ID: 983781403

View in Genome Browser
Species Human (GRCh38)
Location 4:171674501-171674523
Sequence GAACCCCAGGCTCCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983781394_983781403 13 Left 983781394 4:171674465-171674487 CCATGGTGCTCCCTATCCTGTAC No data
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781395_983781403 3 Left 983781395 4:171674475-171674497 CCCTATCCTGTACCCATATAAAC 0: 64
1: 137
2: 228
3: 377
4: 676
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781399_983781403 -10 Left 983781399 4:171674488-171674510 CCATATAAACCCTGAACCCCAGG 0: 24
1: 26
2: 83
3: 150
4: 268
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781393_983781403 22 Left 983781393 4:171674456-171674478 CCTTTGGGTCCATGGTGCTCCCT No data
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781397_983781403 -3 Left 983781397 4:171674481-171674503 CCTGTACCCATATAAACCCTGAA 0: 17
1: 26
2: 100
3: 174
4: 372
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781398_983781403 -9 Left 983781398 4:171674487-171674509 CCCATATAAACCCTGAACCCCAG 0: 21
1: 28
2: 83
3: 155
4: 293
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data
983781396_983781403 2 Left 983781396 4:171674476-171674498 CCTATCCTGTACCCATATAAACC 0: 75
1: 209
2: 289
3: 520
4: 722
Right 983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983781403 Original CRISPR GAACCCCAGGCTCCAGAAGC AGG Intergenic
No off target data available for this crispr