ID: 983827233 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:172278503-172278525 |
| Sequence | CCCAGGATGATGACCAGGAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 263 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 23, 4: 239} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983827233_983827243 | 18 | Left | 983827233 | 4:172278503-172278525 | CCCCTCCTGGTCATCATCCTGGG | 0: 1 1: 0 2: 0 3: 23 4: 239 |
||
| Right | 983827243 | 4:172278544-172278566 | ATCTGTAGATCAGTTGTTTCTGG | 0: 1 1: 0 2: 1 3: 5 4: 128 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983827233 | Original CRISPR | CCCAGGATGATGACCAGGAG GGG (reversed) | Intronic | ||