ID: 983827240

View in Genome Browser
Species Human (GRCh38)
Location 4:172278530-172278552
Sequence TCTACAGATGATACAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827240_983827244 11 Left 983827240 4:172278530-172278552 CCTTTCCCTGTATCATCTGTAGA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 983827244 4:172278564-172278586 TGGATCCTGTGTTATCCTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 155
983827240_983827243 -9 Left 983827240 4:172278530-172278552 CCTTTCCCTGTATCATCTGTAGA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827240 Original CRISPR TCTACAGATGATACAGGGAA AGG (reversed) Intronic