ID: 983726599

View in Genome Browser
Species Human (GRCh38)
Location 4:170936933-170936955
Sequence ATGATCAGTCATGCCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983726596_983726599 11 Left 983726596 4:170936899-170936921 CCTGGTCTGGCTGTTCTTTCTGC No data
Right 983726599 4:170936933-170936955 ATGATCAGTCATGCCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983726599 Original CRISPR ATGATCAGTCATGCCTAAGG AGG Intergenic