ID: 983797948

View in Genome Browser
Species Human (GRCh38)
Location 4:171889098-171889120
Sequence AAATTTTAATAGATGTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983797948 Original CRISPR AAATTTTAATAGATGTCAGT AGG Intronic
900887432 1:5424925-5424947 GAATGTTAATGGATGTCAATAGG - Intergenic
901356516 1:8654335-8654357 AAATTTCAAAAGATGTCAGTGGG - Intronic
905046865 1:35011128-35011150 AAATTTTAAAAAATGTTTGTGGG - Intronic
905624627 1:39480216-39480238 ATATTTTAATAAATGTCCTTTGG - Intronic
907572127 1:55492996-55493018 AGATTTTAACAGATATTAGTTGG - Intergenic
907824036 1:57998327-57998349 AAATTTCAAATGATGTCACTGGG + Intronic
907824601 1:58003372-58003394 AAATTTTAAGTAGTGTCAGTTGG - Intronic
909654145 1:78012034-78012056 AGTTTTTAAAAGATGTCAGTTGG - Intronic
909731887 1:78902045-78902067 AAATTTTAATAGATTGCTCTGGG + Intronic
909957405 1:81796731-81796753 AATTATTAATAGCTGTCATTTGG - Intronic
910866040 1:91788999-91789021 AAATTTTAAAAGGGGTCAGCTGG + Intronic
911186135 1:94906812-94906834 AAATATTAATTGATGTCATTTGG - Intronic
911522375 1:98944159-98944181 AAATCTTTATTGATGTCATTAGG - Intronic
912098774 1:106179954-106179976 TGATTTTATTAGATATCAGTGGG + Intergenic
912981131 1:114374216-114374238 AATTGTTAAAAGCTGTCAGTAGG - Intergenic
913027434 1:114858535-114858557 ATATTTTAATAGAATTCAGAGGG + Exonic
915812944 1:158935382-158935404 AAATATTGAAAGATTTCAGTGGG + Intronic
918026300 1:180751640-180751662 AAATTTTAAATGCTATCAGTAGG - Intronic
918592494 1:186255710-186255732 AAATTTAAATTAATTTCAGTGGG + Intergenic
919319275 1:196014230-196014252 AAATATTAATATATGTCATTGGG - Intergenic
919434236 1:197536689-197536711 AAATTATAATAGATATTAGTAGG + Intronic
919671741 1:200344575-200344597 AAATTTTTAAACATTTCAGTAGG + Intergenic
920274239 1:204792184-204792206 ATATTTTAAAAGCTGTTAGTCGG + Intergenic
920595152 1:207261576-207261598 TAATTTTATTAGATGTTTGTTGG - Intergenic
921705237 1:218315046-218315068 AATTTTTAATAGAAGTCCCTAGG + Intronic
923587296 1:235285073-235285095 AAATTTTAAAAAAAGTCAGCTGG - Intronic
923977442 1:239279363-239279385 AAATTTTGGTAGAAGTCATTTGG - Intergenic
924807760 1:247374638-247374660 AATTTTTAAAAAATTTCAGTTGG + Intergenic
924871438 1:248050820-248050842 AAATTTTCATAAATGTCATTTGG - Intronic
1063068620 10:2636490-2636512 AAATTTCAATTGTTGTGAGTTGG + Intergenic
1063898017 10:10702574-10702596 AAATTTTATTAGAACTCAGGTGG + Intergenic
1065193089 10:23233267-23233289 AAATTTAAAAAGATGTCATCAGG - Intronic
1066501379 10:35998139-35998161 AAATCTTAATAGAAGACAGCTGG + Intergenic
1066525880 10:36279131-36279153 AAATTTTATTAAATTTTAGTAGG - Intergenic
1066629251 10:37442451-37442473 AAATCTTAATAGAAGACAGCTGG + Intergenic
1068183131 10:53548142-53548164 AACTTTTAATAGATTTTTGTGGG + Intergenic
1068282228 10:54888658-54888680 AAATTCTAATAGATGTGTGGTGG + Intronic
1068953339 10:62800325-62800347 TAAATTTAATAGATGTGGGTAGG + Intergenic
1069890240 10:71648067-71648089 AAATATTAATAACTGTCAGAGGG - Intronic
1070980491 10:80641868-80641890 AAATTTTAATTGATAGAAGTTGG - Intronic
1071166361 10:82811998-82812020 AAACTTAAAGAGATGTCAGCTGG + Intronic
1072871583 10:99125924-99125946 AAATTATTACAGATTTCAGTTGG - Intronic
1073799864 10:107029608-107029630 AAGTTTCAATATATGTCTGTTGG - Intronic
1074310502 10:112318532-112318554 AATGTTTAATAAATGTCAGTAGG - Intergenic
1074570237 10:114617673-114617695 AAATGTTAATGAAAGTCAGTTGG - Intronic
1074621305 10:115125937-115125959 TCATTTTACTAGATTTCAGTTGG + Intronic
1074953169 10:118360918-118360940 AAATTTTAAAAGGTGTAAATAGG - Intergenic
1075110985 10:119584279-119584301 GAATTTTAATATCTGACAGTTGG - Intronic
1075359696 10:121819816-121819838 AAATTTTAATAGGTTTTTGTTGG - Intronic
1079815752 11:25055307-25055329 AAATTTTAAAAGATTAAAGTAGG - Intronic
1080127174 11:28749670-28749692 AAATTTCAATAGAATGCAGTGGG + Intergenic
1080201619 11:29678060-29678082 AACTTTAAAGAGAGGTCAGTAGG + Intergenic
1080225562 11:29956442-29956464 AAATGTTAATAGATACCAGGGGG + Intergenic
1081066627 11:38549373-38549395 AAATTTTAAAATATGACTGTAGG - Intergenic
1082627949 11:55506916-55506938 TAATTTAAATATATGTCAATGGG - Intergenic
1082639013 11:55631758-55631780 AATGTTTTATAGATGTCAGTTGG - Intergenic
1082770000 11:57200587-57200609 AAAATTTAAAAAATGTAAGTGGG + Intergenic
1083396180 11:62393778-62393800 AAATATTAATAAATTTCTGTTGG - Intergenic
1085002040 11:73046613-73046635 AAATTTTAATAGATATTAGTAGG - Intronic
1086108380 11:83171720-83171742 AAATATTCATAGATGTCACAAGG - Intronic
1086890636 11:92254198-92254220 CAATTTCAATAGATGACAGAAGG - Intergenic
1087118878 11:94552115-94552137 TAATTTAAATAACTGTCAGTAGG + Intronic
1087417864 11:97881465-97881487 AAATTTTAATAGCTGTTAAGTGG - Intergenic
1087643283 11:100778518-100778540 ACTTTTTAATAGCTCTCAGTTGG + Intronic
1087850429 11:103022081-103022103 TAATTTTAGTAGATGTGAGGTGG - Intergenic
1087869348 11:103272831-103272853 AAAAATTAATAAATGACAGTAGG - Intronic
1088074511 11:105830377-105830399 AAACTTTAATAAATTTTAGTTGG - Intronic
1090986775 11:131774130-131774152 AATTCTTCATAAATGTCAGTGGG + Intronic
1091033166 11:132209753-132209775 CAATTTTAATAGATGTGGATAGG + Intronic
1091942158 12:4497061-4497083 AAATGTCAAAAGATGTCTGTTGG + Intronic
1092549310 12:9480576-9480598 AAAATGTAATAAATGCCAGTGGG - Intergenic
1094104702 12:26798397-26798419 AAATTATGATACATGTCAGAGGG - Intronic
1094426421 12:30321323-30321345 AAATCTTCATGGATGTGAGTTGG - Intergenic
1094521956 12:31200537-31200559 AAAATGTAATAAATGCCAGTGGG + Intergenic
1096343667 12:50825971-50825993 AAATTCTAAGAGCTGTCAGTTGG - Intergenic
1096346229 12:50849254-50849276 AGGTTTTAGTAGATATCAGTGGG - Intronic
1096670771 12:53197110-53197132 AAATTTGAATAGAGGAGAGTTGG + Intronic
1097566983 12:61282615-61282637 AAATTTTAATATATTTGAATGGG + Intergenic
1098195557 12:67997401-67997423 AAATTTTAATAGATGGTTCTGGG + Intergenic
1099066528 12:77987371-77987393 TAATTTTCATATTTGTCAGTTGG + Intronic
1099402783 12:82220545-82220567 AAATTCTAATGTATGTTAGTTGG - Intergenic
1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG + Intergenic
1099868017 12:88308749-88308771 AAATTTTCATTGATGTAACTTGG + Intergenic
1099907183 12:88785466-88785488 AAATTTTGAAAGAAGTCAGGGGG + Intergenic
1100945551 12:99778921-99778943 AGGTTTTATTAGGTGTCAGTTGG - Intronic
1102504795 12:113377054-113377076 GAATTTTATTAGATGCCAGCTGG - Intronic
1103069716 12:117931116-117931138 AAATGTTTTTAGATGTCTGTGGG - Intronic
1103310985 12:120008052-120008074 AAATTTAAATAGCTGTTATTTGG - Intronic
1104119839 12:125788812-125788834 ATATTTTAAAAGATGGCAGTGGG + Intergenic
1105562008 13:21501082-21501104 AATTATTAATAAATGGCAGTAGG - Intronic
1105954450 13:25267357-25267379 AATATTTAATAGATTTGAGTGGG - Intronic
1107906310 13:45064395-45064417 GAAATTTAAAAGATGTCAGAAGG - Intergenic
1107917831 13:45170388-45170410 AAATTTTAAAAGATGTTAAGTGG - Intronic
1108105874 13:47008525-47008547 AAATTTTAACAGCTGTGTGTGGG + Intergenic
1108233742 13:48379386-48379408 AAATTTTAGTAATTGTCAGCTGG + Intronic
1108616290 13:52136200-52136222 AAATCTTCATAGACGACAGTGGG - Exonic
1109457888 13:62617113-62617135 AAATTTAAATATATTTCATTGGG - Intergenic
1109846506 13:67998619-67998641 AAATTTTAATATTTTTCAATGGG - Intergenic
1110446292 13:75585227-75585249 GAATTTTAATGTATCTCAGTAGG - Intronic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1110679752 13:78295244-78295266 AAATTTTATTAGTTATCAGAAGG - Intergenic
1111794638 13:92902479-92902501 AAATTTTGGTAGAGCTCAGTGGG + Intergenic
1112713106 13:102152865-102152887 TAATTTTAAAAGATGTGAGGGGG + Intronic
1114909532 14:27172790-27172812 AAATTTTAAAAAATGTTTGTGGG + Intergenic
1115074367 14:29368774-29368796 AAATTTTATTAGTTGTCAAAGGG + Intergenic
1115737244 14:36346368-36346390 AAAGTTAAATAGATAGCAGTGGG + Intergenic
1116577685 14:46595887-46595909 AAATTCTAACAGATGTGAGTTGG + Intergenic
1116737160 14:48706570-48706592 AAATTTTCACAGAAGACAGTGGG - Intergenic
1117693774 14:58338182-58338204 AAAATTCAACAGATGTCTGTAGG + Intronic
1118946491 14:70392810-70392832 CAATTGAAACAGATGTCAGTTGG + Intronic
1119063245 14:71498025-71498047 CCATTTTAATAGGTGTGAGTGGG + Intronic
1119154981 14:72401940-72401962 AGATTTTAAAAGGTGTGAGTAGG + Intronic
1119772728 14:77230917-77230939 AAATTTTTATACATGTCTCTAGG + Intronic
1120011534 14:79421256-79421278 ATATTTTAATATACTTCAGTGGG + Intronic
1122431270 14:101647961-101647983 AAAAATTAATAGATGGTAGTAGG + Intergenic
1122679216 14:103444428-103444450 AATCTTAAATAGATGTTAGTTGG - Intronic
1122867796 14:104616475-104616497 AAATCATAATAAATGTCAGTGGG - Intergenic
1202876101 14_KI270722v1_random:2312-2334 AAATCTAAATAGAAGCCAGTTGG + Intergenic
1202881757 14_KI270722v1_random:67310-67332 AAATTTCAATAGATGCCAATTGG - Intergenic
1123633698 15:22280891-22280913 AAATTTCAAAAGATGTCAGTGGG + Intergenic
1123956617 15:25342595-25342617 AGATTTTTAGAGATGTGAGTAGG - Intronic
1124401543 15:29352800-29352822 AAATTCTAAAAGATGTCTGAAGG - Intronic
1125457576 15:39876266-39876288 AATTTTGAATATATGTTAGTAGG - Intronic
1125653124 15:41333551-41333573 AAATTTTTATTGATGACTGTTGG + Intronic
1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG + Intergenic
1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG + Intergenic
1126241993 15:46455626-46455648 ATATTTTAATGGATGTGAGACGG - Intergenic
1128198539 15:65783290-65783312 ATAAGTTAATAGATGTCAGATGG + Intronic
1130629608 15:85553414-85553436 AAATTTTAATAAATATTTGTTGG + Intronic
1130784353 15:87079738-87079760 AAATTGTAATGGATCTCACTGGG + Intergenic
1131562172 15:93454386-93454408 AAATATTAATAGAAGTTAGATGG + Intergenic
1135524278 16:23202225-23202247 AAATATTGATAGATGACAGATGG + Intronic
1137867138 16:51910827-51910849 AAATTTTAATAAATGCCTTTGGG + Intergenic
1137889061 16:52139407-52139429 ATATATTAATACATATCAGTTGG + Intergenic
1138551282 16:57750040-57750062 GTATTTGAGTAGATGTCAGTGGG - Intronic
1138894438 16:61186133-61186155 AAATATTAATAGAATTCAGGTGG + Intergenic
1139146208 16:64328456-64328478 GGCTTTTAATAAATGTCAGTTGG - Intergenic
1140107147 16:71971323-71971345 ATATTTAAAAATATGTCAGTAGG + Intronic
1140136938 16:72214756-72214778 ACATTATAAGAGATGTCAGCAGG + Intergenic
1141279107 16:82614574-82614596 AAACTTTAAAAAATATCAGTTGG - Intergenic
1141841793 16:86578441-86578463 AAATTTTAATTAATGTGGGTGGG + Intronic
1142660157 17:1423438-1423460 AAAATTGTATAGATGGCAGTTGG + Exonic
1144105199 17:11978070-11978092 AAACTTTAATAGACATCAGAGGG - Exonic
1146545169 17:33732036-33732058 AAATTTATATAGATGTAATTTGG + Intronic
1148146437 17:45367893-45367915 AAATTTTAAGAGATATCAATAGG + Intergenic
1149239164 17:54628688-54628710 GACTTTGAATAAATGTCAGTGGG - Intergenic
1149732586 17:58961075-58961097 TAATTTTAAAGGATGTCACTTGG - Intronic
1150860102 17:68792500-68792522 GAATTTGAATATATGGCAGTTGG + Intergenic
1151102513 17:71572113-71572135 GAATTTTAAGAGATGTTTGTAGG + Intergenic
1153859650 18:9188522-9188544 AAATGTTAATAGCTATCTGTAGG - Intronic
1154030703 18:10751439-10751461 AAATGTAAATTGATGTCAGAGGG + Intronic
1154990499 18:21593952-21593974 AAATGTTAATAGTGGTGAGTTGG - Intronic
1155218826 18:23666369-23666391 AAATTTTAAAAGATGTGGGATGG - Intergenic
1155691137 18:28624401-28624423 ATATTTTAATAGGTATTAGTGGG - Intergenic
1157273193 18:46292365-46292387 AAATTTTAATAGAGGTGGATTGG + Intergenic
1158835917 18:61332260-61332282 ATATTTTAATAGCTTTCAGCAGG - Intergenic
1162260202 19:9526816-9526838 AAATTTTCATAGAAGCCAGAGGG + Intergenic
1162853670 19:13451489-13451511 AACTTTTATTAGATTCCAGTAGG - Intronic
1164876029 19:31690152-31690174 AAATTTTATTAGATGTCTTTTGG + Intergenic
1168386781 19:55970256-55970278 AAATTTTAAAAAAAGTTAGTTGG - Intronic
1202657368 1_KI270708v1_random:36409-36431 AAATTTCAATAGAGGCCAATTGG - Intergenic
925011769 2:490914-490936 ATATTTCAATAGATGACATTGGG + Intergenic
925648444 2:6062604-6062626 AAGTTATAAAAGATGTCAGAAGG + Intergenic
927071409 2:19533762-19533784 AAATATAAATCTATGTCAGTTGG + Intergenic
927124398 2:20000114-20000136 AAACTTTAGTGGAAGTCAGTTGG - Intronic
927225652 2:20763542-20763564 AAAATATAATAGATGACACTGGG - Intronic
928646624 2:33360233-33360255 AAATTTTTATTGATTTAAGTAGG + Intronic
928824851 2:35407413-35407435 AGATTTTAGTTGATGCCAGTGGG + Intergenic
929837375 2:45417536-45417558 AAATTATAATAGAGGTCATATGG - Intronic
929846665 2:45537347-45537369 GTATTTTTATATATGTCAGTTGG - Intronic
929992947 2:46804728-46804750 AAATTTTAAAACATTTTAGTGGG - Intergenic
930109069 2:47662822-47662844 AAATTTTTAAAAATGCCAGTTGG - Intergenic
930680453 2:54252330-54252352 GAATTTTAATAGCTGACACTGGG - Intronic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
931106280 2:59059870-59059892 AAATTCTAATCAATGTCAATGGG - Intergenic
932304753 2:70694199-70694221 GACTTTCAAGAGATGTCAGTTGG - Intronic
932473818 2:71986993-71987015 AAATTTTAACACATCTCTGTTGG + Intergenic
933377821 2:81502473-81502495 GAATTTTAATAGAAATCAGCTGG - Intergenic
933521208 2:83376681-83376703 ATTTGTTAATAGATTTCAGTTGG - Intergenic
934057638 2:88265391-88265413 AAAGTTAAATAAGTGTCAGTTGG - Intergenic
935106497 2:100049753-100049775 AAATTTTAAAAAATCACAGTTGG + Intronic
935116209 2:100138641-100138663 AAATCTTAAAAGATACCAGTAGG + Intronic
935603484 2:104946572-104946594 AAAATTTAATCCATGTTAGTGGG + Intergenic
936274692 2:111084358-111084380 AGCATTTAATAAATGTCAGTAGG + Intronic
936727961 2:115345152-115345174 AAATTTTAATTGAAATCAATTGG + Intronic
939421464 2:141976263-141976285 AAATTTTGCAAGATGTCAGCAGG + Intronic
939584134 2:143986509-143986531 AAATAGTAATAGATGTGATTTGG - Intronic
939767666 2:146272213-146272235 AAATTTTAAAACATGCCAATTGG + Intergenic
939770771 2:146314199-146314221 AAATTTTAATCAATGTGAGTGGG + Intergenic
940136144 2:150437584-150437606 AAATTTTAATAGGAGTGGGTGGG + Intergenic
940163871 2:150746122-150746144 AAATTTTAATAGATGTATAATGG - Intergenic
940976421 2:159950270-159950292 AAATTTTAATCCTTGCCAGTGGG - Intronic
942392976 2:175515445-175515467 AAATTTTAATGGATGTCTATTGG + Intergenic
944533289 2:200685157-200685179 TAATGTTAATAGATGTCAGAGGG - Intergenic
944833267 2:203554201-203554223 AACTATTAAAAGATGTCTGTTGG + Intergenic
945054169 2:205853685-205853707 AAATTTTTATACATGTCTTTGGG + Intergenic
948060061 2:235036453-235036475 GAATTTTTAAAAATGTCAGTGGG + Intronic
1170635118 20:18097676-18097698 ACCTTTTAATAGATGTCTTTTGG + Intergenic
1170670573 20:18428949-18428971 CATTTTTAATAGCAGTCAGTTGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171137014 20:22703966-22703988 AAATTTTAATAGGTGTGTGGTGG + Intergenic
1171996335 20:31734575-31734597 ACATTTTAATAGTTGTCAATAGG + Intergenic
1173285111 20:41663721-41663743 AAATTTTAATAGCTATTACTAGG - Intergenic
1174872204 20:54193304-54193326 CAATTTTAATAAATGTCATATGG - Intergenic
1176597239 21:8758753-8758775 AAATTTCAATAGAGGCCAATTGG - Intergenic
1176637379 21:9259683-9259705 AAATCTAAATAGAAGCCAGTTGG + Intergenic
1176643056 21:9324715-9324737 AAATTTCAATAGAGGCCAATTGG - Intergenic
1176787368 21:13273462-13273484 AAAACTAAATAGTTGTCAGTTGG + Intergenic
1177153380 21:17477273-17477295 AAATTTTAATAAATTTCCATAGG - Intergenic
1177340040 21:19786375-19786397 AAATTATACTAGAGGTCAATGGG + Intergenic
1177614120 21:23494516-23494538 AAATTTAAATAGATATTACTTGG + Intergenic
1177945684 21:27467179-27467201 AATTTTTCTTAAATGTCAGTTGG + Intergenic
1178207153 21:30481775-30481797 AAATTTTAAAATGTGTCATTCGG - Intronic
1178294659 21:31399209-31399231 AAATTTTAGTATATCTCAGGGGG - Intronic
1180369878 22:11974501-11974523 AAATTTCAATAGAGGCCAATTGG + Intergenic
1180376366 22:12097604-12097626 AAATTTCAATAGAGGCCAATTGG - Intergenic
1180421207 22:12816081-12816103 AAATTTCAATAGAGGCCAATTGG + Intergenic
1181146354 22:20850735-20850757 AAATTTTAAAAAATTTTAGTAGG - Intronic
1181974111 22:26716429-26716451 AAATTTTAATAGATGGCATGGGG - Intergenic
1182331817 22:29556222-29556244 AAATTTTAATAGTTATCTGTTGG + Intronic
1182960778 22:34472939-34472961 AAATTTTAACAGATGGAAATTGG + Intergenic
949239690 3:1855654-1855676 GAATTTTAACAGATGACAGTTGG + Intergenic
949281176 3:2349056-2349078 AAATTTTAAAAGACTTCAGCTGG - Intronic
949713607 3:6901241-6901263 AAATATTAATAGATATAATTTGG + Intronic
951261854 3:20519282-20519304 AAATTTTTTTAAATTTCAGTAGG + Intergenic
953819862 3:46197904-46197926 AATATTTAATAAATGTCAGTTGG - Intronic
954981200 3:54747182-54747204 ACATTTTAAAAAATGTCCGTGGG - Intronic
957097027 3:75785868-75785890 AAATTTCAATAGAGGCCAATTGG + Intergenic
957103510 3:75857361-75857383 AAATCTAAATAGAAGCCAGTTGG - Intergenic
957598715 3:82303986-82304008 AAATATTTATAGATGACATTTGG + Intergenic
957973335 3:87410891-87410913 AAAAATTAATAGATATCAGATGG + Intergenic
958212497 3:90505498-90505520 AAATTTTAAACTATGTGAGTTGG + Intergenic
959667693 3:108939993-108940015 ACATTTAAATGTATGTCAGTGGG + Intronic
963703124 3:148651505-148651527 ACATTTTAACAAATGTCACTGGG - Intergenic
964308741 3:155369747-155369769 AAACTTTAAAAGATGCCACTTGG + Intergenic
965482754 3:169240582-169240604 AAGTTATAATAGATTTCAGATGG - Intronic
966507196 3:180718990-180719012 ATATTTTAATATATATCAGCAGG + Intronic
967060575 3:185868893-185868915 AAACTTGAATAGATGTCACTGGG + Intergenic
967199797 3:187062834-187062856 AAATTGGAAAAAATGTCAGTAGG + Intronic
967237961 3:187406048-187406070 AAATGTTAATAGTTGTCATGGGG + Intergenic
1202743829 3_GL000221v1_random:80314-80336 AAATTTCAATAGAGGCCAATTGG + Intergenic
1202749515 3_GL000221v1_random:145337-145359 AAATCTAAATAGAAGCCAGTTGG - Intergenic
968498774 4:933864-933886 ATATTTTTAAAGATGTCATTTGG - Intronic
971125173 4:23746082-23746104 AAATTTTAATTGGTGTGAGTAGG - Intergenic
971403664 4:26300275-26300297 AAATGTTAATAGTTGGCAGGAGG + Intronic
971676733 4:29640982-29641004 AAATGTTAATATATGTAACTTGG + Intergenic
971820427 4:31546600-31546622 AAATTTTAAAAAAAGACAGTAGG + Intergenic
972001689 4:34044363-34044385 AATGTTAAATAAATGTCAGTGGG + Intergenic
972939344 4:44178059-44178081 GAATTTTAATCCAAGTCAGTAGG - Intronic
973360533 4:49160972-49160994 AAATTTCAATAGAGGCCAATTGG - Intergenic
973399552 4:49626943-49626965 AAATTTCAATAGAGGCCAATTGG + Intergenic
973621486 4:52730876-52730898 AAATTTTAATGGAAGTGGGTAGG - Intronic
973623003 4:52746091-52746113 AAAGTTTTAGAGATGCCAGTAGG + Intronic
974212857 4:58804325-58804347 AAGTTTTTATAGATGTCTTTTGG + Intergenic
974268660 4:59620479-59620501 AAATTTTAATAAAAGTCATGTGG + Intergenic
974829359 4:67171487-67171509 AAATTATAATAAAAGTTAGTAGG + Intergenic
974854716 4:67446563-67446585 AAATTTAATTTGATGTAAGTGGG + Intergenic
974968791 4:68800977-68800999 AAATTTAAATAAATTTCTGTCGG - Intergenic
975049403 4:69841355-69841377 AAAATTTAAGAGATGATAGTAGG + Exonic
975165510 4:71174173-71174195 AAATTTTAAGAGATGTGGCTAGG - Intergenic
975239478 4:72040816-72040838 AAATTTTAAAATCTTTCAGTAGG + Intronic
975858378 4:78649286-78649308 AAATTAATATAGAGGTCAGTTGG - Intergenic
976075386 4:81292697-81292719 AATTTATAATAGATGTCAGTGGG - Intergenic
976480372 4:85536551-85536573 TAATTTTAATAAATGGCTGTTGG + Intronic
977080234 4:92517764-92517786 AAATATTAATACATCTCACTTGG + Intronic
977167507 4:93718890-93718912 AAATTTTAAGAGTTATAAGTGGG - Intronic
977516748 4:98030114-98030136 AGATTTGAATAGCTGTAAGTAGG - Intronic
977659770 4:99570165-99570187 AGATTTTTAAAGATGTCATTTGG + Intronic
977662154 4:99601850-99601872 GAATTTTAATATATGTTAGATGG - Intronic
977795917 4:101164277-101164299 AAATTATAAAAGATGTTAGAAGG - Intronic
977956061 4:103027311-103027333 AAAATTTAACAGTTTTCAGTAGG - Intronic
978607215 4:110493810-110493832 ACATTTCAATAGATTTAAGTAGG - Intronic
978625232 4:110677740-110677762 AAACTTTAAAAAATGACAGTGGG - Intergenic
978632661 4:110765225-110765247 AGATTATAATAGAAATCAGTAGG + Intergenic
979085090 4:116398296-116398318 ACATATTAATATATGTCTGTTGG + Intergenic
980034911 4:127872454-127872476 AAAATTGTATAGATGTCAGCTGG + Intergenic
980138801 4:128890669-128890691 ATATTTTAATATATTCCAGTAGG + Intronic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
981269351 4:142826549-142826571 AAATTTTAAGAGATTTGAATGGG - Intronic
981953285 4:150437866-150437888 AAAGCTTAATAAATGTTAGTTGG + Intronic
982442800 4:155456679-155456701 TAATATTAATAGAGGTCATTTGG + Intergenic
982594680 4:157364790-157364812 TATTTTTAATTGATGTCAATGGG - Exonic
982855887 4:160382369-160382391 ATATTTTAAGAGATGTTATTAGG - Intergenic
983005757 4:162483067-162483089 ATATATTAAAATATGTCAGTTGG - Intergenic
983169977 4:164524510-164524532 AAATTTTAAAAGTGGTCATTTGG + Intergenic
983275496 4:165612371-165612393 ACATTTAAATATATGTCAGATGG + Intergenic
983467709 4:168115319-168115341 AACTTTCAATAGAGGTGAGTTGG - Intronic
983589053 4:169387676-169387698 AATGTTTTATAAATGTCAGTTGG + Intergenic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
984182325 4:176498946-176498968 AAAAATAAATAGATGTCAATTGG + Intergenic
984183242 4:176510976-176510998 AAATTTAAAAAGAAGACAGTAGG + Intergenic
1202752273 4_GL000008v2_random:18104-18126 AAATGTAAATAGAAGCCAGTTGG + Intergenic
1202757965 4_GL000008v2_random:83037-83059 AAATTTCAATAGAGGCCAATTGG - Intergenic
985797971 5:1978265-1978287 AAATTTTAATAGTGATCAATTGG - Intergenic
987786978 5:22513132-22513154 TAATTTCAAGAGATATCAGTGGG - Intronic
989361990 5:40612332-40612354 AAATTTTAAAATATTTCATTTGG + Intergenic
989649832 5:43674947-43674969 AAGTTTTAATAGAAGTAACTGGG - Intronic
989950496 5:50292505-50292527 AAATTTTAATAGATGAATATAGG - Intergenic
990280436 5:54245089-54245111 AAATTTATAAAGATGTCAGGAGG - Intronic
991265743 5:64715063-64715085 AAGTTTTGAAAGATGTCGGTGGG - Intronic
991284872 5:64961692-64961714 AAGTTTTAATTGAAGACAGTAGG + Intronic
991568000 5:68024821-68024843 AACCTTTAATAAATGTGAGTTGG + Intergenic
991637982 5:68725258-68725280 GGATGTTAATAGATGTCACTTGG - Intergenic
991646559 5:68807027-68807049 AAATTTTAATACATCTCTCTCGG + Intergenic
991707008 5:69368250-69368272 TAATTTTAATAGGTATCAGAAGG - Intronic
994357893 5:98815155-98815177 AAATTTGATTAAATATCAGTTGG - Intergenic
994441452 5:99810664-99810686 CTATTTTAATAAATGTCTGTAGG - Intergenic
994769278 5:103961551-103961573 ACATTTTTACAGATGCCAGTGGG + Intergenic
995066432 5:107868387-107868409 AAATTATAATGGATCTCACTTGG + Intronic
995380060 5:111522012-111522034 AAAATTCAATTGATGTCAATTGG + Intergenic
996276812 5:121676663-121676685 AAATTATTATAGCTGTCATTTGG - Intergenic
997124709 5:131214203-131214225 CCATTTTAAAAAATGTCAGTTGG + Intergenic
997148275 5:131462278-131462300 ACTCTTTAATAGATGCCAGTTGG - Intronic
997501439 5:134377891-134377913 GCATTTTAAAAGATGCCAGTTGG + Intronic
998086272 5:139327057-139327079 AAATTTCAATATATCTCAATAGG - Intronic
998215054 5:140231677-140231699 AAAGATGTATAGATGTCAGTAGG + Intronic
1000314612 5:160077193-160077215 AAATTCCAACAGGTGTCAGTAGG - Intronic
1002869100 6:1149562-1149584 AACATTTAAAAGGTGTCAGTTGG - Intergenic
1003490985 6:6621301-6621323 AACTTTTAATACATGTAAGACGG - Intronic
1003938820 6:11003783-11003805 TAATTTTAAGAGTTGTCAGCTGG + Intronic
1004137811 6:12985077-12985099 AAATTTTAGTTGGTTTCAGTTGG - Intronic
1005184240 6:23146119-23146141 TAATTATTATAGATGCCAGTAGG - Intergenic
1005516786 6:26562584-26562606 AGATGTTAATAGATGTTATTTGG - Intergenic
1008180059 6:48317218-48317240 TCATTTTTATAGATGTCACTGGG + Intergenic
1008826966 6:55707534-55707556 AAATTATATTAGAAGACAGTAGG + Intergenic
1010533455 6:76994031-76994053 ATATTTTATTTGCTGTCAGTAGG + Intergenic
1010987838 6:82446129-82446151 ATATTTTAATTCATGTCAGTAGG + Intergenic
1011335822 6:86258789-86258811 CAACTAAAATAGATGTCAGTGGG - Intergenic
1011681176 6:89784806-89784828 AAATTTTAAGAGATGTATGCTGG + Intronic
1011960247 6:93079704-93079726 AAATGTGAATAGACATCAGTTGG - Intergenic
1012503147 6:99913074-99913096 AAATTGTAATAGATGCCTATAGG - Intergenic
1012685903 6:102248145-102248167 AAATATTAATAGAGCTCAGTAGG + Intergenic
1012770636 6:103429204-103429226 AAAAATTAACAGATGTTAGTGGG + Intergenic
1013384755 6:109615274-109615296 ACATTTTAATAGAAGGCAGAAGG - Intronic
1014170638 6:118275308-118275330 AAACTTTACTAAATCTCAGTTGG + Intronic
1014540231 6:122667112-122667134 AAATGTTTATAGATGCCAGATGG + Intronic
1015038069 6:128681647-128681669 AAATTTAAAAAAATGTCATTTGG - Intergenic
1016100084 6:140088993-140089015 AAATTTTAATAGATTTTATCTGG + Intergenic
1016172337 6:141033814-141033836 CAATTTTAATAAATTTTAGTAGG + Intergenic
1016661119 6:146581842-146581864 AAATTTTAGTAGATGTAGATTGG - Intergenic
1017743710 6:157428407-157428429 AAGCTTTAATATATGTCATTAGG + Intronic
1018282763 6:162205859-162205881 CAATTTAAATAGCTGTCTGTGGG + Intronic
1019839196 7:3422394-3422416 AAATCTAAATAAATGTTAGTAGG + Intronic
1021268000 7:18548770-18548792 AAAATGTAATAAATATCAGTGGG + Intronic
1021509012 7:21415117-21415139 AGATTTTTAAAGATGTCATTTGG - Intergenic
1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG + Intronic
1023427877 7:40058292-40058314 AAATTTTATTTGATTGCAGTGGG + Intronic
1025788892 7:64669320-64669342 AAATTTTATGAGATGAAAGTTGG + Intronic
1027955625 7:84875687-84875709 TAATTTTAATAGATGTGATATGG + Intergenic
1027990049 7:85346827-85346849 TAGTTTTAAGACATGTCAGTGGG + Intergenic
1028249026 7:88517882-88517904 AATTTTTAGTAGATTTTAGTTGG + Intergenic
1028765340 7:94551012-94551034 AAATTTTATCATATGTCTGTAGG + Intronic
1028813583 7:95118547-95118569 ATGTTTTAAAAGATGTCACTTGG - Intronic
1029877405 7:103769062-103769084 AAATTTTATTCAAGGTCAGTTGG - Intronic
1030298494 7:107952532-107952554 TAATTTTAAAAAATGCCAGTGGG + Intronic
1030344087 7:108413701-108413723 AAATATTTATTGATGTCTGTTGG - Intronic
1031101127 7:117480788-117480810 ACAATTTATTAAATGTCAGTTGG - Intronic
1032541905 7:132710164-132710186 TAATAATAATAAATGTCAGTTGG - Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1034866115 7:154643884-154643906 ACTTTTTAATAGATGACAGGAGG + Intronic
1035972592 8:4266919-4266941 ATATTTTACTAAATGTCATTTGG - Intronic
1036954435 8:13172108-13172130 AACATTTTATAGATGTCATTTGG + Intronic
1037038711 8:14203483-14203505 AAATTTAAATACATATGAGTGGG - Intronic
1037414418 8:18633913-18633935 AAAAATTAACAGATGCCAGTGGG - Intronic
1037548728 8:19949455-19949477 ATATTTTAATAGGTGTAAGTAGG + Intronic
1038701232 8:29851157-29851179 AAATTTTCATCGATGTAAGTTGG - Intergenic
1038709603 8:29929743-29929765 AAATTTTAAAAGAAGTCACATGG + Intergenic
1038750755 8:30293538-30293560 AAATAATAATAGATGTTGGTGGG + Intergenic
1038817110 8:30915080-30915102 AAATTTTTATACATGTCCCTTGG - Intergenic
1040391999 8:46958126-46958148 AATTATTAATATATATCAGTTGG - Intergenic
1041253604 8:55959178-55959200 TCATTTTAATAGATGTGAGATGG + Intronic
1041361029 8:57054655-57054677 ATATTTTAACAAATGTTAGTCGG + Intergenic
1041776656 8:61529962-61529984 AAATTTCAATAGATGAATGTGGG + Intronic
1041978442 8:63826747-63826769 AAATTTTACTTCAAGTCAGTTGG + Intergenic
1043235119 8:77855015-77855037 AAAACTTGATAGAAGTCAGTGGG - Intergenic
1043466047 8:80507975-80507997 TAATTTTAAAAGATGGTAGTAGG + Intronic
1044352393 8:91182178-91182200 AAATATTAACAGTTGTCAATGGG - Intronic
1044569723 8:93703598-93703620 AAATTTTAATAATTTTCAATAGG + Exonic
1046593821 8:116237083-116237105 ACATTTAAATAGATGTAAATTGG + Intergenic
1047460463 8:125059014-125059036 AAGTTTTAATTAATGTAAGTTGG - Intronic
1047798380 8:128282416-128282438 AAAATATAATAGATGTTGGTGGG + Intergenic
1048164217 8:132048242-132048264 AAACTTTCAAATATGTCAGTGGG + Intronic
1050962642 9:11755614-11755636 ATATTTTAATATAAGTCACTTGG + Intergenic
1051627862 9:19115196-19115218 AAATTTTACTAGGTGACAGTTGG - Intronic
1053369223 9:37546514-37546536 AAGGCTTAATAGATGTCTGTCGG - Intronic
1053569813 9:39292600-39292622 AAATATTGATGGATGTCAGAAGG - Intergenic
1053835775 9:42133634-42133656 AAATATTGATGGATGTCAGAAGG - Intergenic
1054091446 9:60851606-60851628 AAATATTGATGGATGTCAGAAGG - Intergenic
1054112861 9:61127177-61127199 AAATATTGATGGATGTCAGAAGG - Intergenic
1054127336 9:61326412-61326434 AAATATTGATGGATGTCAGAAGG + Intergenic
1054594856 9:67054993-67055015 AAATATTGATGGATGTCAGAAGG + Intergenic
1054690996 9:68321829-68321851 AAATTATAACCGATATCAGTGGG - Intergenic
1055421600 9:76149102-76149124 TAAGCTTAATGGATGTCAGTAGG - Intronic
1056721732 9:89077924-89077946 CAATTTTATTACGTGTCAGTCGG + Intronic
1058167399 9:101635581-101635603 AAGGTTTAATAAATGTCAGCAGG + Intronic
1058523963 9:105838735-105838757 AAATTTTAAGATGTGTCACTTGG + Intergenic
1059714557 9:116901721-116901743 AACTTTTAAAAGATATAAGTAGG - Intronic
1203689570 Un_GL000214v1:30057-30079 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203712461 Un_KI270742v1:110278-110300 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203718156 Un_KI270742v1:175428-175450 AAATCTAAATAGAAGCCAGTTGG - Intergenic
1203533063 Un_KI270743v1:2800-2822 AAATCTAAATAGAAGCCAGTTGG + Intergenic
1203538755 Un_KI270743v1:67909-67931 AAATTTCAATAGAGGCCAATTGG - Intergenic
1203556060 Un_KI270743v1:208604-208626 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203646705 Un_KI270751v1:73996-74018 AAATTTCAATAGAGGCCAATTGG + Intergenic
1203652378 Un_KI270751v1:138983-139005 AAATCTAAATAGAAGCCAGTTGG - Intergenic
1186305647 X:8254336-8254358 AAATTTAAAAAGTTGACAGTGGG + Intergenic
1186538856 X:10378948-10378970 AAATATTAATAGATGGCAAGAGG - Intergenic
1186594082 X:10961589-10961611 TAATTGTAATAGAAGTCAGTTGG - Intergenic
1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG + Intronic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1186942973 X:14531715-14531737 AAATATTAATAGTTGATAGTTGG + Intronic
1187079333 X:15970097-15970119 TAAATTAAATAGATGTAAGTGGG - Intergenic
1187377468 X:18768331-18768353 AAATTTTAATTCATCTCAATTGG + Intronic
1188337351 X:28953292-28953314 ATATTTTAATAGATTTCCCTGGG + Intronic
1189532021 X:41894740-41894762 AAATATTAATAGATAAAAGTGGG + Intronic
1189987369 X:46565788-46565810 AATTTGAAATAGATGGCAGTTGG - Intergenic
1190395770 X:49981199-49981221 AACTTTTAATAAATGTTATTGGG - Intronic
1190730072 X:53220091-53220113 AAATCTTAATAGATGTCCAAGGG - Intronic
1193084653 X:77438310-77438332 AAATTTTAAATGTTATCAGTTGG + Intergenic
1193093523 X:77521327-77521349 AAATTTAAAAAAATGGCAGTAGG + Intronic
1193137867 X:77992912-77992934 AAATTTAAAAAAATGTAAGTGGG - Intronic
1193321039 X:80121688-80121710 AAATTATACTAGATGTTAGCTGG - Intergenic
1193944287 X:87713482-87713504 AAATTTTTATTGATCTTAGTTGG + Intergenic
1193952574 X:87818621-87818643 AAATTATAATAGAATTCAGAAGG + Intergenic
1194286664 X:92019749-92019771 CAATTTAAAAAGATCTCAGTGGG + Intronic
1194901596 X:99519126-99519148 AAATTTTAATAATTGACAATTGG - Intergenic
1195201793 X:102558254-102558276 AAATTTTTATAAATATAAGTTGG + Intergenic
1195393128 X:104383938-104383960 AAATTTAAATAGGTTTCAGGGGG + Intergenic
1195484881 X:105392880-105392902 AAATCTTAGTAAATGTCTGTTGG + Intronic
1195726089 X:107918166-107918188 AAATATGAAAACATGTCAGTGGG + Intronic
1196502861 X:116405779-116405801 ATATTTTATAAGATCTCAGTTGG - Intergenic
1196827876 X:119755178-119755200 AAATCTTAGGGGATGTCAGTAGG - Intergenic
1196960768 X:120998463-120998485 TATTTTTAAAAGATGGCAGTAGG + Intergenic
1198454245 X:136800030-136800052 AAATTTTCATATATGCCAATAGG - Intergenic
1201172317 Y:11280274-11280296 AAATCTAAATAGAAGCCAGTTGG - Intergenic
1202305074 Y:23460553-23460575 AAATTTCAAAAGATGGCAGTGGG + Intergenic
1202565735 Y:26210036-26210058 AAATTTCAAAAGATGGCAGTGGG - Intergenic