ID: 983737595

View in Genome Browser
Species Human (GRCh38)
Location 4:171082394-171082416
Sequence ACATGGCCAGAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983737595_983737604 30 Left 983737595 4:171082394-171082416 CCTTGCTCCTTCTCTGGCCATGT No data
Right 983737604 4:171082447-171082469 GCATAATGCTAAGTTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983737595 Original CRISPR ACATGGCCAGAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr