ID: 983802385

View in Genome Browser
Species Human (GRCh38)
Location 4:171949143-171949165
Sequence CTGATGGCCTTGGGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983802380_983802385 1 Left 983802380 4:171949119-171949141 CCACATGAACTTGAGTTTTTTAT 0: 1
1: 0
2: 2
3: 41
4: 570
Right 983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 266
983802377_983802385 27 Left 983802377 4:171949093-171949115 CCTGGCAGCCGGTTTCTCTGCTA 0: 1
1: 0
2: 0
3: 1
4: 108
Right 983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 266
983802379_983802385 2 Left 983802379 4:171949118-171949140 CCCACATGAACTTGAGTTTTTTA 0: 1
1: 0
2: 2
3: 31
4: 320
Right 983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 266
983802378_983802385 19 Left 983802378 4:171949101-171949123 CCGGTTTCTCTGCTAATCCCACA 0: 1
1: 0
2: 0
3: 21
4: 239
Right 983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983802385 Original CRISPR CTGATGGCCTTGGGGAAAGC AGG Intronic
900325926 1:2108647-2108669 CTGGTGGCCGTGGGAGAAGCAGG + Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900469613 1:2847283-2847305 CTGCTGGCCTTGGGGGAGGCGGG - Intergenic
900486197 1:2923957-2923979 CTGGGGGTCTTGGGCAAAGCAGG - Intergenic
900529947 1:3148255-3148277 CTGGTGGCCCTGGTGAGAGCAGG + Intronic
901427013 1:9188430-9188452 CTGGCAGCCTTGGGGTAAGCTGG - Intergenic
901759583 1:11462003-11462025 CCGATGGCCTTGGGAAGAGCTGG + Intergenic
902112488 1:14094063-14094085 CGGGTGGCTTTGGGGAAAGGGGG + Intergenic
902194620 1:14789166-14789188 CTGAGGGCTTTGGGGACAGGAGG + Intronic
902530969 1:17090431-17090453 CCCCTGGCCTTGGGGAGAGCTGG + Intronic
902816710 1:18920657-18920679 CTGAAGGCCTTGGAGAGGGCAGG - Intronic
903056239 1:20638088-20638110 TTGATGGCCAAGGGGAAGGCAGG - Exonic
903744996 1:25581001-25581023 CTGTTGGCCTTAGCAAAAGCAGG + Intergenic
904287336 1:29461019-29461041 ATGGTGGCCTTGGGGAAAAGGGG + Intergenic
905390755 1:37634260-37634282 CTGGTGGACTTGGGGAATTCAGG + Intronic
907340921 1:53735821-53735843 CTGAAGAACTGGGGGAAAGCTGG + Intergenic
909047427 1:70727636-70727658 CTGGTTGCTTTGGGGAGAGCAGG + Intergenic
913207351 1:116552449-116552471 CTGATGGACTTGCTTAAAGCTGG + Intronic
915035247 1:152918184-152918206 CTGATGGCATAGAAGAAAGCTGG + Intergenic
915619637 1:157073245-157073267 CTGATGGACATGGTGAAGGCAGG - Intergenic
917790758 1:178497275-178497297 CGGCTGGCCTTGGGGAGAGTGGG - Intergenic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
918962890 1:191303246-191303268 CTGCTGGACCTGGAGAAAGCAGG - Intergenic
919548910 1:198960118-198960140 CTGATAGGCTTGCTGAAAGCAGG + Intergenic
919791354 1:201292797-201292819 GTGATGGCCTTGGGGGATGAAGG - Intronic
919980346 1:202639022-202639044 CAGATGGGCTTGGGGAAGGGAGG - Intronic
922153027 1:223021276-223021298 CTGATGGCCGTGAGCAGAGCTGG + Intergenic
923208106 1:231777965-231777987 CTGATGGCCTGGGAGAGACCAGG + Intronic
923671212 1:236042900-236042922 CTGGAGGCAGTGGGGAAAGCTGG - Intronic
1064075350 10:12264393-12264415 CTGAGGGCCTGGGGGAGGGCGGG - Intergenic
1064235288 10:13568287-13568309 GTAATGGCCATGGGAAAAGCTGG - Intergenic
1064553182 10:16522186-16522208 CTGCTGGCAGTGGGGAAATCGGG - Intergenic
1067070285 10:43126101-43126123 CAGGGGTCCTTGGGGAAAGCTGG + Intronic
1067837544 10:49650982-49651004 CTGGGGGCCTTGGGGAATGTGGG - Intronic
1069588564 10:69627761-69627783 CTGATGGCACTGGGGAAGGTGGG + Intergenic
1070838209 10:79464648-79464670 CTGATGGTCTTGCTGCAAGCAGG + Intergenic
1070919439 10:80174992-80175014 CCTATGGCTTTGGAGAAAGCTGG + Intronic
1071503165 10:86217775-86217797 CTGCTGGCCTTTGGGCCAGCTGG + Intronic
1072166107 10:92814681-92814703 GTGATGGACATGGGGAAAGGTGG - Intergenic
1072362623 10:94674565-94674587 CAGAAGGCCATGGTGAAAGCTGG - Intergenic
1074497442 10:113992401-113992423 CTGATGGCCTGGGGGAGATGGGG - Intergenic
1075402900 10:122173636-122173658 CTGATGGCCCTGGGGTCAGTGGG + Intronic
1075589519 10:123681186-123681208 TTGATGGAATTGGGGAAGGCTGG - Intronic
1075924074 10:126236257-126236279 CTGGTGCCCTGGGGGAAGGCTGG + Intronic
1077132118 11:978249-978271 CAGAAGGCCCAGGGGAAAGCAGG - Intronic
1078532205 11:12145457-12145479 ATGCTGGCCCTGGAGAAAGCAGG + Intronic
1079399947 11:20098802-20098824 CTCATGGCCTTGGGCAATCCAGG + Intronic
1084608801 11:70187780-70187802 CTGATGTCCTTGGGGATGTCCGG - Exonic
1084654706 11:70508341-70508363 ATGGTGGCCTTAGGGGAAGCTGG - Intronic
1085128739 11:74019594-74019616 CTGGTGGCTTTGTGGAGAGCTGG + Intronic
1086065371 11:82738126-82738148 CTGATGGGCTTGGCTAGAGCTGG - Intergenic
1087120110 11:94564827-94564849 ATGATGGCCTTGGGCAGAGATGG - Intronic
1087567953 11:99887188-99887210 TTGACTGCCTTAGGGAAAGCAGG - Intronic
1089082399 11:115787914-115787936 CTGCTGACCTTGGGGGAAGAAGG + Intergenic
1090446464 11:126768788-126768810 TTGATGGTCCTGGGGAAAGGAGG + Intronic
1091360907 11:134977914-134977936 CAGATGGCCTGGGGCACAGCAGG - Intergenic
1092236899 12:6816052-6816074 CTGGAGGCCTTCTGGAAAGCTGG - Exonic
1096193784 12:49635964-49635986 CTGATGGTCCTGAGCAAAGCTGG - Exonic
1096633703 12:52945555-52945577 CTGATGGCTCTGGGGAAACTAGG - Intronic
1099712358 12:86243653-86243675 CTGATGGCCATCAGGAAAACAGG + Intronic
1099726114 12:86430544-86430566 CTGATGGCCTGTGGGAACACTGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102740341 12:115201377-115201399 CTGAAGCCCTTAGGGAAAGAAGG - Intergenic
1102896071 12:116599610-116599632 CTGTTGGCCTCGGGGAGGGCAGG - Intergenic
1103839450 12:123850695-123850717 CTGAAGGCCTTGGGGAGGGCAGG - Intronic
1103920127 12:124395043-124395065 CCGAAGGCCCTGGGGAAACCTGG + Intronic
1106418629 13:29567419-29567441 CTGATGGCCTTAGGAAATACTGG - Intronic
1106460673 13:29964897-29964919 CTGGAACCCTTGGGGAAAGCAGG - Intergenic
1107423839 13:40274071-40274093 CCGAGGGCCATGGGGAACGCGGG + Intergenic
1107605141 13:42048986-42049008 CTGAGGGCCGCGTGGAAAGCGGG + Intronic
1107871718 13:44752714-44752736 CAGATGGCCTGGGGGATAGTAGG + Intergenic
1108168067 13:47712762-47712784 CTGACAGCTTTGAGGAAAGCAGG + Intergenic
1109561618 13:64057142-64057164 CTCATGCCCTTGGGGAAATTGGG - Intergenic
1110333780 13:74302741-74302763 CTGCTTGGCTTGGAGAAAGCAGG + Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1110740479 13:78990385-78990407 CTGATGGCTTCGCAGAAAGCAGG - Intergenic
1111723772 13:91978773-91978795 CTGATGGCTTTGTGGAAAATGGG + Intronic
1111933395 13:94534880-94534902 TGGATGGCATTGGGGAAAGATGG - Intergenic
1112792551 13:103018871-103018893 ATGAAGGGCTTGGGGTAAGCAGG - Intergenic
1114476476 14:22998679-22998701 CTGATGAAGATGGGGAAAGCCGG - Exonic
1115071276 14:29324706-29324728 TTTAAGGCCTTCGGGAAAGCAGG + Intergenic
1116324306 14:43512285-43512307 TTGATGGCATTGGGGAAGGGAGG + Intergenic
1119742808 14:77025664-77025686 CTGTTGGCCATGGGGGAATCCGG + Exonic
1121717143 14:96084363-96084385 CTGGTGGCCTCTTGGAAAGCAGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122349104 14:101077472-101077494 CTAATGGGCTTGGGGAAAATGGG + Intergenic
1122811487 14:104291523-104291545 CTGGCGGCCTTCGGGAAAGAAGG - Intergenic
1123109014 14:105856630-105856652 CTGATGCCTCGGGGGAAAGCAGG - Intergenic
1123137380 14:106041086-106041108 CTGATGGCCTTGATGGAATCTGG + Intergenic
1124496044 15:30187824-30187846 CAGATGGGCTTGGGGAAGGGAGG - Intergenic
1124747530 15:32350823-32350845 CAGATGGGCTTGGGGAAGGGAGG + Intergenic
1124892314 15:33744683-33744705 CTGCCGGCCTTGGGAACAGCAGG + Intronic
1126785957 15:52178180-52178202 CTGATTGCCTGGGGGGAATCCGG + Intronic
1127038949 15:54952082-54952104 AGGAAGGCCTTGGGGAAAGGAGG - Intergenic
1128619073 15:69133632-69133654 CTGAAGGCCCTGGGGCAAGTTGG - Intergenic
1129466564 15:75727472-75727494 TTGATGCCCATGGTGAAAGCAGG - Exonic
1129737224 15:77973140-77973162 ATGCTGGCTTTGAGGAAAGCAGG - Intergenic
1129848854 15:78780495-78780517 ATGCTGGCTTTGAGGAAAGCAGG + Intronic
1130211450 15:81926628-81926650 CTGATGGCCCTGGAGAAAGGAGG - Intergenic
1130404406 15:83585037-83585059 CTCATGACCTGGGGGACAGCTGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132341344 15:101080181-101080203 CTCATGGCCAGGGGGAAAGGTGG - Intergenic
1133303146 16:4795328-4795350 CTGCTGGCCCTGGGGAGGGCGGG + Intronic
1133413224 16:5585671-5585693 CCGATGGCTTTGGGGAAGTCAGG - Intergenic
1134207813 16:12252142-12252164 CTTGTGGATTTGGGGAAAGCTGG - Intronic
1135114276 16:19712252-19712274 CTAATGGACTAGGGCAAAGCTGG + Intronic
1137537001 16:49334776-49334798 TTCATGGCCTTGGGTAAAGGTGG - Intergenic
1137625245 16:49903575-49903597 CTGGTGGCCGTGGAGGAAGCAGG - Intergenic
1138598883 16:58043549-58043571 CTGATGGGCTTGGGGTACCCAGG - Exonic
1139484815 16:67249433-67249455 CAGATGGAGTTGGGGAGAGCGGG - Intronic
1141394848 16:83695482-83695504 CTGGTGGACTAGGCGAAAGCAGG + Intronic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1141870746 16:86783893-86783915 CTGAATGCCCTGTGGAAAGCGGG + Intergenic
1143707258 17:8707364-8707386 CAAATAGGCTTGGGGAAAGCTGG - Intergenic
1144103228 17:11962371-11962393 CTGATGGCCTCAAGGAAAGAAGG - Intronic
1144720839 17:17468826-17468848 CCGGTGGCCTTGGTGACAGCTGG - Intergenic
1144735415 17:17552909-17552931 CTCCTGGCCTGGGGGAAAGGGGG - Intronic
1147822097 17:43247599-43247621 ATGATTACCTTGGGGAAACCAGG + Intergenic
1148158156 17:45435160-45435182 GTGAAGCCCTTGGGGGAAGCTGG + Intergenic
1148478479 17:47944647-47944669 CTGAAGGGCTTCGGGAAAGATGG + Exonic
1148678503 17:49459120-49459142 CAGATGGATTTGGGGAATGCTGG + Intronic
1150963136 17:69936786-69936808 CTGATGGCATTGGGAAGAGAGGG + Intergenic
1152291095 17:79440740-79440762 CTAATGGCCATGGGGAAGGGGGG - Intronic
1152539200 17:80966475-80966497 CTGGTGGCCCTGGGGACAGCAGG - Intergenic
1153020072 18:620547-620569 GTGATGACCTTGGGGAAAAGGGG - Intronic
1154142296 18:11834913-11834935 CAAGTGGCCTTGGGCAAAGCAGG + Intronic
1154314885 18:13296842-13296864 GTCATGACCTTGTGGAAAGCAGG - Intronic
1154494399 18:14945043-14945065 CAGATGGCCTGGGGCACAGCAGG + Intergenic
1156192598 18:34736918-34736940 CTGATGCCCTGTGGCAAAGCAGG - Intronic
1156194255 18:34755551-34755573 CTGATGGACTTGGTGAATGAAGG - Intronic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157481964 18:48060788-48060810 GTGATGGGCCTGGGGAGAGCAGG + Intronic
1159918398 18:74205518-74205540 CTGATTGCATCTGGGAAAGCAGG - Intergenic
1160146711 18:76371429-76371451 CTGCTCCCCTTGGGGATAGCTGG + Intronic
1160256735 18:77253466-77253488 CTGAAGGCTTTGGGGAAATAAGG - Intronic
1160664037 19:314627-314649 CTCATGGCCATGAGGAAAACAGG + Intronic
1160989961 19:1856486-1856508 CTGTTGGTCTTGGTGACAGCTGG - Intronic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161390248 19:4016910-4016932 CTGAAGCCCTCGGGGCAAGCAGG - Intronic
1161491798 19:4566477-4566499 CAGATGGTCTTGGGGATAGGGGG - Intergenic
1163395251 19:17056285-17056307 GGGATGGCCTTGTGGAAGGCAGG - Intronic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
1164593811 19:29520641-29520663 CTGATGGCCCTGGTGACAGCAGG + Intergenic
1164635943 19:29791587-29791609 CTGGTGGCCTTGAGGACTGCTGG + Intergenic
1164836381 19:31357637-31357659 CAGAGGGCCTTTGGGAAAGCTGG - Intergenic
1166130824 19:40744654-40744676 CTGGTGGCCTTGTGGATGGCAGG - Exonic
1166714925 19:44960883-44960905 CTGATGGCTGAGGGGACAGCTGG + Intronic
1202634863 1_KI270706v1_random:36181-36203 TTGAAGGCCTTGTGGACAGCTGG - Intergenic
1202650356 1_KI270706v1_random:173924-173946 TTGAAGGCCTTGTGGACAGCTGG + Intergenic
1202650675 1_KI270707v1_random:869-891 TTGAAGGCCTTGTGGACAGCTGG + Intergenic
927010154 2:18895785-18895807 CTGGTGGCCCTGGGGAAAGGAGG - Intergenic
932182646 2:69662472-69662494 CTCATGGCCTTGATGAAAGATGG - Intronic
932190543 2:69738471-69738493 CTCATGGCCTTGATGAAAGATGG + Intronic
936063695 2:109314445-109314467 CAGATTGCCCTGGGGAAAGCAGG + Intronic
936491232 2:112973870-112973892 CTAATGGCCTTGGAGAAACCTGG + Intronic
937980620 2:127612516-127612538 CTGATGGCCTTGGTGCAGACCGG + Exonic
940734873 2:157439483-157439505 CTGCTCGCCCTAGGGAAAGCGGG - Intronic
940849182 2:158672081-158672103 CTGACGGCCTTGGCCAAGGCAGG + Intronic
945402428 2:209401488-209401510 CCATTGGCCTTGGGGAAAACTGG + Intergenic
946529818 2:220559033-220559055 CTTATGACCATGGGGAGAGCAGG - Intergenic
947235182 2:227934122-227934144 CTGACTCCCTTGGGGAAAGCAGG + Intergenic
948260919 2:236603952-236603974 CAGATGACCTTGGAGAAAGCAGG + Intergenic
1168856293 20:1011605-1011627 CTGGTGGGCTGGGGGACAGCAGG + Intergenic
1169022913 20:2342848-2342870 CTGATGGCCTTGGTGAATGGTGG - Intergenic
1169799496 20:9500374-9500396 CTGCTGGCCTGGGGGAAGGCTGG - Intergenic
1169875296 20:10290819-10290841 CTAATGGCCTCTGGGAATGCAGG - Intronic
1171254087 20:23673202-23673224 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171260588 20:23728469-23728491 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171269705 20:23804314-23804336 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1172569927 20:35962037-35962059 CTGCAGGCCTTAGGGAGAGCTGG - Intronic
1172622912 20:36331372-36331394 CCGATGGCCTTGGAGGGAGCAGG + Intronic
1172814485 20:37675425-37675447 CTGATGGCCCTGCCTAAAGCAGG - Intergenic
1173225527 20:41160323-41160345 CTGGTGGCCTTGGTGTGAGCTGG + Intronic
1173721194 20:45259555-45259577 CTGATGGCCTCAGAGGAAGCAGG - Intergenic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1175093736 20:56525167-56525189 CTCATGGTCCTGGGCAAAGCTGG + Intronic
1175094929 20:56533700-56533722 CTCATGGTCCTGGGCAAAGCTGG + Intronic
1175497598 20:59425299-59425321 TTGAGGACTTTGGGGAAAGCAGG - Intergenic
1175847855 20:62067993-62068015 CAGAAGGCCCTGGGGAAAGTGGG + Intergenic
1175972132 20:62692034-62692056 CTGGTGGCCGTGGGCAGAGCTGG - Intergenic
1179423249 21:41252638-41252660 CTGGTGGCGTTGGGGAAGGAAGG - Intronic
1179610535 21:42547432-42547454 CTGAGGCCCCTGGGGAAACCAGG - Intronic
1180626097 22:17194442-17194464 CTGCAGGCCTGGGGGAATGCGGG - Intronic
1181387101 22:22554410-22554432 CTAATGGCCTTTGTGAAAACCGG + Intronic
1181916474 22:26285088-26285110 GTGGTGGCCTTGGGGGCAGCAGG - Intronic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
1182579421 22:31296166-31296188 CTGATTGCCTTGAGGAAGGAAGG - Intergenic
1182791985 22:32960652-32960674 CTGAGGGGCATGGGGGAAGCTGG - Intronic
1183383562 22:37502645-37502667 CGTGTGGCCTTTGGGAAAGCCGG - Exonic
1183410737 22:37653804-37653826 CTGGTGACCTTGGGGGAGGCTGG - Exonic
1183424960 22:37734512-37734534 CTGATGTCCTGGGGGGCAGCGGG - Exonic
1184108025 22:42379689-42379711 CACATGCCCTTGGGGACAGCAGG + Intergenic
1184112336 22:42402617-42402639 CTCATGGCATTGGGCACAGCAGG - Intronic
1184338297 22:43868966-43868988 CTGATGGCTTTGGAGAAATTTGG + Intergenic
1184720423 22:46309410-46309432 CTGGAGGTCTGGGGGAAAGCTGG + Intronic
1184843801 22:47068333-47068355 CTGATGGCCTTTGGTAACACTGG - Intronic
1184885864 22:47344107-47344129 CTGGAGGGCATGGGGAAAGCAGG + Intergenic
1185045002 22:48524381-48524403 AGGGTGGCCTTGGGGAATGCAGG - Intronic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
949467760 3:4361340-4361362 CTGAAGGCTTTGGGGAGAGGGGG + Exonic
949484658 3:4526484-4526506 CTGCTGGCCTTGGTGATGGCAGG + Intronic
950127131 3:10516619-10516641 CTCATGGACTTGGAGAAAGGTGG + Intronic
951970128 3:28434681-28434703 CTGATGGCGTGGGAGAGAGCTGG - Intronic
953338792 3:42116758-42116780 CTGATGGCCAAGTGGAAAGTTGG + Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954121736 3:48503884-48503906 CTGACGGCCTCGGGGCAATCAGG + Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
954867458 3:53742090-53742112 CTGGTGGCCTTGGGGACATTTGG + Intronic
955536402 3:59928346-59928368 CTGATGACATTGGGGCAACCTGG - Intronic
960320463 3:116228829-116228851 CTGGAGGCATTAGGGAAAGCAGG + Intronic
961813275 3:129533938-129533960 CCGCTGGCCTTGGGGAACGTGGG - Exonic
964534554 3:157705504-157705526 CTGATTGCCTTGGGTAAGGGGGG + Intergenic
965078237 3:164004375-164004397 CTGAGGGCCCAGGGAAAAGCCGG + Intergenic
967099110 3:186201304-186201326 CTGATGGCCTGGGGGCCAGCAGG + Intronic
968603775 4:1522023-1522045 CTGGGGGTCTTGGGGACAGCTGG - Intergenic
969172764 4:5377038-5377060 CTGGTGGCTGTGGGGAGAGCTGG - Intronic
969496924 4:7531515-7531537 CTGATGACCTGGGGGAAAAGGGG - Exonic
969529322 4:7721792-7721814 ATGTTAGCCTTGGGGAGAGCCGG + Intronic
973637567 4:52874263-52874285 CAGATGGCCTGTGGGACAGCCGG + Intronic
975458743 4:74625507-74625529 CTGACGGCTTTGAGGAAAGGAGG + Intergenic
976160760 4:82196152-82196174 CTGTTTCCCTTAGGGAAAGCAGG - Intergenic
976845723 4:89487238-89487260 CTAAGGGCCTGGGGGAAATCTGG - Intergenic
978734599 4:112071075-112071097 CAGATGGGCTTTGGGGAAGCTGG + Intergenic
979375495 4:119941829-119941851 CTGATGGTCCTGGGGAAAGGAGG + Intergenic
980681737 4:136171406-136171428 ATGTTTGCTTTGGGGAAAGCTGG + Intergenic
983476870 4:168223133-168223155 TTGATGGCCTGGGGGAAAACGGG + Intronic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
985022888 4:185710828-185710850 CTGATGAGCTTAGGGAAACCCGG + Intronic
987248979 5:16079653-16079675 CTGAGGGCCCTGGGGAGAGGAGG - Intronic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
994737179 5:103569578-103569600 TTGATCCCCTTGGGGAAAGCTGG - Intergenic
996070717 5:119128272-119128294 CTTATGGCAGTGGGGAAATCTGG - Intronic
997430575 5:133837604-133837626 ATGATGGCCTTTGTGAGAGCTGG + Intergenic
999236930 5:150104112-150104134 TGGATGGCCTTGAGGAAACCTGG + Intronic
1000206248 5:159062369-159062391 CAGGTGGCCTTGGAGAAGGCTGG + Intronic
1001993527 5:176135585-176135607 CTGCTGGCCTTGGGGGCTGCAGG + Intergenic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1005495220 6:26382380-26382402 CGGGAGGCCTTGGGGGAAGCAGG - Intergenic
1005499925 6:26420982-26421004 CGGAAGGTCTTGGGGGAAGCAGG - Intergenic
1008045285 6:46845343-46845365 GTGGTGGCCTTGGGAAAAGCAGG + Intergenic
1010505046 6:76646798-76646820 CTGATTGCCCTTGAGAAAGCAGG - Intergenic
1011058789 6:83237781-83237803 GTGATGGCCTTGGAAAAAGAAGG - Exonic
1016360442 6:143261501-143261523 CTGGTGGCCTTGGCCTAAGCAGG + Intronic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017950085 6:159129019-159129041 CTGATGGGCCTGGGGAGGGCAGG - Intergenic
1018593317 6:165452071-165452093 CTCATGGCCTTGGTGAAGGGGGG - Intronic
1018987530 6:168649114-168649136 CTGAGGGCCACGGGGAAGGCGGG + Intronic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019262180 7:87844-87866 CTGATGGCCCTGGGGCAGGTGGG - Intergenic
1021971992 7:25973984-25974006 CTGTTGGGGTTGGGGAAGGCTGG + Intergenic
1023896622 7:44439119-44439141 CGGGTGGCCTGGGGGAAAGAAGG + Intronic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1025604494 7:63029600-63029622 CTGTTAGCCTTTGGGAAATCTGG - Intergenic
1027806057 7:82824281-82824303 CAGATGGCTTTGGGGACTGCTGG + Exonic
1031153109 7:118077014-118077036 ATGAGGAGCTTGGGGAAAGCTGG + Intergenic
1031921075 7:127600990-127601012 AAGATGGCCCTGGGGAAGGCAGG - Intronic
1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG + Intronic
1034627492 7:152504618-152504640 CCTATGGCCTTGGGGAAAACTGG + Intergenic
1040389900 8:46940965-46940987 CTGATGGCACTGGGAAAATCAGG + Intergenic
1041461451 8:58116161-58116183 ATGATGGCAGTGGTGAAAGCTGG - Intronic
1045193233 8:99904144-99904166 CTGCTGACCTAGGGGAACGCTGG + Intergenic
1045265600 8:100616324-100616346 ATGATGTCTTTGGGGAAGGCAGG + Intronic
1045351910 8:101349141-101349163 CTGAAGGACTTGGAGAAAGGAGG - Intergenic
1046754485 8:117959183-117959205 CTGCATGCCTTAGGGAAAGCTGG + Intronic
1049421514 8:142518628-142518650 CCTGTGGCCTTGGGGAAAGGGGG - Intronic
1049443480 8:142619608-142619630 CTGATGGCCTGGGGGCCAGTGGG + Intergenic
1049465173 8:142747955-142747977 CAGATGGCCTTGGGGAAGTCAGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1049734781 8:144199214-144199236 CAGATGCCCATGGGCAAAGCTGG - Intronic
1051343268 9:16130341-16130363 CTTAGGGGCTTGGGGAAAGGAGG - Intergenic
1052101183 9:24447814-24447836 TAGATGCCTTTGGGGAAAGCTGG + Intergenic
1053129885 9:35608911-35608933 CTGACCGGCTTCGGGAAAGCCGG - Exonic
1053273164 9:36763747-36763769 CTGAGGGCCTTGGAGGAAGGAGG + Intergenic
1059147243 9:111911154-111911176 CTGAGAGCCTTGGGTAAATCTGG - Intronic
1060115425 9:120936481-120936503 CTGAAGGCTTTGGGCAAGGCTGG - Intergenic
1060291537 9:122307376-122307398 CAGAAGGCAATGGGGAAAGCAGG - Intronic
1061933828 9:133846636-133846658 CTGATGGCCATGGGGAGGTCTGG - Intronic
1189655530 X:43240679-43240701 CTGATGGCCTGGGTGGAAGAGGG - Intergenic
1189994138 X:46623077-46623099 ATGGTGGCTTTGGGGAAATCAGG + Intronic
1190155935 X:47992528-47992550 CTGATGGGTTTGGAGCAAGCAGG - Intronic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1191220607 X:57984674-57984696 CTGATGGACATGGTGGAAGCAGG - Intergenic
1192440602 X:71170853-71170875 CTGTTGGCCTTTGGGGAAGCAGG - Intronic
1192852046 X:74967225-74967247 CTGATGGCACTGGGGAAATGGGG + Intergenic
1195872698 X:109502486-109502508 CTGAGGGCTTTGTGGAAAGCAGG - Intergenic
1197793876 X:130280930-130280952 CTGAAGGCCAAGGAGAAAGCAGG + Intergenic
1198369326 X:135974525-135974547 CTGGGGGCGTTGGGGAAAGGCGG + Intergenic
1198589986 X:138168025-138168047 ATGATAGCATTGGGGAAAACTGG - Intergenic
1198686813 X:139236152-139236174 GCGCTGGCCTTGGGGACAGCTGG - Intergenic
1200105372 X:153709127-153709149 CTGAGGGGTTTGGGGTAAGCTGG + Intronic
1202596790 Y:26548575-26548597 CTGATGGCTTTGGAGAATACAGG + Intergenic