ID: 983827235

View in Genome Browser
Species Human (GRCh38)
Location 4:172278504-172278526
Sequence GCCCAGGATGATGACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827235_983827243 17 Left 983827235 4:172278504-172278526 CCCTCCTGGTCATCATCCTGGGC 0: 1
1: 0
2: 4
3: 35
4: 307
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827235 Original CRISPR GCCCAGGATGATGACCAGGA GGG (reversed) Intronic