ID: 983810063

View in Genome Browser
Species Human (GRCh38)
Location 4:172050602-172050624
Sequence GCCAGTGGACCCATTTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 4, 2: 27, 3: 51, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983810058_983810063 -1 Left 983810058 4:172050580-172050602 CCCCTTTATCTGAGGTCTATGTG 0: 8
1: 21
2: 44
3: 112
4: 566
Right 983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG 0: 2
1: 4
2: 27
3: 51
4: 136
983810056_983810063 7 Left 983810056 4:172050572-172050594 CCTTAGCACCCCTTTATCTGAGG 0: 1
1: 0
2: 2
3: 24
4: 137
Right 983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG 0: 2
1: 4
2: 27
3: 51
4: 136
983810060_983810063 -3 Left 983810060 4:172050582-172050604 CCTTTATCTGAGGTCTATGTGCC 0: 15
1: 37
2: 68
3: 79
4: 164
Right 983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG 0: 2
1: 4
2: 27
3: 51
4: 136
983810059_983810063 -2 Left 983810059 4:172050581-172050603 CCCTTTATCTGAGGTCTATGTGC 0: 7
1: 20
2: 42
3: 82
4: 294
Right 983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG 0: 2
1: 4
2: 27
3: 51
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983810063 Original CRISPR GCCAGTGGACCCATTTGGTG TGG Intronic
900521311 1:3106692-3106714 GCCAGTGGAGGCATTTGGCCAGG + Intronic
900659816 1:3776815-3776837 GCCAGAGGGCCCAATTGGTAGGG - Intergenic
914983821 1:152439851-152439873 GCCAGTGGATCCTGTAGGTGGGG - Intergenic
915828708 1:159105348-159105370 GCCCGTGGACCCCCTTGGTCTGG + Intronic
916732792 1:167581359-167581381 GCCAATGGATCCATTTGGTGGGG + Intergenic
916803065 1:168232463-168232485 GCCAGTGCTCCCAGTTGGAGAGG - Intronic
917098388 1:171422542-171422564 GCCAGCAGATCCATTTGGTGGGG - Intergenic
918965304 1:191338463-191338485 GGCAGATGATCCATTTGGTGAGG + Intergenic
921279979 1:213557028-213557050 GCCTGTGGATCCATTGTGTGAGG + Intergenic
923004598 1:230036927-230036949 GCCAGTGGAACTATTTGGTGGGG - Intergenic
923437847 1:233984769-233984791 GCCAGTGGATGTCTTTGGTGGGG + Intronic
923868432 1:237964678-237964700 GCCAGTGAATCAATTTGGTGGGG + Intergenic
923883479 1:238129619-238129641 GCCAGTGGATCTGTTTGGTGGGG + Intergenic
924891005 1:248280026-248280048 GCCAGTAGATCTATTTAGTGGGG - Intergenic
1065435852 10:25703154-25703176 GCCAGAGGACCCAGTTGGGCTGG + Intergenic
1065773182 10:29096375-29096397 GCCAGTGGATTCATCTGATGGGG + Intergenic
1067271771 10:44797658-44797680 GCCAGTGGATTCATTTAATGTGG + Intergenic
1067279922 10:44863496-44863518 GCCAGGGGAGCCACCTGGTGGGG - Intergenic
1067345303 10:45433885-45433907 GCCAGTGGATCGGTTTGGTGGGG + Intronic
1067409700 10:46053606-46053628 GCCAGCAGATCCGTTTGGTGGGG - Intergenic
1067797059 10:49328265-49328287 GCCAGTGGATCCGTTTGGTGGGG + Intergenic
1069261388 10:66402842-66402864 GCCAGTGGATCCCTTAGGTGGGG - Intronic
1069383649 10:67864858-67864880 GCCAGAGGATCCGTTTGGTGGGG - Intergenic
1070573170 10:77656951-77656973 GCCAGTAGATCCATCTGGTAGGG + Intergenic
1074385505 10:113013759-113013781 ACCACTGGATCCATTTGGTGGGG + Intronic
1075480825 10:122780304-122780326 GCCAGTGTACCCACTTGGGCTGG + Intergenic
1076130973 10:128013683-128013705 TCCAGGGGACCTATTTGTTGAGG + Intronic
1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG + Intronic
1081500779 11:43664473-43664495 GCCAGCCGATCCATTTGGTGGGG + Intronic
1081547364 11:44081031-44081053 CCCAGAGGACCCATGTGATGTGG + Exonic
1083302879 11:61747980-61748002 TCCAGTGGCTCTATTTGGTGAGG + Intergenic
1086497472 11:87419494-87419516 CCCAGTGGACCCTTCTGATGAGG + Intergenic
1086845731 11:91747672-91747694 GCCAATGGATCTGTTTGGTGGGG + Intergenic
1087381462 11:97409335-97409357 GCCAGTGGACCCCAGTGGTGGGG + Intergenic
1090914662 11:131152629-131152651 GCCAGTGGATCTGTTTGGTGGGG + Intergenic
1091690400 12:2592576-2592598 GCCAGTGGCCACATTTAATGTGG - Intronic
1093460757 12:19404811-19404833 GGCAGTGGATCCATTTGTTAGGG + Intronic
1094527500 12:31241887-31241909 GCCAGTGGATCTGTTCGGTGTGG - Intergenic
1098032597 12:66269665-66269687 GCCAGTGGTTTTATTTGGTGAGG - Intergenic
1101375282 12:104166045-104166067 GCCAGTGGATCCATTTGGCAGGG + Intergenic
1101698703 12:107151602-107151624 GCCAGCGGATCCATTTGGTGGGG + Intergenic
1102974558 12:117197108-117197130 GCCAGTGGGTCTGTTTGGTGGGG + Intergenic
1103586428 12:121959597-121959619 GCAAGTGAACCCAGTTGGAGTGG - Intronic
1104489123 12:129179025-129179047 GCATTTGGCCCCATTTGGTGTGG - Intronic
1107709053 13:43134548-43134570 GCCAGCAGATACATTTGGTGGGG + Intergenic
1107832063 13:44383283-44383305 GCCAGTAGAGTCATTTGGCGTGG + Intronic
1110794771 13:79623487-79623509 GCCAGTGGATCTATTTGGTGTGG - Intergenic
1113250915 13:108451271-108451293 TCCAGGAGACCCATTTAGTGTGG - Intergenic
1115334454 14:32231054-32231076 GCTCGTGGATCCAGTTGGTGAGG - Intergenic
1115358679 14:32477160-32477182 GCCAGTGGATCCATTTGGAAGGG + Intronic
1116617132 14:47154290-47154312 AGCAGTGGCCCCATTTGGAGTGG + Intronic
1117599692 14:57362554-57362576 GCCAGCAGATCCACTTGGTGGGG + Intergenic
1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG + Intronic
1120347441 14:83308582-83308604 GCCAGGGGACCCATGTGCTGCGG + Intergenic
1120471604 14:84932850-84932872 GCCAGTGGATCTATTCAGTGAGG - Intergenic
1120966836 14:90175035-90175057 GACAGTGGATCCATTTGGTGGGG + Intronic
1121172217 14:91864083-91864105 GCCAGGGGATCCATTTGGTGGGG + Intronic
1123818834 15:24005922-24005944 GTCAGCAGATCCATTTGGTGGGG + Intergenic
1123922960 15:25083472-25083494 GCCCCTGGACACATGTGGTGTGG + Intergenic
1125349879 15:38755485-38755507 GCCAGTGGATCCAATTGGTGGGG - Intergenic
1126693710 15:51308302-51308324 GACAGAGGACCGACTTGGTGGGG - Intronic
1129092569 15:73166824-73166846 GCCAACAGATCCATTTGGTGGGG + Intronic
1129873748 15:78958666-78958688 GCTAGCGGGTCCATTTGGTGGGG - Intergenic
1129926138 15:79365882-79365904 GCCAGCAGATCCATTTGGTGGGG + Intronic
1129926384 15:79368030-79368052 GCCAGTGGATCCATTTGGTGGGG + Intronic
1130432144 15:83859438-83859460 GCCGGTGGATCCATTTGGTAGGG + Intronic
1130770771 15:86921362-86921384 GCCAGTGTATCCATTTGGTCGGG + Intronic
1130813649 15:87407832-87407854 GCCAGTAGTTCCATTTTGTGAGG - Intergenic
1132723419 16:1327906-1327928 GCCATTGGGCCCAGTTGGGGTGG + Intergenic
1133982378 16:10642542-10642564 CCCTGTGGACCCCTGTGGTGTGG + Intronic
1134606471 16:15575243-15575265 GCCAGTGGATCCATTTGGTAGGG + Intronic
1135672804 16:24389646-24389668 CCCAGTGGATCCATTTGGTGGGG - Intergenic
1136627961 16:31473129-31473151 GCCAATGGAGCAATTTGGAGGGG + Intronic
1137365068 16:47853261-47853283 GCCAGCGGATCCATTTGGTGGGG + Intergenic
1142310961 16:89313265-89313287 GACAGGGGACCCATGGGGTGGGG + Intronic
1144405709 17:14950880-14950902 GCCTCTGGAGCCATCTGGTGGGG - Intergenic
1144413090 17:15020361-15020383 ACCAGGGGATCCATTTGGAGGGG + Intergenic
1144607329 17:16678486-16678508 GCCAGGGTATCCATTTGGTGGGG - Intergenic
1145820986 17:27835378-27835400 GCTAGTGGATCCATTTGGTAGGG - Intronic
1145822301 17:27848334-27848356 TCCAGTGGATCCATTTGGTGGGG - Intronic
1150602136 17:66660244-66660266 GCCAGTGGGTCCGTTTGGTGGGG + Intronic
1150618439 17:66790120-66790142 GCCAGGGGACCCACCTGGGGTGG + Intronic
1151846107 17:76656811-76656833 GCCTGTGGTCCCAGTTGCTGGGG + Intergenic
1152293670 17:79454549-79454571 GTGAGTGGACCCCTTTGCTGTGG - Intronic
1152332009 17:79678894-79678916 GCCTGTGGAGCCATATGGGGAGG - Intergenic
1153008440 18:516330-516352 GCCAGCAGATCCATTTGGTGGGG - Intergenic
1153516774 18:5910877-5910899 GCCAGTGGGTCCATTTGGTGGGG + Intergenic
1153773385 18:8433070-8433092 GCCAATGGATCTGTTTGGTGAGG + Intergenic
1156589028 18:38465206-38465228 GCCATTGCCTCCATTTGGTGGGG - Intergenic
1160263730 18:77320199-77320221 GCCAGTAGATCTGTTTGGTGGGG - Intergenic
1162175671 19:8828333-8828355 GCCAGCAGCTCCATTTGGTGGGG - Intronic
1165855947 19:38879359-38879381 GTCAGAGGACCCATGGGGTGGGG + Intronic
1166118696 19:40671763-40671785 GCCAGTGAACCCATGTGGTCTGG - Intronic
925138944 2:1537078-1537100 CACAGTGGACGGATTTGGTGAGG - Intronic
925923695 2:8655380-8655402 GCCAGTGCAACCAGGTGGTGTGG - Intergenic
927231170 2:20825505-20825527 GCCAGTGGATCCATTTAGTGGGG + Intergenic
927389248 2:22574740-22574762 TCTAGTGGACCCATTTTGTGAGG + Intergenic
933155157 2:78965069-78965091 GCCAGCGAATCCATTTAGTGGGG + Intergenic
933262070 2:80141941-80141963 GCCAGCGGATCCATTTGGTGGGG - Intronic
934136487 2:89000845-89000867 GCCAGTGGGTCCACTGGGTGAGG - Intergenic
934145963 2:89094169-89094191 GCCAGTGGGTCCACTGGGTGTGG - Intergenic
934223295 2:90106399-90106421 GCCAGTGGGTCCACTGGGTGTGG + Intergenic
935122305 2:100193599-100193621 GCCAGCAGATCCATTTGGTGAGG + Intergenic
936154307 2:110038104-110038126 GCCAGTGGGTCCATTTGCTGGGG - Intergenic
936190376 2:110333311-110333333 GCCAGCGGGTCCATTTGCTGGGG + Intergenic
941903785 2:170702075-170702097 GCCAGGGGATCCATTTTGTGGGG + Intergenic
941955464 2:171199676-171199698 TCCAGTGGTCCCTTTTGCTGGGG + Intronic
944889052 2:204098270-204098292 GCCAGTGGCACCATTTGGCCGGG - Intergenic
946471205 2:219963014-219963036 GCCAGTGGATTCACTAGGTGGGG - Intergenic
948056537 2:235012890-235012912 GCCTGTGCACTCATCTGGTGTGG - Intronic
1168865259 20:1080793-1080815 GCCTGCAGACCCATTTGGTGTGG - Intergenic
1169619251 20:7486779-7486801 GCCAATGGATCCATTTGGTAGGG - Intergenic
1170169522 20:13394731-13394753 GCCAGTGGATCCCATTGGTGTGG - Intronic
1170191898 20:13652703-13652725 GTCAGTGGGTCCATTTGATGGGG + Intergenic
1171374087 20:24680315-24680337 GCCAGTGAACCCATTAGATGGGG - Intergenic
1175799991 20:61796115-61796137 GCCAGTGGCCCCACAGGGTGAGG - Intronic
1178441722 21:32603894-32603916 GGCAGTGGACGCAGTTTGTGAGG - Intronic
949823459 3:8139755-8139777 GCCAGCAGATCCATTTGGTGGGG + Intergenic
951274842 3:20672571-20672593 GCCAGTGGATTCATTTGGTGGGG - Intergenic
952300843 3:32103501-32103523 GCCAGTGGATACATTTCGTGAGG - Intergenic
952475540 3:33706121-33706143 GCCTGTGGTCCCAGTTGCTGGGG + Intronic
952908595 3:38163871-38163893 GCCAGCAGATCCATTTGGTGGGG + Intergenic
952979591 3:38723936-38723958 GCTAATGGACCCAAATGGTGGGG + Intronic
953092832 3:39746723-39746745 GCCAGTGGATCCATTTGGTGGGG + Intergenic
953257764 3:41306447-41306469 GCCAGTGGCCCCATCTGGGAGGG + Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
958000766 3:87746061-87746083 GCCAGTGGACCAATTTGGTGGGG + Intergenic
959487047 3:106938807-106938829 GACAGTGGATCCATCTGGTGGGG + Intergenic
959715961 3:109432765-109432787 GCCAATGGATCCATTTGTGGGGG + Intergenic
962094971 3:132284245-132284267 GCCAGTGGATCCATTTGGCTGGG + Intronic
962095900 3:132292474-132292496 GCCGGTGGACCCAGCTGCTGGGG - Intergenic
962288235 3:134106454-134106476 GCCACAGGTCCCATTTGGAGGGG + Intronic
962679888 3:137787679-137787701 CCCAGTGGACCCATGAAGTGTGG + Intergenic
963896241 3:150687995-150688017 GCCTGTGGTCCCAGTTAGTGGGG + Intronic
964856472 3:161151142-161151164 GCCAGAGGATCCATTCAGTGGGG + Intronic
965843858 3:172938839-172938861 GCCAGGGGATCCATTTGTTGCGG - Intronic
966400735 3:179544528-179544550 TCAAGAGGACACATTTGGTGAGG - Intergenic
966782084 3:183592717-183592739 GCCAGTGGATCCCTTTGGTGGGG - Intergenic
969499054 4:7542107-7542129 GCCAATGGGCCCCTTTGGTTTGG - Intronic
973540001 4:51926236-51926258 GCCTGTGAGCCCATTTTGTGGGG - Intergenic
978840864 4:113209972-113209994 GCCAGCAGATCTATTTGGTGGGG + Intronic
979751037 4:124278719-124278741 ACCAGAGGAGCCATCTGGTGGGG + Intergenic
980033404 4:127856385-127856407 GCCAGTGCATCCATTTGGCAGGG + Intergenic
981064713 4:140470386-140470408 GCCACTAGAGCTATTTGGTGAGG + Intronic
983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG + Intronic
984706617 4:182851767-182851789 GCCAGTGGATCTGTTTGGTGGGG + Intergenic
985354490 4:189103214-189103236 GCCAGTAGATCCATTTGGTGGGG - Intergenic
985699702 5:1363226-1363248 ACCAGTGGACTCATCTGCTGGGG + Intergenic
986089346 5:4488701-4488723 GCCAGCAGATCCTTTTGGTGGGG + Intergenic
986736401 5:10671071-10671093 GCCACTGGTCCCACTGGGTGAGG + Intergenic
987853482 5:23387605-23387627 GCCGGTGGATCCACTTGGTGGGG - Intergenic
988663284 5:33297396-33297418 GCCAGCAGATCCATTTGGTGGGG - Intergenic
993225142 5:85160143-85160165 GTCAGCTGAGCCATTTGGTGTGG - Intergenic
994387126 5:99145840-99145862 GCCAATGGACCACTCTGGTGGGG + Intergenic
994811864 5:104529478-104529500 TCAAGTGTACCCATTTGTTGAGG - Intergenic
996891583 5:128427421-128427443 GCCAGCAGATCCTTTTGGTGGGG - Intronic
997537716 5:134635538-134635560 TCCAGTGGGTCCATTTGATGTGG - Intronic
997595608 5:135105266-135105288 GCCAGTGGACCCCTGTGGCATGG - Intronic
999289816 5:150416996-150417018 GCCAGTGGATCTGTTTGGTGGGG - Intergenic
1001454460 5:171850023-171850045 ACCAACGGAACCATTTGGTGGGG - Intergenic
1001918512 5:175581967-175581989 GCCAGCGGATCTGTTTGGTGGGG - Intergenic
1004225289 6:13779269-13779291 GCCAGTGGATCCATTCGGTGGGG + Intergenic
1005820178 6:29592148-29592170 GCCAGCAGATTCATTTGGTGGGG - Intronic
1006134778 6:31888787-31888809 GCCAGGGGTCCCAGTAGGTGAGG - Intronic
1007301359 6:40870303-40870325 GCCAGCAGATCCATTTGGTGGGG + Intergenic
1007595762 6:43050356-43050378 GCCAGTGCACCCAATAGGTGCGG + Exonic
1007617172 6:43186980-43187002 GCCAGTGCACCCAGTAAGTGCGG - Exonic
1009883913 6:69602159-69602181 GCCAGTGAATCCATTTAGTGGGG + Intergenic
1009901476 6:69812466-69812488 GCCAGGGAATCCATTTGGTGGGG + Intergenic
1010866547 6:80982895-80982917 GCCATTGGACCCCTTGGGTTAGG + Intergenic
1011482801 6:87811954-87811976 GCCAGTGGATCCATTGGGTGGGG - Intergenic
1013249523 6:108320501-108320523 GCCAGTGGATCCATTTGGTAGGG + Intronic
1014249210 6:119098772-119098794 GCCGGTGGACCCATTTAGTAGGG + Intronic
1015270791 6:131336764-131336786 GTCAGTGAACCCATCTGGCGAGG + Intergenic
1017547220 6:155465535-155465557 GCCACTGGACCCAATAGGTGAGG + Intergenic
1020241109 7:6395946-6395968 GAAAGTGGACCCATCTGTTGTGG + Intronic
1021400360 7:20203234-20203256 GGCTGTAGACCCATGTGGTGTGG - Intronic
1023110707 7:36808066-36808088 GCCAGCAGATTCATTTGGTGGGG + Intergenic
1023694076 7:42826644-42826666 GCCGGTGGTGGCATTTGGTGGGG - Intergenic
1024701474 7:51908293-51908315 GGCAGTGGAGCCAGTTGATGGGG + Intergenic
1024929854 7:54658499-54658521 GCCAGCTGACCCAATGGGTGTGG - Intergenic
1025101902 7:56142593-56142615 GTCAGTGCATCCATTTGTTGAGG + Intergenic
1026212961 7:68323185-68323207 GCCAGTGGACTGATTTGATGGGG + Intergenic
1026264299 7:68783094-68783116 GCCAGGGGATCCACTCGGTGGGG - Intergenic
1026317375 7:69238911-69238933 GTCAGCGGATCCCTTTGGTGAGG - Intergenic
1026521552 7:71122409-71122431 GTCAGTGGATTCATTTGGTGGGG - Intergenic
1028724537 7:94072250-94072272 TCCAGTGGACCCATTTGAGGAGG - Intergenic
1028793070 7:94875594-94875616 GACAGTAGATCCATTTGGTGAGG - Intergenic
1031353917 7:120767089-120767111 ACCAATGGATCCATTTAGTGTGG - Intergenic
1036488576 8:9202402-9202424 GCCAGCGGATTCATTTGGTGGGG - Intergenic
1038227072 8:25667385-25667407 GCCAGGGGATTCATTTAGTGGGG + Intergenic
1038369380 8:26972865-26972887 GCCAGTGGATTCATGTGGTAGGG - Intergenic
1038643079 8:29342704-29342726 CCCAAGTGACCCATTTGGTGGGG + Intronic
1038702685 8:29863778-29863800 GCCAGCAAACCCATTTGATGGGG + Intergenic
1039509729 8:38081364-38081386 GCCAGCAGATCCATTGGGTGGGG - Intergenic
1040944811 8:52873559-52873581 GCCAGTGGATCCATTTGGTGGGG + Intergenic
1042152232 8:65800162-65800184 GCCAGTGGATCTGTTAGGTGGGG - Intronic
1044833042 8:96268845-96268867 GCCAGTGGACCCTGTGGGTCAGG + Intronic
1048121091 8:131582666-131582688 GCCAGTTGGCCCTCTTGGTGGGG - Intergenic
1048893532 8:138968410-138968432 ACCAGAGTATCCATTTGGTGGGG + Intergenic
1053266370 9:36717177-36717199 GCCAGGTGACCCATATGCTGAGG - Intergenic
1055650326 9:78400534-78400556 GCCAGTGGATTCATTTGGTGGGG - Intergenic
1056432325 9:86540185-86540207 CCCACTGGTCCCATTTGGGGAGG - Intergenic
1056729923 9:89156682-89156704 GCCAGTGGCTCCATTTGGTGGGG - Intronic
1057607858 9:96513895-96513917 GGCAGTGGACGCAGGTGGTGTGG - Intronic
1060031974 9:120222378-120222400 GGAAATGGATCCATTTGGTGCGG - Intergenic
1186026627 X:5320432-5320454 GCTAGTAGATCCGTTTGGTGCGG + Intergenic
1186130565 X:6461237-6461259 TCCAGTGGATGCATTTTGTGGGG - Intergenic
1186177940 X:6944728-6944750 GCCAGTGGATCCATTTTTTCAGG - Intergenic
1186511395 X:10132500-10132522 GCCAGCGGGTCCCTTTGGTGGGG + Intronic
1187112375 X:16314936-16314958 GCCAGCAGATCTATTTGGTGGGG - Intergenic
1187854520 X:23623948-23623970 GCCAGTGGATCCATTTCGTGGGG - Intergenic
1190162903 X:48046747-48046769 GCCAGTCTGCCCATTTAGTGGGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1194169648 X:90565422-90565444 GTCAGTGGATCCATTTGGTGGGG - Intergenic
1196314765 X:114209969-114209991 GCCAGAGGATCCATTTGGTGGGG - Intergenic
1196528669 X:116758022-116758044 GCCAGTGGTCACTTTGGGTGAGG - Intergenic
1199772905 X:150985227-150985249 GAGAGAGGACACATTTGGTGGGG - Intronic
1199995143 X:153019452-153019474 GCCACAGCATCCATTTGGTGGGG - Intergenic
1200515887 Y:4143196-4143218 GTCAGTGGATCCATTTGGTGGGG - Intergenic