ID: 983757740

View in Genome Browser
Species Human (GRCh38)
Location 4:171362166-171362188
Sequence CTGTTTCAGCAGTAACTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983757740_983757743 -6 Left 983757740 4:171362166-171362188 CCACTCAGTTACTGCTGAAACAG No data
Right 983757743 4:171362183-171362205 AAACAGTTGTTATGGAGGCCTGG No data
983757740_983757744 -5 Left 983757740 4:171362166-171362188 CCACTCAGTTACTGCTGAAACAG No data
Right 983757744 4:171362184-171362206 AACAGTTGTTATGGAGGCCTGGG No data
983757740_983757745 9 Left 983757740 4:171362166-171362188 CCACTCAGTTACTGCTGAAACAG No data
Right 983757745 4:171362198-171362220 AGGCCTGGGTTAGTGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983757740 Original CRISPR CTGTTTCAGCAGTAACTGAG TGG (reversed) Intergenic
No off target data available for this crispr