ID: 983775805

View in Genome Browser
Species Human (GRCh38)
Location 4:171605773-171605795
Sequence CCTTCTTTAGACTATTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983775803_983775805 17 Left 983775803 4:171605733-171605755 CCAAATATTTCTTCTATATTAAT No data
Right 983775805 4:171605773-171605795 CCTTCTTTAGACTATTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983775805 Original CRISPR CCTTCTTTAGACTATTATTG AGG Intergenic
No off target data available for this crispr