ID: 983786251

View in Genome Browser
Species Human (GRCh38)
Location 4:171733235-171733257
Sequence TTATTATTCCAGAGCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983786251_983786256 26 Left 983786251 4:171733235-171733257 CCAATAAAGCTCTGGAATAATAA No data
Right 983786256 4:171733284-171733306 GTCTCAGATACTACTAAATAGGG No data
983786251_983786257 27 Left 983786251 4:171733235-171733257 CCAATAAAGCTCTGGAATAATAA No data
Right 983786257 4:171733285-171733307 TCTCAGATACTACTAAATAGGGG No data
983786251_983786255 25 Left 983786251 4:171733235-171733257 CCAATAAAGCTCTGGAATAATAA No data
Right 983786255 4:171733283-171733305 AGTCTCAGATACTACTAAATAGG No data
983786251_983786254 -10 Left 983786251 4:171733235-171733257 CCAATAAAGCTCTGGAATAATAA No data
Right 983786254 4:171733248-171733270 GGAATAATAACGGGATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983786251 Original CRISPR TTATTATTCCAGAGCTTTAT TGG (reversed) Intergenic
No off target data available for this crispr