ID: 983827236

View in Genome Browser
Species Human (GRCh38)
Location 4:172278505-172278527
Sequence AGCCCAGGATGATGACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827236_983827243 16 Left 983827236 4:172278505-172278527 CCTCCTGGTCATCATCCTGGGCT 0: 1
1: 0
2: 2
3: 23
4: 229
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827236 Original CRISPR AGCCCAGGATGATGACCAGG AGG (reversed) Intronic