ID: 983827387

View in Genome Browser
Species Human (GRCh38)
Location 4:172280871-172280893
Sequence GCAAATTCTGGCCCGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983827387 Original CRISPR GCAAATTCTGGCCCGCACGG TGG Intronic
900409858 1:2507622-2507644 GCCATTTCTGGCCCCCACTGTGG - Intergenic
905394997 1:37661215-37661237 GCCAATGCTGGCCCTCAAGGAGG - Intergenic
920327268 1:205175377-205175399 GCAGCTTCTGGCGGGCACGGTGG - Intronic
924112873 1:240717067-240717089 GCGAATTCTGGCCGGCATGGTGG - Intergenic
1076997251 11:304146-304168 GCGACCTCTGGCCCTCACGGCGG + Intergenic
1091585151 12:1811665-1811687 GCAAATTCTGGGCGGCAACGCGG - Exonic
1091791197 12:3273212-3273234 CCAAATCCTGGCCCTCAAGGAGG + Intronic
1097035561 12:56121438-56121460 GCAGACTCTGGCCCCCACTGTGG + Exonic
1097171974 12:57120384-57120406 GCAAATTATGCCAGGCACGGTGG - Intronic
1097682658 12:62663472-62663494 GCAAATTTTGGCTGGCATGGTGG - Intronic
1101649059 12:106658522-106658544 GCAAATTCTGAGCCACAAGGAGG - Intronic
1130520649 15:84658368-84658390 CCACACTCTGGCCCGCACGCGGG + Exonic
1131528274 15:93170193-93170215 GCAAATTGGGGCGGGCACGGTGG - Intergenic
1132763244 16:1521351-1521373 GGAAAATCAGGCCGGCACGGTGG - Intronic
1135342272 16:21659150-21659172 GGAAATTCTGGCCGGTGCGGTGG - Intergenic
1136048796 16:27636194-27636216 GAAAAGTCTGGCCCCCACGCTGG + Intronic
1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG + Intergenic
1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG + Intergenic
1149603263 17:57907069-57907091 GGAAATCCTGGCCTGCACAGAGG + Intronic
1149732532 17:58960485-58960507 CAAAGTTCTGGCCAGCACGGTGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152739113 17:82011358-82011380 CCCAAGTGTGGCCCGCACGGTGG + Intronic
1158621596 18:59037316-59037338 TCAAATTCTGGCCCACAGAGTGG + Intergenic
1167691262 19:50984652-50984674 CCTAATTCTGGCCCGCCTGGGGG + Intergenic
926541017 2:14182033-14182055 GCAAACTCTGGCCCACAGGCTGG - Intergenic
927876258 2:26657295-26657317 CCAAATTCAGGCGGGCACGGTGG - Intergenic
928488811 2:31759659-31759681 GCAGATTCTGGGCAGCACAGAGG - Intergenic
937047061 2:118857483-118857505 GCAAACTCTCGACCACACGGAGG - Intergenic
938246775 2:129782964-129782986 GCAATTTCTGGACCCCACAGTGG - Intergenic
942252052 2:174055446-174055468 GCAAATTCTGCCGGGCGCGGTGG - Intergenic
944544560 2:200786183-200786205 GTAAATTCTGGCTGGCACGGTGG - Intergenic
1170868031 20:20177657-20177679 AGAAATTCTTGCCCTCACGGGGG + Intronic
1178981085 21:37266203-37266225 GAAAAATCTGGCCCGCGCGGTGG - Intronic
1178988878 21:37334869-37334891 CCAAATTTTGGCCAGCATGGTGG + Intergenic
1179209278 21:39312727-39312749 GCAAAGTGTGACCCGCACTGGGG - Intronic
1179464348 21:41561856-41561878 GCTCATTCTGGCCCCCATGGTGG - Intergenic
1180260277 21:46663632-46663654 GCAGATGCTGGCCCACACTGGGG + Intronic
1184729982 22:46366672-46366694 GCACATCCTGGCCCGCGCTGTGG + Intronic
1185299352 22:50071564-50071586 GGAAATCCTGTCCCACACGGAGG - Intronic
966019297 3:175188385-175188407 GAAGAATCTGGCCCTCACGGGGG - Intronic
972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG + Intergenic
976629749 4:87224235-87224257 GCAAATGTTGGCCGGCGCGGTGG - Intronic
979654604 4:123177496-123177518 TCAAGGTCTGGCCAGCACGGTGG - Intronic
980071119 4:128243608-128243630 GGAAATTCTGGCCCTCTGGGTGG + Intergenic
983827387 4:172280871-172280893 GCAAATTCTGGCCCGCACGGTGG + Intronic
1001308983 5:170597173-170597195 GAACATTTAGGCCCGCACGGTGG + Intronic
1001639275 5:173233817-173233839 ACAAATTCGGGCGGGCACGGCGG - Intronic
1003918887 6:10813440-10813462 GGAATTTCTGGCTGGCACGGTGG - Intronic
1006747018 6:36350044-36350066 GCAAATTAGGTCCAGCACGGTGG - Intergenic
1021003258 7:15360329-15360351 GCAAATTTTTGACCGCACGGGGG - Intronic
1035555164 8:562446-562468 GCAAACTCCGGCCAGCAGGGAGG + Intergenic
1036095751 8:5723829-5723851 GCAAATTCTGTCTCACACGCAGG + Intergenic
1037786710 8:21907743-21907765 GGAAATTCTGCCAGGCACGGTGG - Intergenic
1038023421 8:23568974-23568996 GCTAATTCTGGCCGGCATGGTGG + Intronic
1038209201 8:25499589-25499611 ACTAATTCAGGCCAGCACGGTGG - Intronic
1040291661 8:46128656-46128678 GCAAAATCTGGGCCACAGGGTGG - Intergenic
1050966999 9:11817523-11817545 GCAAATTCTCGTCTGCACGAAGG + Intergenic
1053162583 9:35823950-35823972 GCAAATTCTGGCTGGCAAGGTGG - Intronic
1056402393 9:86240992-86241014 GCAAATTAGGGCCGGCACAGTGG - Intronic
1190456085 X:50629010-50629032 GGAAATCCTGGCCCCCACTGTGG - Intronic