ID: 983755472

View in Genome Browser
Species Human (GRCh38)
Location 4:171329285-171329307
Sequence TGGGGCTCACCCAGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983755472_983755479 4 Left 983755472 4:171329285-171329307 CCACAGGCACTGGGTGAGCCCCA No data
Right 983755479 4:171329312-171329334 CATGCTGGCCTGCAAGGCTTAGG No data
983755472_983755477 -2 Left 983755472 4:171329285-171329307 CCACAGGCACTGGGTGAGCCCCA No data
Right 983755477 4:171329306-171329328 CAGTTCCATGCTGGCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983755472 Original CRISPR TGGGGCTCACCCAGTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr