ID: 983779050

View in Genome Browser
Species Human (GRCh38)
Location 4:171645006-171645028
Sequence AATGAGAGAGGAGTACAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983779046_983779050 13 Left 983779046 4:171644970-171644992 CCCTTAGGTGAAAAAACAAAACT No data
Right 983779050 4:171645006-171645028 AATGAGAGAGGAGTACAACGAGG No data
983779047_983779050 12 Left 983779047 4:171644971-171644993 CCTTAGGTGAAAAAACAAAACTA No data
Right 983779050 4:171645006-171645028 AATGAGAGAGGAGTACAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983779050 Original CRISPR AATGAGAGAGGAGTACAACG AGG Intergenic
No off target data available for this crispr