ID: 983827231

View in Genome Browser
Species Human (GRCh38)
Location 4:172278496-172278518
Sequence TGATGACCAGGAGGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827231_983827243 25 Left 983827231 4:172278496-172278518 CCTGGGTCCCCTCCTGGTCATCA 0: 1
1: 0
2: 0
3: 22
4: 236
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827231 Original CRISPR TGATGACCAGGAGGGGACCC AGG (reversed) Intronic