ID: 983833551

View in Genome Browser
Species Human (GRCh38)
Location 4:172361677-172361699
Sequence AGTCAAAAGGGGCATAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983833545_983833551 -5 Left 983833545 4:172361659-172361681 CCCTTTTTTTCATTAGTGAGTCA 0: 1
1: 0
2: 4
3: 30
4: 459
Right 983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG No data
983833543_983833551 -3 Left 983833543 4:172361657-172361679 CCCCCTTTTTTTCATTAGTGAGT 0: 1
1: 0
2: 2
3: 24
4: 378
Right 983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG No data
983833546_983833551 -6 Left 983833546 4:172361660-172361682 CCTTTTTTTCATTAGTGAGTCAA 0: 1
1: 0
2: 0
3: 21
4: 307
Right 983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG No data
983833544_983833551 -4 Left 983833544 4:172361658-172361680 CCCCTTTTTTTCATTAGTGAGTC 0: 1
1: 1
2: 2
3: 25
4: 292
Right 983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983833551 Original CRISPR AGTCAAAAGGGGCATAAAAT GGG Intronic
No off target data available for this crispr