ID: 983803372

View in Genome Browser
Species Human (GRCh38)
Location 4:171963633-171963655
Sequence TTAGGTTACCATCACTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983803372_983803375 7 Left 983803372 4:171963633-171963655 CCTAAGGAGTGATGGTAACCTAA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 983803375 4:171963663-171963685 TCGCTTACTTAAACAGGATCTGG No data
983803372_983803374 1 Left 983803372 4:171963633-171963655 CCTAAGGAGTGATGGTAACCTAA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 983803374 4:171963657-171963679 TGTAAATCGCTTACTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983803372 Original CRISPR TTAGGTTACCATCACTCCTT AGG (reversed) Intronic
900815833 1:4844359-4844381 TTTGTTTACTATCACTCTTTTGG + Intergenic
905494987 1:38377922-38377944 TTAGGTCACCATCTCTGTTTAGG + Intergenic
907529599 1:55081313-55081335 TAAGCTTACCAACATTCCTTTGG + Exonic
908083857 1:60609489-60609511 TTAGGTCACCATCACCCCCTGGG + Intergenic
908687520 1:66738738-66738760 GTAGGTTAGTATTACTCCTTTGG - Intronic
910972773 1:92873130-92873152 TTAGTTTACCTTTACTCCTGGGG + Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
918508929 1:185288959-185288981 TAAGGTTACTAACATTCCTTTGG + Intronic
921026947 1:211293347-211293369 TTAGGTTTCCTTCAATCTTTAGG + Intronic
921037864 1:211399729-211399751 TTATGTTCCCATCACTGTTTGGG + Intergenic
1066696894 10:38087264-38087286 TTAGGTTAGCATTACTGCTGTGG + Intergenic
1066789113 10:39043669-39043691 TTATGTTCCCATCACTGTTTGGG + Intergenic
1066995664 10:42560450-42560472 TTAGGTTAGCATTACTGCTGTGG - Intergenic
1069861485 10:71474333-71474355 TTAGGGTACCATCCCTGCTGAGG + Intronic
1071949323 10:90684739-90684761 TCTGGTTACCTTCCCTCCTTAGG + Intergenic
1075508326 10:123046902-123046924 TTAGGTTAAGATTACTCTTTAGG - Intronic
1077851453 11:6077618-6077640 TTATGTTCCCATCACTGTTTGGG + Intergenic
1078839923 11:15068954-15068976 TTATGTTCCCATCACTGTTTGGG - Intronic
1080604389 11:33852764-33852786 TTTGGGTACCATCACTCAGTGGG + Intergenic
1080842764 11:35999795-35999817 GTAGGTCACCATCATCCCTTGGG - Intronic
1082300046 11:50494170-50494192 TTATGTTTCCATCAATCTTTGGG - Intergenic
1086579801 11:88385877-88385899 TCAGGAACCCATCACTCCTTAGG + Intergenic
1087961505 11:104356016-104356038 TGAGATCACCATCACTCTTTGGG - Intergenic
1088183421 11:107137368-107137390 TTTGGTTATCATGTCTCCTTAGG - Intergenic
1090738652 11:129635665-129635687 CAAGGTTACCATCACCCCTGTGG - Intergenic
1090986512 11:131771508-131771530 TAAGGTTACCAGGCCTCCTTTGG + Intronic
1094865074 12:34522536-34522558 TTAAGTTCCCATCACTGGTTGGG + Intergenic
1095146304 12:38732081-38732103 TTAGGTTCCCACCACTGCTGTGG - Intronic
1097951295 12:65431478-65431500 TCAGGTTTTCATCACTCGTTTGG + Intronic
1098469890 12:70831287-70831309 TTAGGTTAAAATCACTTCATTGG + Intronic
1099555920 12:84108093-84108115 TTATGTTCCCATCACTGTTTGGG - Intergenic
1099665306 12:85620883-85620905 TTAGGTTGCCAGCCCTCCTGTGG - Intergenic
1101500637 12:105300781-105300803 TTATGTTCCCATCACTGTTTGGG + Intronic
1104295819 12:127511924-127511946 TTTGGTCTCCATGACTCCTTAGG - Intergenic
1110038649 13:70721582-70721604 TTAGGTTAAAATCACACATTTGG + Intergenic
1110578639 13:77091857-77091879 TTGGGTTACTATTACCCCTTAGG - Intronic
1118621535 14:67618847-67618869 TTAGGGTACTAAAACTCCTTTGG + Intergenic
1137987380 16:53120660-53120682 TACAGTTTCCATCACTCCTTAGG + Intronic
1145802156 17:27694570-27694592 TTATGTTCCCATCACTGTTTGGG - Intergenic
1146007864 17:29172760-29172782 TCAAGTTACCTTCACTTCTTTGG - Intronic
1157623660 18:49031034-49031056 TTAGGTCACCACCTCTCCATTGG + Intergenic
1161064247 19:2229732-2229754 TGAGGTTACCATCGCGCCTGGGG - Intronic
1163942531 19:20508327-20508349 TTATGTTGCCATCACTGTTTGGG - Intergenic
1164243438 19:23409940-23409962 TGAGCTTCCCATCACTCCCTGGG + Intergenic
1164329862 19:24244025-24244047 TTATGTTCCCATCACTGTTTGGG + Intergenic
1164332376 19:24271779-24271801 TTATGTTCCCATCACTGTTTGGG + Intergenic
1164365760 19:27580113-27580135 TTATGTTCCCATCACTGTTTCGG + Intergenic
1165531360 19:36404610-36404632 TTAGGTTAACATAAGTCCTATGG - Intronic
1166134191 19:40765532-40765554 TCAGGTTACAATGACTACTTTGG + Intergenic
931056575 2:58479068-58479090 TAAGGTTCCCAACAATCCTTAGG + Intergenic
935310249 2:101776261-101776283 TTAGCTGACCATCAGTCCCTGGG - Intronic
938657737 2:133451853-133451875 TGAAGTTCCCATCACTCCTTCGG - Intronic
938723218 2:134084633-134084655 TTAGGTTACAGACACTGCTTAGG - Intergenic
940109836 2:150139259-150139281 TCTGGTTACCATCAGGCCTTTGG - Intergenic
941442056 2:165550802-165550824 GGAGGCTACCATCCCTCCTTGGG + Intronic
942774050 2:179559299-179559321 TTAGAGTACCAGCATTCCTTGGG - Intronic
946171422 2:217898232-217898254 CTTGGTTCCCATCAGTCCTTTGG + Intronic
946531005 2:220570343-220570365 TTAGGATTCCATCACTCTGTTGG - Intergenic
1169580431 20:7016700-7016722 CTAGCTTACCATCACTCAGTTGG - Intergenic
1169725148 20:8720585-8720607 TTAGGTTACCCTAGTTCCTTAGG - Intronic
1173220089 20:41125394-41125416 TTATGTAGCCATCACTGCTTTGG + Intergenic
1174195156 20:48767585-48767607 TTACGTTACCATCACTGATGGGG + Intronic
1174503296 20:51001100-51001122 TTAGGGGACCATCACTCCTCTGG - Intergenic
953421377 3:42756030-42756052 TTAGGCTACCATGAGTCTTTAGG + Intronic
954743821 3:52775283-52775305 TCAGCTTCTCATCACTCCTTGGG + Intergenic
955019507 3:55105686-55105708 TTGTGTTACCATCTCTGCTTCGG - Intergenic
955088938 3:55730416-55730438 TTAGGTTACCATAAAGCATTTGG + Intronic
958147061 3:89639667-89639689 TTGGGTTGCCATCGCTCCCTGGG - Intergenic
964153827 3:153561414-153561436 GTAGGTTACCATCATTCCAAAGG - Intergenic
970142385 4:12996605-12996627 TTAGGTTCCCTTCACTTCTATGG - Intergenic
972927651 4:44031293-44031315 TTAGGTGAGCTTCATTCCTTCGG + Intergenic
974605649 4:64146656-64146678 TTATGTTCCCATCACTGTTTGGG - Intergenic
974998455 4:69192710-69192732 TTATGTTCCCATCACTGTTTGGG + Intronic
975834228 4:78404743-78404765 TCAGGTTCCCATCTCTCCTCTGG + Intronic
976378200 4:84368897-84368919 TCAGGTTTCTATCACTTCTTAGG - Intergenic
977769950 4:100846386-100846408 TTAGGGTAACATTACTCATTTGG - Intronic
981801246 4:148659534-148659556 TTTAGTTACCATGTCTCCTTAGG + Intergenic
983803372 4:171963633-171963655 TTAGGTTACCATCACTCCTTAGG - Intronic
989317993 5:40104368-40104390 TTATGTTCCCATCACTGTTTGGG + Intergenic
990820291 5:59832045-59832067 GTAGGCTACCATCACTCTTTGGG - Intronic
992465190 5:76997348-76997370 TTACATTAGCATCGCTCCTTTGG - Intergenic
994815427 5:104580622-104580644 TTTGGTTACCATGTCTCCTGAGG + Intergenic
996042600 5:118832536-118832558 TTATGGAAGCATCACTCCTTTGG - Intergenic
1000402269 5:160842576-160842598 TTAAGTTCCCTTCATTCCTTTGG - Intronic
1000944292 5:167401285-167401307 GTCAGTTAGCATCACTCCTTAGG - Intronic
1010619662 6:78059306-78059328 TTAAGTTATCATGTCTCCTTAGG + Intergenic
1011645351 6:89452440-89452462 GTAGGTTACAATCAATACTTTGG - Intronic
1014996507 6:128152312-128152334 CTAGTTTACCATCAGTACTTTGG - Intronic
1021887874 7:25157712-25157734 TTCAGTCACCATCTCTCCTTAGG - Intronic
1023301606 7:38778536-38778558 TTTGGTTGTCATCACTCCTGAGG + Intronic
1028151292 7:87376283-87376305 TTAGGTTATCATTTCACCTTTGG - Intronic
1030089018 7:105840876-105840898 TGAGATTGCCATCACTCCATGGG - Intronic
1037553548 8:19998882-19998904 TTAGTTTTCCACCACTCATTTGG + Intergenic
1038050104 8:23800952-23800974 TTAGCTTTCCATCAATCCTTTGG - Intergenic
1038525265 8:28267631-28267653 TTTGTTTACCCTCTCTCCTTGGG - Intergenic
1038950903 8:32413366-32413388 TTTAGTTACCATCTCTCCTCAGG - Intronic
1040139513 8:43894107-43894129 TTATGTTCCCATCACTGTTTGGG + Intergenic
1043235308 8:77857555-77857577 TTAAATTCCCTTCACTCCTTAGG - Intergenic
1044313288 8:90720543-90720565 TCAGTTTACCCTCAGTCCTTAGG + Intronic
1046283669 8:112067563-112067585 TCATTTTACCATCACTCCTAGGG - Intergenic
1050078423 9:1889315-1889337 TTAGGTTATAATCCCTGCTTGGG - Intergenic
1052408624 9:28094207-28094229 TTAAGTTACTATTCCTCCTTTGG - Intronic
1056991553 9:91416386-91416408 TTAGGTTAGCATAAATCCTGAGG - Intronic
1059833004 9:118119380-118119402 TTAGGTCAACATCAATTCTTTGG + Intergenic
1185761593 X:2692858-2692880 TTAGGCCACCAGCACTCCCTTGG - Intronic
1186583261 X:10843926-10843948 TTTAGTTACCATGTCTCCTTAGG - Intergenic
1187713001 X:22073107-22073129 TTAGGTTAGCATAAGTCCTTTGG + Intronic
1187920713 X:24198963-24198985 TTTGTCTACAATCACTCCTTTGG - Intronic
1189453535 X:41162338-41162360 TTGTGTTACCCTCACTTCTTAGG + Intronic
1191849298 X:65574237-65574259 GTAAGTCACCATTACTCCTTTGG - Intergenic
1192334430 X:70205465-70205487 TTAGTTCACCATCACTACGTAGG + Exonic