ID: 983827233

View in Genome Browser
Species Human (GRCh38)
Location 4:172278503-172278525
Sequence CCCAGGATGATGACCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827233_983827243 18 Left 983827233 4:172278503-172278525 CCCCTCCTGGTCATCATCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 239
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827233 Original CRISPR CCCAGGATGATGACCAGGAG GGG (reversed) Intronic