ID: 983763792

View in Genome Browser
Species Human (GRCh38)
Location 4:171450644-171450666
Sequence CATTATGTGCAGAAATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983763792_983763794 3 Left 983763792 4:171450644-171450666 CCTTGTGATTTCTGCACATAATG No data
Right 983763794 4:171450670-171450692 CTGTTTCACCTTCTGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983763792 Original CRISPR CATTATGTGCAGAAATCACA AGG (reversed) Intergenic
No off target data available for this crispr