ID: 983819360

View in Genome Browser
Species Human (GRCh38)
Location 4:172173422-172173444
Sequence CAAGCTGCACCCTCTGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983819360_983819364 -1 Left 983819360 4:172173422-172173444 CCTAGACCAGAGGGTGCAGCTTG 0: 1
1: 0
2: 2
3: 20
4: 170
Right 983819364 4:172173444-172173466 GTCGAGGCACACAGTGCACAGGG 0: 1
1: 0
2: 1
3: 12
4: 163
983819360_983819363 -2 Left 983819360 4:172173422-172173444 CCTAGACCAGAGGGTGCAGCTTG 0: 1
1: 0
2: 2
3: 20
4: 170
Right 983819363 4:172173443-172173465 TGTCGAGGCACACAGTGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 76
983819360_983819365 19 Left 983819360 4:172173422-172173444 CCTAGACCAGAGGGTGCAGCTTG 0: 1
1: 0
2: 2
3: 20
4: 170
Right 983819365 4:172173464-172173486 GGGTGCATTTCTGCACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983819360 Original CRISPR CAAGCTGCACCCTCTGGTCT AGG (reversed) Intronic
901425611 1:9180901-9180923 CCAGCTGCTCCCTCTGCTCCTGG + Intergenic
901664508 1:10818793-10818815 CCAGCTGCACCCTCCGCCCTGGG + Intergenic
902559031 1:17265506-17265528 GCATCTGCACCCTCTGGGCTGGG - Intronic
904423222 1:30407436-30407458 CAAGATGCAGCCTCTGCACTAGG + Intergenic
904498695 1:30902050-30902072 CAAGCTGCCCCCTCAGGCTTGGG + Intronic
908074271 1:60496766-60496788 TATGTTGCACCCTCTGTTCTTGG - Intergenic
908259393 1:62327711-62327733 TAGCCTGCACCCTCTGGTCCTGG - Intergenic
919903162 1:202058736-202058758 GAAGCAGCACCCTCAGGGCTGGG - Intergenic
920244499 1:204577527-204577549 CCTGCCCCACCCTCTGGTCTGGG - Intergenic
922192692 1:223333205-223333227 TAAGCTGCACCCCCTGCTCCTGG - Intronic
922721862 1:227903630-227903652 ACAGCTTCACCCTCGGGTCTGGG + Intergenic
923173754 1:231443184-231443206 CAGGCTGCACCCTCTGATCCTGG - Intergenic
923206909 1:231768037-231768059 CAACTTGCATCCTCTGTTCTGGG - Intronic
923925362 1:238620981-238621003 CAAGATTCACCCACTAGTCTTGG - Intergenic
1065486408 10:26240231-26240253 CATGCTGCACCCTCCAGTCTAGG + Intronic
1065551183 10:26869814-26869836 CAAGCTGAAAGCTCTGGTGTGGG + Intergenic
1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG + Intronic
1068674183 10:59753027-59753049 CAAGCTGCAGCCACAGGTCTTGG + Intergenic
1070552348 10:77500846-77500868 AAAGCTCAACCCTCTGGTTTTGG + Intronic
1071443984 10:85729214-85729236 CAAGCTGCTCCATTTGTTCTTGG - Intronic
1071933010 10:90495515-90495537 CAAGCTGCACCTTCTAATCTTGG + Intergenic
1073827172 10:107337138-107337160 CAAGCTGCACTCTCTGGGTTTGG + Intergenic
1073985774 10:109207341-109207363 CAACCTGCACTATTTGGTCTAGG + Intergenic
1076833946 10:133010541-133010563 CAGGCTGCACCCACCGGTCTGGG + Intergenic
1078042263 11:7878767-7878789 CAAGCTGGAGCCTCCGGACTGGG - Intergenic
1078704963 11:13734674-13734696 CATGCTGACTCCTCTGGTCTGGG - Intergenic
1079303419 11:19299942-19299964 AAAGCTGCACTCTTTTGTCTGGG + Intergenic
1083060293 11:59862957-59862979 CAAGCTGTACCCTATAGCCTAGG - Intronic
1083348732 11:62012412-62012434 CAAGCTGGGCCGTCTGGTCAAGG - Intergenic
1084358340 11:68653799-68653821 CAGGCTGCACCCTGAGGTTTGGG - Intergenic
1089608432 11:119655716-119655738 TACGCTTCACCCACTGGTCTAGG - Intronic
1089871112 11:121673269-121673291 CAAGCTGCAAACTCCGGTCAGGG - Intergenic
1090911332 11:131122104-131122126 CTAGCTGCACCCTCTGCACCTGG - Intergenic
1097977783 12:65707010-65707032 CAGGCTGCACCTTCTGATCCTGG + Intergenic
1100564548 12:95782628-95782650 CCAGCTACTCCCTCTGTTCTTGG + Intronic
1101908050 12:108842486-108842508 CAGGCTGCAGGCTCTGGGCTTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1107791680 13:44008354-44008376 AAATCTGCATCATCTGGTCTTGG - Intergenic
1109145079 13:58769421-58769443 CATGCTGCCCAGTCTGGTCTTGG + Intergenic
1110880952 13:80571652-80571674 GACGCTGCACACACTGGTCTAGG + Intergenic
1112103984 13:96220109-96220131 CAGACTGCACCCTTTTGTCTGGG + Intronic
1113413223 13:110108208-110108230 CAGGCTGGAACCTGTGGTCTCGG + Intergenic
1113518790 13:110923314-110923336 CAAGCTCCACCATCTAGCCTCGG - Intergenic
1113619393 13:111702595-111702617 CAAGCAGCACCCTCATCTCTAGG - Intergenic
1113624922 13:111787856-111787878 CAAGCAGCACCCTCATCTCTAGG - Intergenic
1114398362 14:22387257-22387279 CAAGGTGAATCCTCTGATCTTGG - Intergenic
1115017356 14:28633560-28633582 CAAGCTGCACACTATAGACTTGG + Intergenic
1118353557 14:64991847-64991869 CAACCTGCACCCTCCGTTCCTGG - Intronic
1120340730 14:83217613-83217635 CAAGCTGCACTGCCTGGTGTTGG + Intergenic
1122171194 14:99877113-99877135 CATGCTGGCCCCCCTGGTCTCGG - Intronic
1122510672 14:102264644-102264666 CAAACTGCACTCTCTGGACCTGG + Intronic
1123049909 14:105536201-105536223 CAGGCTGCACCATCAGGGCTCGG + Intergenic
1123689482 15:22825153-22825175 CAGGCTGTACCATCTGGCCTGGG - Exonic
1126874989 15:53031966-53031988 AAAGCTGCTGCCTCTGCTCTGGG - Intergenic
1128602624 15:69010675-69010697 CAAGCTGCACCCTCAGATGAGGG + Intronic
1128761583 15:70219736-70219758 CAGGCTCCACCCTGTGGGCTGGG + Intergenic
1129002395 15:72345615-72345637 CAGGCTGCTACCTCTTGTCTAGG + Intronic
1129225803 15:74169677-74169699 TCAGCTGCAACCTCTGGGCTAGG + Intergenic
1132356912 15:101178516-101178538 AATGATGCGCCCTCTGGTCTTGG + Exonic
1132468394 16:88514-88536 CAAGCCGAACCCTCAGGCCTGGG + Intronic
1135245116 16:20849403-20849425 CATGGTTCACTCTCTGGTCTAGG + Exonic
1136271110 16:29148815-29148837 CAAGCTGCACCTGCTGCCCTGGG - Intergenic
1137897647 16:52231565-52231587 CAAGCTCCACCCCCTGGTTGGGG - Intergenic
1139740853 16:69033844-69033866 CAAGCTGGTCCCTCTGGTCAAGG + Intronic
1141080586 16:81048191-81048213 CAACCTGGACCCACTGCTCTAGG + Intergenic
1142597009 17:1034810-1034832 CAGTCTGCACCCTGTGGCCTGGG - Intronic
1144530443 17:16033437-16033459 GAAGCAGCAACCACTGGTCTGGG + Intronic
1146653821 17:34623475-34623497 CACGCTCCTCCCTCTGGGCTGGG - Intronic
1150656357 17:67042272-67042294 CTGGGTGCACCCTCTGGGCTGGG + Intergenic
1150870950 17:68910639-68910661 CGAGCTGCACTGTCTGGTGTTGG - Intronic
1152344214 17:79741762-79741784 CAAGCAGCACGCGTTGGTCTGGG - Intronic
1152564594 17:81094537-81094559 TAAGCCGCACCCTCTGGCCCCGG - Intronic
1154356570 18:13626409-13626431 CAGGCTGGACCCTCTGGGCCAGG - Intronic
1156405217 18:36776732-36776754 GCTGCTTCACCCTCTGGTCTGGG - Intronic
1159229004 18:65580233-65580255 TTAGCTGCATCCTCTGGTCAGGG - Intergenic
1160463564 18:79057340-79057362 GGAGCTGCACACTCTGGTCCAGG + Intergenic
1160620444 18:80166951-80166973 CATGCTGACCCCTCTGGCCTTGG + Intronic
1160945899 19:1643999-1644021 GAAGCTGCACCCACTGTTCCAGG + Intronic
1161428340 19:4216715-4216737 CAGGCTGCCCCCTCTTCTCTGGG - Exonic
1161529219 19:4777091-4777113 GTGGCTGCCCCCTCTGGTCTTGG - Intergenic
1162462213 19:10819901-10819923 CATGCTACACGCTCTGGCCTGGG + Intronic
1163606787 19:18280233-18280255 CAAGCTGGACCCCCTGCTCCCGG - Exonic
1167747594 19:51361555-51361577 CCAGCCACACCCTCTCGTCTGGG - Intronic
1168030716 19:53677621-53677643 CAACCTCCACCCTCTGGACTGGG + Intergenic
925959290 2:9000678-9000700 TAGGCTGTACCATCTGGTCTAGG - Intronic
927292515 2:21419219-21419241 CCAGCTTCACCCTCTTGTTTTGG - Intergenic
927395958 2:22651535-22651557 CAATCTGGACCCTTTGGACTTGG - Intergenic
929804929 2:45136616-45136638 CAAGCTGCACCCTCACCTCTGGG - Intergenic
932609482 2:73188102-73188124 CAAGGTCCAGCCTCTGTTCTTGG + Intergenic
932649155 2:73536970-73536992 CATTTTGCATCCTCTGGTCTTGG - Intronic
933343975 2:81060338-81060360 TAAGCTGTACCCTCTGATCCTGG + Intergenic
934317739 2:91940791-91940813 TGAGCTGCACCCACTGCTCTGGG + Intergenic
937318205 2:120945392-120945414 CCAGCTGCACCCTCCAGCCTCGG + Intronic
937400205 2:121575909-121575931 GAATCTGCACCCTCTGTTGTTGG - Intronic
943876618 2:193074230-193074252 CAGGCTGCACCCTCTGGTCCTGG + Intergenic
945993955 2:216420327-216420349 CAACCTGCAGCCTCTGGAATGGG + Exonic
946087444 2:217188138-217188160 TCAACTTCACCCTCTGGTCTTGG - Intergenic
947912501 2:233810713-233810735 CAAGCTGCAGCTTCTGCTCCTGG - Intronic
948518557 2:238521736-238521758 CAGCCTGCACCCTCAGGCCTGGG + Intergenic
948598176 2:239093670-239093692 AGAGCTGCACCCTCACGTCTGGG - Intronic
948675494 2:239594362-239594384 CAAGCCCCAGCCTCTGATCTGGG - Intergenic
1170165261 20:13355456-13355478 CAAGCTCCACCCTCTCCTTTGGG + Intergenic
1171191520 20:23162727-23162749 CAAGCAGGACCCTCTGAACTGGG - Intergenic
1171309974 20:24138191-24138213 CAGGCTGCACCCACTGGGGTTGG - Intergenic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1173711352 20:45158393-45158415 CAGGCTGCACCCTCTGATCGTGG - Intergenic
1173773003 20:45680127-45680149 CAAACTGCACCCTCTGATCCTGG + Intergenic
1174279228 20:49426777-49426799 CAAGACTCATCCTCTGGTCTTGG - Intronic
1175025065 20:55893440-55893462 CAAGCTCCCCACTCTGGGCTTGG + Intergenic
1175327541 20:58140227-58140249 CACGCTGCACCCTCAGCTCCTGG + Intergenic
1176316062 21:5245274-5245296 CAACCTGCCGCCTCTGGTGTTGG + Intergenic
1180050850 21:45330454-45330476 CACCCTGCACCCTCTGTGCTTGG - Intergenic
1180305908 22:11124460-11124482 TGAGCTGCACCCACTGCTCTGGG + Intergenic
1180544427 22:16486643-16486665 TGAGCTGCACCCACTGCTCTGGG + Intergenic
1181864969 22:25847588-25847610 CAAGCTGGACCCTCAGTGCTGGG - Exonic
1183984358 22:41561476-41561498 CAAGCCGCAGCCTCCTGTCTGGG + Intronic
1184211976 22:43041397-43041419 CAACCTGCAAACTCTGGTTTTGG - Intronic
1184247261 22:43241961-43241983 CAGGCTGCAGCCTCTTGCCTGGG + Intronic
1184620538 22:45672672-45672694 CAGGCTGCACCATCTGCCCTGGG + Intronic
949563227 3:5221712-5221734 CACTCTGCACCTCCTGGTCTGGG - Intergenic
950972266 3:17201285-17201307 TAAGCAGCACACCCTGGTCTGGG - Intronic
953242811 3:41164951-41164973 GCAGCTGCTCCCTCTGCTCTAGG - Intergenic
955517075 3:59736751-59736773 CAAGCTCCACCCTAAGGTCTGGG - Intergenic
956078530 3:65532721-65532743 CAAGCTGCATCATCAGCTCTAGG + Intronic
959737134 3:109672380-109672402 CAAGCTACCCCCTCCTGTCTAGG + Intergenic
960361084 3:116712435-116712457 CACACTGTACCCTCTGTTCTTGG + Intronic
961529782 3:127533445-127533467 CAAGCTGCCTCCTCTGTCCTGGG - Intergenic
964313072 3:155414773-155414795 GAAGCTGGTGCCTCTGGTCTAGG - Intronic
966665254 3:182464576-182464598 CAGGCTGCACCTTCTGATCCTGG + Intergenic
968598094 4:1495683-1495705 CAAGCTGCAGCCTCTGACCTCGG - Intergenic
969608750 4:8215653-8215675 CGAGCTCCCCCCTCTCGTCTGGG - Intronic
973258177 4:48134498-48134520 CAAACTGCCCTCTCTGGACTGGG + Intergenic
973773280 4:54225543-54225565 CAAGGTGCAGCCTCTCTTCTGGG - Intronic
975629615 4:76387125-76387147 CAAGCTACACCGTCTGGGGTTGG - Intronic
977525949 4:98145050-98145072 CAAACTGCATACTCAGGTCTAGG + Intergenic
977950213 4:102962079-102962101 TGAGCTGCACCCACTGCTCTGGG + Intronic
978341133 4:107721741-107721763 CAGGCAGCAGCCTCAGGTCTTGG - Intergenic
979288478 4:118953876-118953898 CAAACTGGACCCTCTGGGCTTGG + Intronic
979614656 4:122729063-122729085 CAAGAGGGACCCTCTGGTCATGG - Intergenic
982255096 4:153443875-153443897 CAAGCTTCTCCCTCTGCGCTGGG - Intergenic
983819360 4:172173422-172173444 CAAGCTGCACCCTCTGGTCTAGG - Intronic
985776501 5:1846906-1846928 CAAGCTGGGCCCTCTGCTCGGGG - Intergenic
986258174 5:6119207-6119229 CAAGCTGCATCCTCCCATCTAGG - Intergenic
990924938 5:61010172-61010194 CAGGCTTCACACTCTGGTCTTGG + Intronic
992351299 5:75931971-75931993 CAAGCTGTAGCCTCTGATCCAGG + Intergenic
992520469 5:77545565-77545587 CAAGCTGGGCCGTCTGGTCAAGG + Intronic
996631661 5:125640013-125640035 CAGGCTGCACCCTCTGATCTTGG - Intergenic
998554587 5:143110821-143110843 CCATCTGCACCCTGTGGACTGGG + Intronic
1001914681 5:175549621-175549643 CAACCTGCACCTCCTGGGCTCGG - Intergenic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1006630300 6:35426034-35426056 CTCGCTGCACCCTCTGCTCCAGG + Exonic
1008911925 6:56743761-56743783 CAAACTGCACTCTCTGCTCTTGG - Intronic
1012057076 6:94426806-94426828 CAAGCTGCACTGCCTGGTTTTGG + Intergenic
1013611987 6:111804328-111804350 GAAGCGGCACCCTCTGTTCTGGG + Intronic
1013941695 6:115671027-115671049 TGAGCTGCGCCCTCTGGTCAAGG - Intergenic
1015052877 6:128863288-128863310 CAAGCTGCACTGTCTGGGATTGG + Intergenic
1017393808 6:153972952-153972974 CAAGCTCCAACCTCTGTACTGGG - Intergenic
1017721143 6:157244004-157244026 CAAGCTGCACCCTTTGTTACAGG + Intergenic
1017799719 6:157883136-157883158 CAAGCTGCACCCTTTTTGCTGGG - Intronic
1018497068 6:164359459-164359481 AAAGCTGCACCATCTGGAGTTGG + Intergenic
1022539569 7:31123400-31123422 CAACCTGCAGCCGCTGGACTGGG - Intergenic
1022926052 7:35057197-35057219 CTCGCTGCTCCCTCTGGACTCGG - Intergenic
1023738044 7:43251934-43251956 CAAGCTGGACCCAGTGCTCTGGG + Intronic
1023984701 7:45088008-45088030 CAGGCTGCTGCCTCTGCTCTAGG - Intronic
1024184928 7:46940149-46940171 CTGGCTTCACCCTCTGGGCTCGG - Intergenic
1024233913 7:47383821-47383843 CATGCTGCACCCTCTAGTGCAGG + Intronic
1026955879 7:74376246-74376268 CAAGCTGGACTCGCTGGCCTCGG + Exonic
1029125719 7:98293973-98293995 CAGGCTGGACCCCCTGGGCTGGG + Intronic
1031753706 7:125611808-125611830 CAAGCTGCACTGTCTGGAGTTGG - Intergenic
1031938313 7:127759774-127759796 CTAGCTGAACCCTGTGGTGTTGG - Intronic
1034980986 7:155476194-155476216 TAATCTTCCCCCTCTGGTCTAGG - Intronic
1035894710 8:3386441-3386463 CCACCTGCACTCTGTGGTCTCGG + Intronic
1036397491 8:8381586-8381608 CAGGCTGCCCGCTCTGGGCTGGG + Exonic
1038271239 8:26077900-26077922 CAAGCAGCCCCCTCTCCTCTGGG + Intergenic
1046114202 8:109765656-109765678 CAAGCTGCACTGTCTGGGCCTGG + Intergenic
1048298544 8:133234556-133234578 CAAGCCTCACCTTCTGCTCTTGG + Intergenic
1048573777 8:135675604-135675626 TAAGCTGCTCCCTCTGGCCTGGG + Intergenic
1050526646 9:6552199-6552221 TAAGCTGCCCCCTCTGGCCTTGG - Intronic
1052352374 9:27470704-27470726 CAAGCTGCCACCTCTGGTGGAGG + Intronic
1052732613 9:32307383-32307405 CAAACTGCATTCTCTGGGCTGGG - Intergenic
1053750221 9:41246194-41246216 CAAGCTGCACCAGCTGCTCCTGG + Intergenic
1054255719 9:62810532-62810554 CAAGCTGCACCAGCTGCTCCTGG + Intergenic
1054335592 9:63805076-63805098 CAAGCTGCACCAGCTGCTCCTGG - Intergenic
1056878889 9:90369267-90369289 GAACCTTCACACTCTGGTCTAGG - Intergenic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1061239684 9:129362405-129362427 CAAACTGGTCCCTCTGGTCAGGG - Intergenic
1062119704 9:134827697-134827719 CAGGCTGCAGCCTCGGGCCTGGG + Intronic
1062207760 9:135346740-135346762 CAAGAAGCACACTCAGGTCTGGG + Intergenic
1192213410 X:69141910-69141932 CTAGCAGGACCCTCTGGTCCTGG + Intergenic
1193896959 X:87126713-87126735 CAAGCTGCACTTTCTGGGGTTGG - Intergenic
1194329170 X:92560006-92560028 CGAGCTGCACTGTCTGGGCTTGG - Intronic
1200272553 X:154699419-154699441 CAGGCTGGTGCCTCTGGTCTTGG - Exonic
1200637871 Y:5679195-5679217 CGAGCTGCACTGTCTGGGCTTGG - Intronic