ID: 983832522

View in Genome Browser
Species Human (GRCh38)
Location 4:172345921-172345943
Sequence GAGAATAAATAGTCGTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983832522_983832528 16 Left 983832522 4:172345921-172345943 CCACCATACGACTATTTATTCTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 983832528 4:172345960-172345982 TTGGTTGATACTTGTTCTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
983832522_983832526 14 Left 983832522 4:172345921-172345943 CCACCATACGACTATTTATTCTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 983832526 4:172345958-172345980 TGTTGGTTGATACTTGTTCTAGG No data
983832522_983832524 -3 Left 983832522 4:172345921-172345943 CCACCATACGACTATTTATTCTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 983832524 4:172345941-172345963 CTCTAACTTCCATTATTTGTTGG No data
983832522_983832527 15 Left 983832522 4:172345921-172345943 CCACCATACGACTATTTATTCTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 983832527 4:172345959-172345981 GTTGGTTGATACTTGTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983832522 Original CRISPR GAGAATAAATAGTCGTATGG TGG (reversed) Intronic
905777282 1:40676929-40676951 GAAAATAAATTGTCCTAAGGGGG - Intergenic
911496950 1:98643519-98643541 GTGAATATACAGTCGTATGCAGG + Intergenic
923356486 1:233160960-233160982 GACAGTTAATAGTCATATGGTGG - Intronic
1065885139 10:30070103-30070125 GAGGATAATTAGTGGTTTGGAGG + Intronic
1068782930 10:60941559-60941581 AAAAATAAAAAGTCGTATGATGG + Intronic
1070554337 10:77516336-77516358 GGGAAAAAATAGTGCTATGGAGG - Intronic
1072935448 10:99708114-99708136 GAGAATAAATAGAAGATTGGTGG - Intronic
1081229011 11:40561819-40561841 GAAACTAAATAGTTGTTTGGTGG + Intronic
1081418754 11:42847005-42847027 GAGAATAAATAGTTTGAGGGAGG + Intergenic
1082793548 11:57364038-57364060 GAGAACAAAAAGTCGTATCCTGG - Intronic
1087798159 11:102476137-102476159 GAGAATAAATAGTCTTTGGCAGG + Intronic
1088157097 11:106820192-106820214 AAAAATAAATAGCCCTATGGGGG - Intronic
1093408424 12:18834995-18835017 GAGAACAAATAGACACATGGAGG + Intergenic
1096211792 12:49772034-49772056 GAAAAAAAATAGTTGAATGGTGG + Intergenic
1098774656 12:74597032-74597054 TAGAATAAATTGTCGTGTGAAGG - Intergenic
1098842646 12:75495039-75495061 AATAATAAATAATGGTATGGGGG - Exonic
1100735156 12:97520641-97520663 GAGAATTAAAAATCGTTTGGGGG - Intergenic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1110755648 13:79171151-79171173 GAAAACAAACAGTGGTATGGGGG + Intergenic
1113022174 13:105899741-105899763 GAGAATACATGGGCGCATGGTGG + Intergenic
1114440180 14:22740039-22740061 GTGAATAGATAAGCGTATGGTGG + Intergenic
1116205357 14:41858511-41858533 GAGAAAAAATAAGCCTATGGCGG - Intronic
1116668088 14:47804149-47804171 GAAAATAAACTGTCTTATGGAGG - Intergenic
1125469334 15:39987137-39987159 GAGGATAAACAGTGGTTTGGGGG - Intronic
1127628166 15:60800728-60800750 GAGGATAAATAGGAGTTTGGGGG - Intronic
1146082951 17:29798808-29798830 GAAAATAAATAGTAACATGGTGG - Intronic
1146906225 17:36619844-36619866 GAAAATAAACAGTCTTATTGAGG - Intergenic
1149185532 17:53992782-53992804 TAGAATAAAAAGTGGAATGGTGG - Intergenic
1155122420 18:22835802-22835824 GAAAACAAATAGCAGTATGGAGG + Intronic
1160103843 18:75949803-75949825 GTGAATAAATATACATATGGGGG + Intergenic
1160279997 18:77480353-77480375 GAGAACACATAGACGTAGGGAGG - Intergenic
925884042 2:8379142-8379164 TAGAATAAATACACGTATGATGG + Intergenic
927815059 2:26208396-26208418 GAGCATTTATTGTCGTATGGAGG - Intronic
930356449 2:50327155-50327177 GAGAATAAATAATCAAATCGTGG + Intronic
931862965 2:66376342-66376364 CAGAAAAAATAGCAGTATGGAGG - Intergenic
940962791 2:159803197-159803219 GAGAATAAATAGGCGGGTAGTGG - Intronic
942782769 2:179665541-179665563 GAGAATAAATAGTTTAATGAGGG - Intronic
943856089 2:192793298-192793320 CAGAAAAAATAGTAATATGGAGG - Intergenic
943900984 2:193436110-193436132 GAGAATCAATATTTGTTTGGAGG + Intergenic
945339561 2:208635822-208635844 GAGATTAAAAAGTAGAATGGTGG + Intronic
946466420 2:219916064-219916086 GAGAATACATAGCGGGATGGTGG - Intergenic
1174782844 20:53406027-53406049 GAAAATAAATAGTGGTGAGGTGG + Intronic
1175345872 20:58275023-58275045 TAGAATAAATAGCCATATGGGGG + Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176935598 21:14862790-14862812 GAGAAAAAATAGTGGTAGGAAGG + Intergenic
1177534862 21:22411601-22411623 GAAAATAAATGGTGGTAAGGAGG - Intergenic
951398923 3:22205867-22205889 GAAAATAAATAGCCAAATGGCGG + Intronic
953811028 3:46112986-46113008 GAGAACAAATTGCCGTAGGGGGG + Intergenic
955566959 3:60257845-60257867 GAGAACAAATAGACACATGGCGG + Intronic
958882037 3:99683208-99683230 TAGAATATAGAGTCTTATGGGGG - Intronic
959861050 3:111215445-111215467 GAGAATGGATAGTTGGATGGAGG + Intronic
961917725 3:130394378-130394400 TAGAATAATTAGTCATAAGGTGG + Intronic
964099539 3:152972495-152972517 GAGAATAAATGGACACATGGAGG + Intergenic
965075639 3:163971552-163971574 GAGACTAAACAGTAGTTTGGTGG - Intergenic
965496811 3:169408641-169408663 GAGAATAAATAATAGTACTGTGG - Intronic
971189945 4:24417962-24417984 CAAAATAAATAGTCTGATGGTGG - Intergenic
973223195 4:47752236-47752258 GATAATAAATACTCGTTTAGCGG - Intronic
974704307 4:65491992-65492014 GAGAATAAAATGGAGTATGGTGG + Intronic
975962749 4:79932998-79933020 GAAAATAAATAGGCTTATGATGG - Intronic
983832522 4:172345921-172345943 GAGAATAAATAGTCGTATGGTGG - Intronic
988163886 5:27558193-27558215 GAGAATACATAGACACATGGAGG + Intergenic
991951469 5:71950418-71950440 GAGAATATATGGGCGTAGGGAGG - Intergenic
992618718 5:78571473-78571495 GCGAATAATTATTAGTATGGTGG - Intronic
994809818 5:104501268-104501290 GAGAATAAAGACTCGTAAGAAGG + Intergenic
995535461 5:113131301-113131323 GAGATTATATAGTGGGATGGGGG - Intronic
996313433 5:122133927-122133949 GAGAAGAAACAGTCATATGAAGG - Intronic
999967339 5:156823588-156823610 GAGAAAAAATAGTCATATGAAGG - Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1006122883 6:31817852-31817874 AAGAAGAAATAGTCGTAAGATGG - Exonic
1010668608 6:78659110-78659132 GAGAATAAATTTTTGTATTGAGG - Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1022711744 7:32857074-32857096 GAGATAAAATAGTCTTTTGGAGG + Intergenic
1022912915 7:34917882-34917904 GAGATAAAATAGTCTTTTGGAGG - Intergenic
1028624843 7:92865904-92865926 GAGAATAACTGGTATTATGGAGG + Intergenic
1028629516 7:92919419-92919441 GAGAATACATAGACATAGGGAGG - Intergenic
1028636151 7:92991746-92991768 AAGAATAAATAGCCTTATGAAGG - Intergenic
1030745922 7:113166219-113166241 GAGAATACATAGACATAAGGAGG - Intergenic
1031530228 7:122866999-122867021 AAGAATAAAAAGTCCTGTGGTGG - Intronic
1035023278 7:155810996-155811018 GCGAATAAATATTAGTGTGGGGG - Intronic
1041204855 8:55488637-55488659 GAGAATAAAAAGACCAATGGTGG + Intronic
1046614228 8:116458349-116458371 GAGAAAAAATAATCTTATGATGG + Intergenic
1061928803 9:133821663-133821685 GAGACTAAAAAGTTGGATGGGGG + Intronic
1188437970 X:30184596-30184618 GAGAATAATTAGTAGGATGGAGG + Intergenic
1193062186 X:77218799-77218821 GAGAATCACTAGTCTTATGGTGG + Intergenic
1194327303 X:92535472-92535494 GAGAATACATAGACATATAGAGG + Intronic
1198323493 X:135543131-135543153 GAGAATAAATTGTGGGGTGGAGG - Intronic
1200636019 Y:5654680-5654702 GAGAATACATAGACATATAGAGG + Intronic
1201728611 Y:17182462-17182484 GAGAATAAATAAACAAATGGTGG + Intergenic
1201914647 Y:19169072-19169094 GAGACTAATTAGTGGTATGTGGG + Intergenic
1202303759 Y:23445859-23445881 GAGAATAAAAAAAAGTATGGAGG + Intergenic
1202567051 Y:26224734-26224756 GAGAATAAAAAAAAGTATGGAGG - Intergenic