ID: 983827243

View in Genome Browser
Species Human (GRCh38)
Location 4:172278544-172278566
Sequence ATCTGTAGATCAGTTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 128}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983827235_983827243 17 Left 983827235 4:172278504-172278526 CCCTCCTGGTCATCATCCTGGGC 0: 1
1: 0
2: 4
3: 35
4: 307
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827231_983827243 25 Left 983827231 4:172278496-172278518 CCTGGGTCCCCTCCTGGTCATCA 0: 1
1: 0
2: 0
3: 22
4: 236
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827239_983827243 -8 Left 983827239 4:172278529-172278551 CCCTTTCCCTGTATCATCTGTAG 0: 1
1: 0
2: 0
3: 27
4: 268
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827236_983827243 16 Left 983827236 4:172278505-172278527 CCTCCTGGTCATCATCCTGGGCT 0: 1
1: 0
2: 2
3: 23
4: 229
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827233_983827243 18 Left 983827233 4:172278503-172278525 CCCCTCCTGGTCATCATCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 239
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827238_983827243 1 Left 983827238 4:172278520-172278542 CCTGGGCTTCCCTTTCCCTGTAT 0: 1
1: 0
2: 4
3: 49
4: 346
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827237_983827243 13 Left 983827237 4:172278508-172278530 CCTGGTCATCATCCTGGGCTTCC 0: 1
1: 0
2: 0
3: 32
4: 260
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128
983827240_983827243 -9 Left 983827240 4:172278530-172278552 CCTTTCCCTGTATCATCTGTAGA 0: 1
1: 0
2: 1
3: 15
4: 200
Right 983827243 4:172278544-172278566 ATCTGTAGATCAGTTGTTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827243 Original CRISPR ATCTGTAGATCAGTTGTTTC TGG Intronic