ID: 983779046

View in Genome Browser
Species Human (GRCh38)
Location 4:171644970-171644992
Sequence AGTTTTGTTTTTTCACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983779046_983779049 1 Left 983779046 4:171644970-171644992 CCCTTAGGTGAAAAAACAAAACT No data
Right 983779049 4:171644994-171645016 ATAATGGCAGTTAATGAGAGAGG No data
983779046_983779050 13 Left 983779046 4:171644970-171644992 CCCTTAGGTGAAAAAACAAAACT No data
Right 983779050 4:171645006-171645028 AATGAGAGAGGAGTACAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983779046 Original CRISPR AGTTTTGTTTTTTCACCTAA GGG (reversed) Intergenic
No off target data available for this crispr