ID: 983730684

View in Genome Browser
Species Human (GRCh38)
Location 4:170990221-170990243
Sequence ATCTATTGGCAGCCTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983730677_983730684 15 Left 983730677 4:170990183-170990205 CCCCAATCACTTCTAGCTTGTAA No data
Right 983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG No data
983730678_983730684 14 Left 983730678 4:170990184-170990206 CCCAATCACTTCTAGCTTGTAAA No data
Right 983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG No data
983730679_983730684 13 Left 983730679 4:170990185-170990207 CCAATCACTTCTAGCTTGTAAAG No data
Right 983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983730684 Original CRISPR ATCTATTGGCAGCCTGATGG GGG Intergenic
No off target data available for this crispr