ID: 983726599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:170936933-170936955 |
| Sequence | ATGATCAGTCATGCCTAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983726596_983726599 | 11 | Left | 983726596 | 4:170936899-170936921 | CCTGGTCTGGCTGTTCTTTCTGC | No data | ||
| Right | 983726599 | 4:170936933-170936955 | ATGATCAGTCATGCCTAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983726599 | Original CRISPR | ATGATCAGTCATGCCTAAGG AGG | Intergenic | ||