ID: 983795540

View in Genome Browser
Species Human (GRCh38)
Location 4:171857469-171857491
Sequence CCTTATCAGCCCACTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983795540 Original CRISPR CCTTATCAGCCCACTCCTTA TGG (reversed) Intronic
902537790 1:17131237-17131259 CCTTGTGAGCCCACTCCTTGTGG + Intergenic
903615890 1:24656194-24656216 CCTTATCTCCCCACTCCCCAAGG + Intronic
905465808 1:38152279-38152301 CCTTATAAGACCAATCCCTAAGG - Intergenic
912218908 1:107649650-107649672 CATTATCAGTCCACTCATAAAGG + Intronic
915524332 1:156466853-156466875 CCTCCTCAGCCCTCTCCTCATGG + Exonic
922503223 1:226111522-226111544 GATTATCAGCCCACTGCTCAGGG + Intergenic
1064420539 10:15186938-15186960 CCTCACCAGCCCACTCCACATGG - Intergenic
1066204707 10:33176859-33176881 CCAAAGCAGCCCACTCCTCAGGG + Intergenic
1071918854 10:90326914-90326936 CAATAACAGCCCAGTCCTTAGGG - Intergenic
1073918035 10:108428703-108428725 ACTTATCTGCCCCCTCCTCAGGG - Intergenic
1078543720 11:12231235-12231257 CATTCTGAGCCCACTCCTTGGGG + Intronic
1085766511 11:79287905-79287927 ACACATCAGCCCACACCTTAAGG + Intronic
1085843106 11:80036687-80036709 CCTCATCAGCCCTTTCCTGAGGG - Intergenic
1086801761 11:91184527-91184549 CCTCATGAACCCACTCCATAAGG - Intergenic
1090659100 11:128869325-128869347 CCTCCTCAGCCCACCCCCTAGGG + Intergenic
1112926426 13:104680311-104680333 CCTTATCAGTCCAGTCTTCAAGG + Intergenic
1113450047 13:110402691-110402713 TCTTATGAGCCCTCACCTTACGG + Intronic
1113617963 13:111694466-111694488 CCTCCTCAGCCCACTCCATGTGG - Intergenic
1113623496 13:111779727-111779749 CCTCCTCAGCCCACTCCATGTGG - Intergenic
1116803417 14:49466957-49466979 CTTTCTCATCCCAATCCTTAGGG - Intergenic
1117503177 14:56374500-56374522 CCTTATGAGCCCACTCCACCAGG - Intergenic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1125613270 15:40987270-40987292 CGTTCTCAACCCACTCCTCAGGG + Intronic
1129715445 15:77845788-77845810 CCCTATGAGCCCATTCCTTATGG + Intergenic
1139822110 16:69728880-69728902 GCTTCTCAGACCACTCCTGATGG - Intergenic
1147028993 17:37615310-37615332 TCATATCAGCCCCCTGCTTAAGG - Intronic
1147326676 17:39672988-39673010 CCTTCCTTGCCCACTCCTTAGGG - Intronic
1152343851 17:79739802-79739824 TCTTCTCAGTCCACTCCTTCTGG - Intronic
1152673235 17:81622057-81622079 CCTCATCACACCACTCATTATGG - Intronic
1152935247 17:83132880-83132902 CCTCCTCAACCCACTCCTCAGGG + Intergenic
1159520738 18:69518421-69518443 CCTCAACAGCCCCCTTCTTATGG + Intronic
1161989565 19:7677018-7677040 CCTCATCTGCCCACACCTTCCGG + Exonic
1163632651 19:18425192-18425214 CCTTCGCAGCCCCCTCCTTCAGG + Intronic
1163817248 19:19474369-19474391 CCTTACCATCCCACTCCAGAAGG + Intronic
1165663838 19:37608641-37608663 CCTTATCACTGCACTCCTAAAGG - Intronic
1166891975 19:45999526-45999548 CCTTGGCAGCCCACACCTGATGG - Intronic
925263603 2:2548816-2548838 CCTTCTCAGCCCACTCAATGTGG - Intergenic
925493444 2:4421233-4421255 CCTTGTCAGACCATTCCTTCTGG + Intergenic
929352510 2:40975304-40975326 CCTGATCAGTCCAGTCCCTAGGG + Intergenic
931703673 2:64928686-64928708 CCTGATCACCCTACTCCTTTTGG + Intergenic
935296722 2:101656270-101656292 CCCTAACAGCCTTCTCCTTAAGG + Intergenic
939116253 2:138064677-138064699 CCTTAACAACCCACACTTTATGG - Intergenic
940895955 2:159081935-159081957 CCTTCTCAGCCCACTCGATCAGG + Intronic
941605575 2:167592416-167592438 CTTTATCAGCCCACTTTCTATGG + Intergenic
946037908 2:216758652-216758674 CCTGAACAGCCCACTCCCTAAGG + Intergenic
1168863242 20:1061388-1061410 CCTCATCAGCCCAGTGCTCAAGG + Intergenic
1173021664 20:39272577-39272599 CCTTATTGGACCACTCCTAAGGG + Intergenic
954452319 3:50578417-50578439 CCTCATCAGCCAATTCCTGATGG - Intronic
960881924 3:122354096-122354118 CCTTATCACCCTGCTCCTTCAGG + Intergenic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
966772613 3:183517513-183517535 CCTTTTCTGCCCACTCCATGAGG - Intronic
971674466 4:29607696-29607718 CCTCATCAGCCAATTCATTAGGG + Intergenic
974170578 4:58261474-58261496 CTATAACTGCCCACTCCTTAAGG + Intergenic
974199629 4:58622268-58622290 CCTCATCAACCCACTCCTCCAGG + Intergenic
978528659 4:109692607-109692629 CCTCTTCAGCCCATTCCTCATGG + Intronic
983795540 4:171857469-171857491 CCTTATCAGCCCACTCCTTATGG - Intronic
985150903 4:186946118-186946140 CCTTTTCTGCCCGCTCCTTGAGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986807448 5:11321885-11321907 CCCTATCTCCCCACTCCTTATGG + Intronic
988485867 5:31667709-31667731 CCTCAACAGCTCACTCCTGAAGG + Intronic
993372344 5:87108400-87108422 GCTTATCTGCCCACTACTGAGGG + Intergenic
993554628 5:89320628-89320650 TCTGGTCTGCCCACTCCTTAAGG + Intergenic
995918029 5:117274625-117274647 CCTGGTCAGCACACTCCTTTTGG - Intergenic
996345999 5:122489318-122489340 CCTTCTCTGGCCACTCCTTGAGG - Intergenic
1007069144 6:39022460-39022482 CCTTCTCAGCCCACTCAATCAGG + Intronic
1008851875 6:56032429-56032451 CCTTACCAGCCCATTACTAAAGG - Intergenic
1011352240 6:86435320-86435342 CCTTCTCAGCCCACTCAATCAGG + Intergenic
1011794492 6:90937531-90937553 ATTTATCAGCCCACTATTTAGGG - Intergenic
1019217498 6:170453318-170453340 CCTTCTCATCCCAATCTTTAAGG + Intergenic
1022508144 7:30919377-30919399 CCTTGTAAGCCCACTACTCAAGG - Intronic
1023557688 7:41440038-41440060 CCTTATCAACTCACTGCCTAGGG + Intergenic
1024304444 7:47915384-47915406 TTATATCAGCCCACTCCTTGTGG + Intronic
1024665740 7:51545223-51545245 CCTTGTCAGCCCAGTCCTCCAGG - Intergenic
1028307716 7:89286991-89287013 CCTTCTCAGCCTACTCAATATGG + Intronic
1034477189 7:151292217-151292239 CCTTAGCAGCCCTATCTTTATGG + Intergenic
1037304742 8:17493585-17493607 CCATATCTGCCCATCCCTTAAGG - Intergenic
1039031746 8:33317000-33317022 CCTCATCAACCCCCTTCTTAAGG + Intergenic
1045344978 8:101285763-101285785 CCTTATCAGCCCCCAACCTATGG - Intergenic
1049258328 8:141625551-141625573 ACTTATCTGCCTGCTCCTTAGGG + Intergenic
1049404905 8:142447978-142448000 CCATATCAGTCCCCTCCTCAAGG - Intergenic
1055208435 9:73761758-73761780 CCTCATGAGCCCACTCCATCAGG + Intergenic
1061325107 9:129858928-129858950 CCTTGTCAACCCTCTCCATAAGG - Intronic
1195361428 X:104086304-104086326 CCTCATGAGCCCACTCCATCGGG - Intergenic
1196152956 X:112394026-112394048 CCTTGTGAGCCCACTCCTCCAGG - Intergenic
1196828156 X:119757397-119757419 CCAAATCAGCCCACTCCCTCGGG - Intergenic
1198892009 X:141407390-141407412 CTTTGTCATTCCACTCCTTAAGG + Intergenic