ID: 983827239

View in Genome Browser
Species Human (GRCh38)
Location 4:172278529-172278551
Sequence CTACAGATGATACAGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827239_983827244 12 Left 983827239 4:172278529-172278551 CCCTTTCCCTGTATCATCTGTAG 0: 1
1: 0
2: 0
3: 27
4: 268
Right 983827244 4:172278564-172278586 TGGATCCTGTGTTATCCTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 155
983827239_983827243 -8 Left 983827239 4:172278529-172278551 CCCTTTCCCTGTATCATCTGTAG 0: 1
1: 0
2: 0
3: 27
4: 268
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827239 Original CRISPR CTACAGATGATACAGGGAAA GGG (reversed) Intronic