ID: 983827238

View in Genome Browser
Species Human (GRCh38)
Location 4:172278520-172278542
Sequence ATACAGGGAAAGGGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827238_983827244 21 Left 983827238 4:172278520-172278542 CCTGGGCTTCCCTTTCCCTGTAT 0: 1
1: 0
2: 4
3: 49
4: 346
Right 983827244 4:172278564-172278586 TGGATCCTGTGTTATCCTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 155
983827238_983827243 1 Left 983827238 4:172278520-172278542 CCTGGGCTTCCCTTTCCCTGTAT 0: 1
1: 0
2: 4
3: 49
4: 346
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827238 Original CRISPR ATACAGGGAAAGGGAAGCCC AGG (reversed) Intronic