ID: 983755378

View in Genome Browser
Species Human (GRCh38)
Location 4:171328650-171328672
Sequence AGGAAGAGCAAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983755370_983755378 21 Left 983755370 4:171328606-171328628 CCCCAGGCAGGGCCATGTGGAGA No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data
983755367_983755378 28 Left 983755367 4:171328599-171328621 CCCTCAACCCCAGGCAGGGCCAT No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data
983755372_983755378 19 Left 983755372 4:171328608-171328630 CCAGGCAGGGCCATGTGGAGAGA No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data
983755371_983755378 20 Left 983755371 4:171328607-171328629 CCCAGGCAGGGCCATGTGGAGAG No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data
983755368_983755378 27 Left 983755368 4:171328600-171328622 CCTCAACCCCAGGCAGGGCCATG No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data
983755373_983755378 9 Left 983755373 4:171328618-171328640 CCATGTGGAGAGAGAAGCTGTGT No data
Right 983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983755378 Original CRISPR AGGAAGAGCAAAGTGAGTGT GGG Intergenic
No off target data available for this crispr