ID: 983755595

View in Genome Browser
Species Human (GRCh38)
Location 4:171330593-171330615
Sequence GTGTGGAAAGTGTGGATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983755595_983755598 1 Left 983755595 4:171330593-171330615 CCGGGGATCCACACTTTCCACAC No data
Right 983755598 4:171330617-171330639 GACTTTAGCAAATCTGAGCATGG No data
983755595_983755599 2 Left 983755595 4:171330593-171330615 CCGGGGATCCACACTTTCCACAC No data
Right 983755599 4:171330618-171330640 ACTTTAGCAAATCTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983755595 Original CRISPR GTGTGGAAAGTGTGGATCCC CGG (reversed) Intergenic
No off target data available for this crispr