ID: 983834200

View in Genome Browser
Species Human (GRCh38)
Location 4:172369545-172369567
Sequence CAGGCTGCATGGGAGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983834196_983834200 -8 Left 983834196 4:172369530-172369552 CCCGTCGGGGAGGTTCAGGCTGC 0: 1
1: 4
2: 15
3: 47
4: 186
Right 983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG 0: 1
1: 0
2: 1
3: 33
4: 334
983834197_983834200 -9 Left 983834197 4:172369531-172369553 CCGTCGGGGAGGTTCAGGCTGCA 0: 1
1: 1
2: 9
3: 32
4: 210
Right 983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG 0: 1
1: 0
2: 1
3: 33
4: 334
983834190_983834200 12 Left 983834190 4:172369510-172369532 CCGCGGAGCAGGGGGTGGCACCC 0: 2
1: 17
2: 69
3: 263
4: 796
Right 983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG 0: 1
1: 0
2: 1
3: 33
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983834200 Original CRISPR CAGGCTGCATGGGAGCACCC TGG Intronic
900538397 1:3190490-3190512 CAGGATGCCTCGCAGCACCCAGG - Intronic
900961883 1:5927706-5927728 CAGGCTCCGTGGGTGCATCCAGG + Exonic
901193139 1:7424525-7424547 CTTGCTGCATGGGAGCAAACAGG + Intronic
901691481 1:10976208-10976230 GAGGCTCCATGGGAACACCGTGG + Exonic
902805021 1:18855579-18855601 GAGGCTGGATGGGACCACCAAGG - Intronic
904605613 1:31696194-31696216 CAGGCTGGAAAGGGGCACCCAGG + Intronic
905249821 1:36640769-36640791 CAGGCTGCATGGGCAGAGCCTGG - Intergenic
905635196 1:39546296-39546318 CTGGCTACATGGAAGCAACCGGG + Intergenic
905648503 1:39640613-39640635 GAAGCTGCATGAGAGCATCCTGG + Intergenic
906065405 1:42976994-42977016 GAGGCTGCACGGGAGCACTGGGG + Intergenic
906264535 1:44418145-44418167 CGGGGTGCATGGGAGCGCGCGGG + Intronic
906323632 1:44831196-44831218 CAGGCTGCATGGGCCCACCAGGG + Intronic
907540971 1:55215235-55215257 CCGGCTGCTGCGGAGCACCCGGG - Intergenic
908301153 1:62761818-62761840 CAGGCTGCAGGGGAGCCCATGGG - Intergenic
908549620 1:65195579-65195601 CAGGCAGTCTGGCAGCACCCGGG - Intronic
908798407 1:67853947-67853969 CAGGAAGCAGGGGAGCACCAAGG - Intergenic
909317991 1:74247973-74247995 CAGGTTGCCTGGGAGCCCACGGG + Intronic
910371744 1:86523886-86523908 CAGGCTGCATGAGAGCCCACAGG + Intergenic
912181126 1:107220279-107220301 CAGGCTCCATGGGAGAGCCAAGG - Intronic
912800328 1:112715844-112715866 CAGGCTGCAGCCGACCACCCCGG + Intergenic
913107720 1:115629780-115629802 GAGGCAGGATGGGAGCACCGTGG - Intergenic
913443518 1:118925139-118925161 CAGGATGCATGTGTGCACACAGG - Intronic
915118139 1:153612939-153612961 GAGGCAGCAGGTGAGCACCCTGG - Intronic
915587948 1:156854457-156854479 CAGGCTGCAGGTGAGCCCTCCGG - Intronic
916897973 1:169186328-169186350 CAGGCTTCATAGGAACACACAGG + Intronic
919757554 1:201075368-201075390 CTGGCTGGAGGGGAGCTCCCAGG - Intronic
920381090 1:205534922-205534944 CAGGGTGAATGGGAGCCCACAGG - Intergenic
920670713 1:208002031-208002053 CTGGGTGCAAGGGAGGACCCAGG - Intergenic
922033448 1:221825974-221825996 CAGGCTCCATGGTAGCATCTAGG - Intergenic
922482388 1:225948012-225948034 CGTGCTGTATGGGAGCACCTGGG - Intergenic
922973781 1:229766630-229766652 CAGGCAGCATGGAAGCTTCCTGG + Intergenic
923487308 1:234445756-234445778 TAGGTTGCATGTGAGCACACAGG + Intronic
923620760 1:235577320-235577342 CAGGCTGCATGGGAACCAGCTGG - Intronic
924144664 1:241061590-241061612 TAGGGTGCTTGGGAGCACGCAGG + Intronic
1063130642 10:3173729-3173751 AAGGCTGCATGGCAGGTCCCAGG + Intergenic
1064140409 10:12785409-12785431 CAGGAGGCATGGGAGCAGCAGGG + Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1067056788 10:43057163-43057185 CAGGCTGCATGAGGCCACCATGG - Intergenic
1067400477 10:45969088-45969110 CAGGCTGGACGGGAACTCCCGGG + Intergenic
1067868821 10:49938645-49938667 CAGGCTGGACGGGAACTCCCGGG + Intronic
1069947714 10:71999256-71999278 GAGGCGGCAGGGGAGCCCCCAGG - Intronic
1073493673 10:103872487-103872509 CAGGCTGTGTGGGAGCAAGCAGG - Intergenic
1075658039 10:124174672-124174694 GGGCCTGCATGGGAGGACCCTGG - Intergenic
1075712127 10:124536414-124536436 CAGGCTGGATGGAAGCTCCCCGG + Intronic
1076067861 10:127463530-127463552 CAGGCAGGCTGGGAGGACCCTGG - Intergenic
1076458877 10:130624506-130624528 CAGGCTGCACGGGAACAGCCAGG - Intergenic
1076698279 10:132257430-132257452 CAGGGTGCCTGAGAGCTCCCAGG + Intronic
1077522311 11:3043597-3043619 GAGGCAGGATGCGAGCACCCTGG - Intronic
1078051050 11:7965120-7965142 CAGGCTGCATGGGAAGACTCAGG + Intronic
1078086865 11:8239197-8239219 CAGGCTGCACCGGAGAATCCAGG - Intronic
1078448743 11:11424707-11424729 CAGGGTGCGTGGGAGCACTGAGG + Intronic
1078931772 11:15918163-15918185 CAGGATTCTTGGGAACACCCAGG - Intergenic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1084363908 11:68685524-68685546 TATGCTGAATGGGTGCACCCAGG - Intronic
1085524125 11:77154598-77154620 GAGGCTGGAGGGGAGCAGCCAGG - Intronic
1086001042 11:81986752-81986774 CGGGCTGCGTGGGAGCCCACTGG + Intergenic
1087990760 11:104743647-104743669 CAGGCTGTATGGGAGCAGGTTGG + Intergenic
1089649325 11:119902119-119902141 CAGGATGAGTGGGTGCACCCAGG - Intergenic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1091274785 11:134342751-134342773 CAGGCTGGACTGGAGCACCCTGG + Exonic
1092425400 12:8371564-8371586 CTGGCTGCATGAGATCACCTGGG + Intergenic
1094258831 12:28467429-28467451 CATGCAGCACTGGAGCACCCAGG + Intronic
1094311391 12:29087257-29087279 CAGGCTGCAGGGGTCCACCATGG - Intergenic
1094348345 12:29496867-29496889 CAGGCTGAAAGGGAGCAGACAGG - Intronic
1096024468 12:48349629-48349651 AGGGCCTCATGGGAGCACCCTGG + Intronic
1096561695 12:52440119-52440141 CAGGCTGCATGGCCACAGCCTGG - Intergenic
1096593595 12:52679412-52679434 CAGGGTGCAAGTGAGAACCCTGG - Intronic
1097253725 12:57656051-57656073 CCAGCTGCATGGGAGCCCACGGG - Intergenic
1101755372 12:107617209-107617231 CAGGGTGCACTGGAGCTCCCTGG - Intronic
1101902030 12:108798037-108798059 CAGGCCCCATGGCAGCATCCAGG - Intronic
1102507215 12:113391166-113391188 CAGGCTGCATGAGATCAGACAGG - Exonic
1102564100 12:113783394-113783416 CAGGATGACTGTGAGCACCCCGG + Intergenic
1103008665 12:117440887-117440909 CAGGCAGGGTGGGAGCGCCCGGG - Intronic
1103744680 12:123114442-123114464 CAGCTTGCATGGGAGGAACCTGG + Intronic
1104805433 12:131586537-131586559 CAGGCCTCAGGGGAGCACACTGG + Intergenic
1105407099 13:20142127-20142149 CAGTCTGGAGGGGAGCGCCCTGG - Exonic
1105542325 13:21326382-21326404 CAGGCTTCAGGGGAGCACTCGGG - Intergenic
1106070490 13:26406747-26406769 GAGCCTGGATGGCAGCACCCAGG - Intergenic
1106132689 13:26952882-26952904 CACACTGCAAGGGGGCACCCTGG - Intergenic
1108378234 13:49833470-49833492 GAGGCTGCATGACACCACCCAGG - Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1112547118 13:100381925-100381947 CAGGCCCCATGGCAGCATCCAGG + Intronic
1112822963 13:103357346-103357368 CTGGCTACATGGAAGCACTCTGG + Intergenic
1113680318 13:112239018-112239040 CAGGCTGCATGGGAGCCCATGGG - Intergenic
1113736408 13:112681530-112681552 TAGGCAGCATGGGAAGACCCTGG - Intronic
1113881636 13:113630074-113630096 CAGGCTGCCTGAGAGCGCGCTGG - Intronic
1113926889 13:113946730-113946752 CAGGGTGGAGGGGAGGACCCAGG - Intergenic
1114539809 14:23446523-23446545 CTGGATGCATGTGAGAACCCAGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1117829107 14:59732914-59732936 GAGACTGCATTGGAGCCCCCCGG + Intronic
1117912753 14:60650011-60650033 GAGGCTGCATGCGCGGACCCTGG - Intronic
1118385991 14:65256014-65256036 CAAGCTGCAGGGGACCACCAGGG - Intergenic
1120163533 14:81170292-81170314 CAGGCAGCTTGGGAGCACTTCGG + Intergenic
1121414040 14:93766615-93766637 CATGCTGCATGTGAGGCCCCAGG - Intronic
1121485392 14:94310576-94310598 CAAGCTGGATGGTGGCACCCTGG - Intronic
1121498148 14:94411817-94411839 GAGTCTGCCTGGGAGCACACTGG + Intergenic
1122125610 14:99576946-99576968 CAGGCTGCCTGGGGGCACGGTGG + Intronic
1122152323 14:99731784-99731806 CAGCCCGCACAGGAGCACCCTGG + Intergenic
1122597420 14:102903073-102903095 CAGGCCTCCTGGGAGCTCCCTGG - Intronic
1122864291 14:104596557-104596579 CTGGCTGCATGGGAGAGCCCAGG - Intronic
1122935497 14:104954178-104954200 CAGGCTCCATGGAAAGACCCTGG - Exonic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124601489 15:31136225-31136247 CAGGCTCCATGGGGTCACCAAGG + Intronic
1126097508 15:45099947-45099969 GAGTCTGCATGGGAGAGCCCAGG - Intronic
1126541748 15:49831715-49831737 CAGGCTCCATGGGAGAGCTCAGG - Intergenic
1127288886 15:57553286-57553308 CTGGCAGCAAGGGAGCACTCAGG - Intergenic
1127819432 15:62641948-62641970 CAGGCTGCTCAGGATCACCCTGG - Intronic
1129849117 15:78781645-78781667 CAGGCTGTTGGGCAGCACCCTGG + Intronic
1129911847 15:79234466-79234488 CAGGGGCCATGGGGGCACCCAGG + Intergenic
1131846071 15:96491906-96491928 CAGGCCGCACAGGAGCCCCCGGG + Intergenic
1132456492 16:26521-26543 CAGGAAGCATGAGAGCACCCAGG + Intergenic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1132936532 16:2484068-2484090 CATTCTGCATGGGAGGACCAGGG + Intronic
1133036609 16:3037004-3037026 CAGGCAGCCAGGGAGCGCCCCGG - Intergenic
1133734872 16:8607383-8607405 CAGGATGCCTGGGGGCACTCGGG - Intergenic
1135510043 16:23074659-23074681 CAGGCTCCATGGAAGTTCCCTGG + Intronic
1135914927 16:26597063-26597085 AAGGCTGCATGAGAGCCACCAGG + Intergenic
1136991222 16:35152402-35152424 CAGGCTCCAAGGGAGCAGGCTGG + Intergenic
1137483288 16:48870292-48870314 CAGGCAGCATGTGGGCAGCCTGG - Intergenic
1140967607 16:79982441-79982463 CAGACAACATGGCAGCACCCAGG - Intergenic
1141157315 16:81606337-81606359 CAGGGTGCATGGGAGAGCCAGGG + Intronic
1141512242 16:84519894-84519916 AAGCCTGCATCGGAGCCCCCAGG - Intronic
1142138997 16:88464283-88464305 CAGGCAGCCTGGGGGCACCTGGG - Intronic
1142173143 16:88633307-88633329 CAGGCTGCAGGCTGGCACCCAGG - Intergenic
1142351728 16:89583778-89583800 CAGGCTGCAGGGGTGCGCCCGGG - Intronic
1142410495 16:89913562-89913584 CACGCTGCCTGTGGGCACCCGGG - Intronic
1142417806 16:89952602-89952624 CAGTCTCCCAGGGAGCACCCAGG - Intronic
1142981410 17:3674269-3674291 CAGGCTGGATGGGAGTGCCGTGG - Intronic
1144362361 17:14507627-14507649 CAGTGGGCATGGGAGCAACCTGG - Intergenic
1144757999 17:17691819-17691841 CAGGCTGGAAGGTAGCACCTGGG - Intronic
1145835662 17:27952573-27952595 CGGGCTGCATGGGAGTAGGCAGG - Intergenic
1147318400 17:39632007-39632029 CACGGTGCATGGTAGCACCCTGG - Intronic
1147533565 17:41302580-41302602 CAGGCTGCGTGGGAGCACATAGG + Exonic
1147559134 17:41498105-41498127 CAGGGTGCCTTGGAGCAGCCAGG + Intergenic
1147565964 17:41536604-41536626 AAGGCAGCAGGGAAGCACCCAGG - Intergenic
1148716429 17:49719333-49719355 AAGGCTGCATAGGAGCAGCTTGG + Intronic
1148861148 17:50604908-50604930 CAGGCAGCGTGGGAGCCCCTGGG + Intronic
1150638454 17:66933156-66933178 CAGGCTGGCTGGGAGCAACCTGG - Intergenic
1151005487 17:70431419-70431441 CTGGCTTCTTGGGAGCACTCTGG - Intergenic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1151785813 17:76274380-76274402 CAGGCTGGAGGGGAGCTGCCGGG + Intronic
1152114275 17:78375347-78375369 GAGCCTGCCTGGGAGCACTCAGG - Intergenic
1152309932 17:79543923-79543945 CAGGCTGCTTGTGGGCACCCTGG - Intergenic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1152723294 17:81933235-81933257 CAGGCTGCGGGGGAGCAGCTTGG + Exonic
1153581171 18:6575168-6575190 CAGGCTGCCTGGGAACTTCCAGG - Intronic
1153868752 18:9297227-9297249 CAGGCTGCGAGGGAGCCCACAGG - Intergenic
1155273845 18:24167176-24167198 CAGGCAAGAAGGGAGCACCCGGG + Intronic
1155573876 18:27224186-27224208 CAGGCTGCATGGGACAGCCAAGG - Intergenic
1156500476 18:37554292-37554314 CAGGCTGGATGTGAGCACCTGGG + Intronic
1156651614 18:39233206-39233228 CAGGCCCCATGGCAGCATCCAGG + Intergenic
1157710410 18:49846194-49846216 CAGTCTGTCTGGGATCACCCTGG - Intronic
1158014339 18:52766244-52766266 CAGGCCCCATGGCAGCATCCAGG + Intronic
1161161186 19:2762641-2762663 CAGGCTGGAGGAGAGCACCGGGG + Exonic
1162730443 19:12715369-12715391 CAGGCTCCCTGGAAGCCCCCAGG + Intronic
1162870041 19:13579584-13579606 CAGGAGGCATGGGAGGACCCAGG + Intronic
1162908966 19:13839498-13839520 CAGGCTGCATCAGGACACCCCGG + Intergenic
1163033664 19:14560001-14560023 CGGGCTGCAAGGCAGCACCTAGG - Intronic
1163288149 19:16362111-16362133 CAGGCTGGACGGGGGTACCCTGG + Intronic
1163327769 19:16616168-16616190 TAGCATGCATGTGAGCACCCAGG + Intronic
1164376640 19:27693433-27693455 TAGAATGCATGGGATCACCCAGG + Intergenic
1164796118 19:31032191-31032213 CTCGCTGCATGGGAGCACAGTGG + Intergenic
1165057495 19:33187293-33187315 CAGGCTGGATGGGTGCACTGTGG + Intronic
1165095162 19:33406212-33406234 CATGATGTCTGGGAGCACCCAGG + Intronic
1166738877 19:45102349-45102371 GAGGCAGCACGGGAGCCCCCTGG + Intronic
1167151930 19:47715227-47715249 AAGGTTGCCTGGGTGCACCCAGG - Intronic
1168611841 19:57807057-57807079 CATGATGCAGGAGAGCACCCAGG + Intronic
1168616987 19:57846241-57846263 CATGATGCAGGAGAGCACCCAGG - Intronic
925929192 2:8693900-8693922 CAGGCTCCATGAGAGCACCGTGG + Intergenic
926108955 2:10170034-10170056 AAGGCAGCATGGGAGGCCCCCGG + Intronic
928100823 2:28436597-28436619 CAGGCTGCAGGGGAGAGCCCTGG - Intergenic
928707412 2:33965061-33965083 CAGCGTGGTTGGGAGCACCCAGG - Intergenic
929047419 2:37803547-37803569 CAGGATGCATGTGGCCACCCTGG - Intergenic
929651182 2:43681267-43681289 CAGCCAGCATGGCATCACCCTGG - Intronic
929789271 2:45011647-45011669 GGGGCTGCAGAGGAGCACCCTGG + Intergenic
931787044 2:65629498-65629520 CAGGGAGAATGGGAGCAGCCTGG + Intergenic
932310002 2:70732111-70732133 CAGGCAGCAGGGGAGAACCCAGG + Intronic
933223439 2:79717453-79717475 CAGGCTGCATGAAAGCAGTCTGG + Intronic
933298167 2:80514290-80514312 CAGGCCCCCTGGCAGCACCCAGG + Intronic
934574073 2:95389573-95389595 CAGGCTTCTTAGGAGCGCCCCGG - Intergenic
934747650 2:96770069-96770091 TAGGCTGCATGGGGCCAGCCAGG - Intronic
935264325 2:101381748-101381770 GAGGCTGGAGGTGAGCACCCCGG - Intronic
935328709 2:101961005-101961027 CAGGACCCTTGGGAGCACCCAGG - Intergenic
937271451 2:120655367-120655389 AAGGCTGCATGGTGCCACCCTGG - Intergenic
937340621 2:121088459-121088481 CAGGCTGGGTGGGAGCCCCGCGG + Intergenic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
938087729 2:128412320-128412342 CAGGCTGGATGGGATGCCCCTGG + Intergenic
945060727 2:205906550-205906572 CAGGCTGCATGAGAGATGCCAGG + Intergenic
945859572 2:215105281-215105303 AAGGCTAAATGGGAGTACCCTGG + Intronic
946061987 2:216950383-216950405 CAGGCTGGAGGGGGGCAGCCTGG + Intergenic
946811594 2:223531092-223531114 CAGGCCCCATGGTGGCACCCAGG - Intergenic
947354519 2:229278003-229278025 TATGCTGCAAAGGAGCACCCTGG - Intergenic
947973902 2:234347478-234347500 CAGGTCGAATGGGAGCTCCCAGG - Intergenic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
1171189096 20:23145686-23145708 CAGGGTCACTGGGAGCACCCTGG + Intergenic
1172765707 20:37349685-37349707 CAGACTCCATGAGATCACCCAGG - Intronic
1173132966 20:40411772-40411794 GAGGCTGCATGGGCTCACCCTGG - Intergenic
1175466475 20:59193548-59193570 CAGGCTGCGTGGGCCCACCTGGG - Exonic
1175502036 20:59457291-59457313 CAGGCTGCCTGGCAGCTCACGGG + Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176121647 20:63456795-63456817 GAGGCTGCGTGGGACCCCCCAGG - Intronic
1176188604 20:63795637-63795659 CACGATGGGTGGGAGCACCCGGG - Intronic
1176277334 20:64279802-64279824 CAGGGAGCATGGGAACTCCCAGG - Intronic
1176289063 21:5034677-5034699 CAGACTGCAGGGGAGCACTTGGG + Intronic
1179868172 21:44228927-44228949 CAGACTGCAGGGGAGCACTTGGG - Intronic
1179931690 21:44574968-44574990 CAGGCTGGGCGGGAGCACACGGG - Exonic
1180159028 21:45990798-45990820 CAGGCTGCAAGGGCTCGCCCGGG + Exonic
1180626106 22:17194489-17194511 CAGGCAGCGGGGCAGCACCCTGG - Intronic
1180941007 22:19659452-19659474 CAGGCCCCAGGGGAACACCCAGG + Intergenic
1181305193 22:21912521-21912543 CAGGCCCCATGGGACCACACAGG - Intergenic
1182622431 22:31625474-31625496 CAGGGGGCCTGGGAGCACCAGGG + Intronic
1182736701 22:32536051-32536073 CAGGCTGCATGGGCCATCCCTGG - Intronic
1182830640 22:33302192-33302214 CTGGCCACATGGGGGCACCCTGG + Intronic
1183094162 22:35542162-35542184 CAGGCTGGGAGGGAGCAGCCAGG + Intronic
1183265176 22:36820507-36820529 CAGGCTGCATGGGGGAAGCTGGG + Intergenic
1184660615 22:45963960-45963982 CAGCCTGGAGGGGAGCCCCCAGG + Intronic
1185044688 22:48523070-48523092 CAGGCTGGATGGGGGCGGCCAGG + Intronic
1185081965 22:48714444-48714466 CAGGCTGCATAAGAGACCCCTGG + Intronic
1185111394 22:48902127-48902149 CCTGCTGCCTGGGTGCACCCTGG - Intergenic
1185111517 22:48902641-48902663 CCTGCTGCCTGGGTGCACCCTGG + Intergenic
1185169694 22:49285615-49285637 CAGGCTCCACTGGAGCAGCCAGG - Intergenic
1185212325 22:49577318-49577340 CAGGCTCCGTGGGGGCACGCTGG - Intronic
1185212336 22:49577368-49577390 CAGGCTCCGTGGGGGCACGCTGG - Intronic
949772066 3:7589865-7589887 AAAGCTGAATGGGAGCACACAGG - Intronic
952340287 3:32439902-32439924 CAGGGTGCTTAGCAGCACCCTGG + Intronic
953404481 3:42653851-42653873 CATGCTGCATAGGGCCACCCAGG - Exonic
953563108 3:44010502-44010524 CAAGCAGCATGGGGTCACCCTGG - Intergenic
953665125 3:44920318-44920340 CAGGCTGCAGATGATCACCCAGG - Intronic
953698969 3:45181347-45181369 CAGGCTGAGTAGGAGCACCCTGG - Intergenic
954820696 3:53324351-53324373 CAGGCTCCGTGGCAGCTCCCTGG - Intronic
957108580 3:75924179-75924201 CAGGCAGCATGGGAGCATTGTGG + Intronic
960047343 3:113211254-113211276 AAGGCTTCAGGGGAGCCCCCTGG + Intronic
961088759 3:124092054-124092076 CAGGCTGAATGGGTTCACCCTGG + Intronic
961170322 3:124793247-124793269 CAGGCTGCATGGACACACGCAGG + Intronic
961768494 3:129230577-129230599 TAGGCTGAATGGGACCAGCCTGG + Intergenic
962282104 3:134059905-134059927 CAGCCTGCCTGGAAGCACCTGGG - Intergenic
962345305 3:134614422-134614444 CAAGCTGCCAAGGAGCACCCTGG + Intronic
962508762 3:136077135-136077157 CACGCTCCATGGGAGGCCCCAGG - Intronic
963397251 3:144750096-144750118 CAGGCGGCACAGGAGCCCCCGGG - Intergenic
964624755 3:158748377-158748399 GAGCCTGCATTGTAGCACCCTGG - Intronic
965776685 3:172239231-172239253 CAGCCTGCTTGGGAGAATCCTGG + Intronic
966249515 3:177847419-177847441 GAGGCTGGTTGGGATCACCCAGG + Intergenic
968047786 3:195633902-195633924 AAGGCCGCATGAGACCACCCCGG + Intergenic
968306828 3:197656022-197656044 AAGGCCGCATGAGACCACCCCGG - Intergenic
968452545 4:682106-682128 CAGGCTGGGTGGGGGCTCCCGGG + Exonic
969501354 4:7555385-7555407 CAGGCTACATGGGCTCACACAGG - Intronic
969704154 4:8782954-8782976 AAGCCAGCATGGGAGCATCCGGG + Intergenic
969799456 4:9551399-9551421 CTGGCTGCATGAGATCACCTGGG - Intergenic
970382017 4:15518005-15518027 CAGGTTTCATGGGAGGAACCGGG - Intronic
973586053 4:52392591-52392613 CAGGCTGGATGAGAGCTCCAAGG + Intergenic
974838198 4:67275322-67275344 CAGGCTGCATGGGAGCCCATGGG + Intergenic
976318624 4:83686294-83686316 CAGGCTGGAAGTGAGCAGCCAGG + Intergenic
980563052 4:134502084-134502106 CGGGCTGCATTGGAGCCCACGGG - Intergenic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
983933680 4:173480130-173480152 CATACTGCATGGCAGCAGCCAGG - Intergenic
983936975 4:173508997-173509019 CAGACTGCATCCGAGCAGCCGGG + Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
985292450 4:188400559-188400581 CAGGCTGAATGGTGGCCCCCAGG - Intergenic
987141112 5:14947374-14947396 CAGGCTACATTGGAACAGCCAGG + Intergenic
987225080 5:15831682-15831704 CATGCTCCATGAGAGCAGCCTGG - Intronic
989477208 5:41888247-41888269 CAGGCTGAATGGGAGTATCTGGG - Intergenic
989559721 5:42836657-42836679 CGGGCCGCATGGGAGCCCACAGG - Intronic
990816743 5:59794441-59794463 CAGGCTGCCGGGAAGCACCAGGG - Intronic
992050397 5:72935526-72935548 CTGGCTGCACGGGAGCCCACTGG - Intergenic
995311889 5:110722554-110722576 CAGCCTCCATGAGAGCACACAGG - Intronic
995847526 5:116509953-116509975 CATGCTGCTTAGGAGCAACCAGG - Intronic
997408262 5:133669604-133669626 CAGGCTCCTTGGGAGCATCTGGG + Intergenic
997690136 5:135822789-135822811 CAGGCTAAATGGCAGCACCCAGG - Intergenic
998946688 5:147347544-147347566 CAGGATGCATGCTAGCATCCCGG - Intronic
1001264766 5:170265897-170265919 CAGGCTGCAGTTGAGGACCCTGG - Intronic
1001574332 5:172752032-172752054 CAGGCTGCATGGGACAGCCATGG + Intergenic
1002164267 5:177334899-177334921 CAGGCTGCAGGGGAACAACTCGG + Intronic
1002186825 5:177458519-177458541 CAGGCTCCACGGGAGCAGCCAGG + Exonic
1002783388 6:383741-383763 CTGGCTGCTTGGGAGGACTCGGG - Intergenic
1003065460 6:2901201-2901223 CTGGCTGACTGGGAGCAGCCTGG - Intronic
1003394586 6:5742184-5742206 CCGGCTGCATGTGAGCATCTTGG - Intronic
1003409704 6:5851486-5851508 CGGGCTTCAGGGGAGCACCTGGG + Intergenic
1004101007 6:12611394-12611416 CACGCTGAATGGGAGAAGCCGGG + Intergenic
1004864551 6:19838958-19838980 CAGACTGCACGGGAGGACACCGG - Intronic
1005114233 6:22318491-22318513 GAGGCTGCAGGGGAGCCCACCGG + Intergenic
1006423506 6:33949852-33949874 GAGGCAGCACGGGAGCAGCCAGG + Intergenic
1006843521 6:37047410-37047432 CAGGCTGCAGGTTTGCACCCTGG + Intergenic
1007125767 6:39424304-39424326 CAGGGTGCTGGGGAGCACCTGGG - Intronic
1007817126 6:44532437-44532459 GAGGCTGGATGGGAGCTGCCTGG + Intergenic
1009627897 6:66160545-66160567 CAGGCTCCATGGTAGCATCTAGG + Intergenic
1011390584 6:86848159-86848181 CAGGCCGCAGGGAAGCACTCAGG + Intergenic
1011408846 6:87044516-87044538 CAGGCCCCATGGCAGCATCCAGG - Intergenic
1012843215 6:104356301-104356323 CAGGCCTCATGGCAGCATCCAGG - Intergenic
1013295664 6:108756268-108756290 CAGGCGGCCTAGGAGCACTCAGG - Intergenic
1015754861 6:136596970-136596992 CAGGCTGCAAGAGAGGAGCCTGG + Intronic
1016485175 6:144529289-144529311 CATGCTGCATGGGAGAGCCGAGG - Intronic
1016567807 6:145476251-145476273 CACCCAACATGGGAGCACCCAGG + Intergenic
1017543683 6:155428490-155428512 CAGGCTGCATAGAAGTAACCAGG + Intronic
1019598237 7:1868388-1868410 CGGCCTGCGTGGGAGCAGCCCGG - Intronic
1019749995 7:2723311-2723333 CAGGCTGTCTGGATGCACCCGGG - Intronic
1020330533 7:7012803-7012825 CAGGCAGCTTAGGAACACCCAGG + Intergenic
1020837350 7:13169565-13169587 CAGGCATCATGGGAGGAACCTGG - Intergenic
1021573944 7:22090715-22090737 CAGGCCGCACGGGAGCCCACAGG - Intergenic
1021759859 7:23893163-23893185 CAGGCTGCATGTGAGACCCTCGG + Intergenic
1021796472 7:24259528-24259550 GAGACTGCATGGGAACACCTTGG - Intergenic
1023204019 7:37728783-37728805 CAGGCAGGATGGGAGAATCCTGG + Intronic
1023861950 7:44221772-44221794 CAGGCTGCCAGTGAGCGCCCCGG - Intronic
1024223171 7:47303800-47303822 CAGCCCGCATGAGGGCACCCAGG + Intronic
1026490480 7:70859006-70859028 CAGTGTTCAGGGGAGCACCCTGG + Intergenic
1027292433 7:76728890-76728912 CAGACTGCAAGGCAGCAGCCAGG + Intergenic
1028046801 7:86130585-86130607 CAGGCCCCATGGCAGCATCCAGG + Intergenic
1028913028 7:96228996-96229018 CAGGCTGCATGGGAGCCCACGGG - Intronic
1029092406 7:98058405-98058427 CAGGCTCCCTGCCAGCACCCCGG - Intergenic
1029709552 7:102292176-102292198 GAGGCTGCATGAGACCAGCCTGG + Intronic
1030772184 7:113488206-113488228 CAGGCTGTGTGGGAGCCCACGGG + Intergenic
1031629789 7:124032802-124032824 CGGGATGCACGGGATCACCCTGG - Exonic
1031992372 7:128206716-128206738 CAGGCTGCAGTGGAGAACCTGGG - Intergenic
1032506042 7:132435444-132435466 CAGGCTGCTTGGGAGCCCCGTGG - Intronic
1033595887 7:142857348-142857370 CAGGCTTCATGGAGGCATCCAGG - Intronic
1035205076 7:157289808-157289830 CAGGGGGCATGGGGGCACCCAGG + Intergenic
1035665015 8:1374312-1374334 CGGGCTGCATGGGACCACCGTGG - Intergenic
1036207549 8:6816038-6816060 CAGGCTGCTGAGGAGTACCCAGG + Intronic
1036245317 8:7111141-7111163 CTGGCTGCATGAGATCACCTGGG - Intergenic
1036462155 8:8962997-8963019 GAGGATGCATGGGAGCTCTCTGG + Intergenic
1036910356 8:12754006-12754028 CAGGTAGCAAGGGACCACCCTGG + Intronic
1037890764 8:22622715-22622737 GAGGGTGCAGGGCAGCACCCAGG + Intronic
1040356614 8:46624639-46624661 CAGGCAGCTTAGGAACACCCAGG + Intergenic
1040417272 8:47206480-47206502 CTGGCTGCCTGAGAACACCCAGG + Intergenic
1040444579 8:47480659-47480681 CAGGCCACATGGGAGCACACAGG - Intronic
1041150284 8:54925635-54925657 CAGGCTCCATGGGACCACAAAGG + Intergenic
1043874768 8:85473206-85473228 CAGGCTGTATGGCAGCAATCGGG + Intronic
1044459610 8:92429300-92429322 CAGGCTGCGTGGGAGCCCACGGG + Intergenic
1045203741 8:100014908-100014930 CAGGGTCCATGGGAACACACAGG - Intronic
1045657300 8:104400079-104400101 CAAGCTGCCTGGGGTCACCCTGG + Intronic
1045718094 8:105072275-105072297 CAGGATGCATGGAAGCAACAAGG + Intronic
1046497810 8:115036980-115037002 TGGGCTGCATGGGAGCCACCTGG - Intergenic
1047410086 8:124617333-124617355 CGGTCTGAATGGGAGCCCCCTGG - Intronic
1047595123 8:126370551-126370573 CAGGCTGCAATGCAGAACCCTGG + Intergenic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1049150861 8:141034646-141034668 CAGGCTGGATGGGCACACCCGGG + Intergenic
1049799126 8:144509660-144509682 CATCCTGCATGGCGGCACCCAGG - Exonic
1051747856 9:20312065-20312087 AGGGCTGCAGTGGAGCACCCAGG + Intergenic
1053165821 9:35842815-35842837 CAGGATGGGTGGGAGCAACCTGG - Intronic
1056779967 9:89541930-89541952 CAGCCTGCATGGGACGTCCCCGG - Intergenic
1057578875 9:96267830-96267852 CAGGATGAATGAGAACACCCTGG + Intronic
1060318751 9:122535777-122535799 CAGGCTTCATGTGAGCAACAAGG + Intergenic
1060553529 9:124496842-124496864 GAGGATGCAAGGGAGGACCCGGG - Intronic
1061188428 9:129068497-129068519 CAGGCAGCAACGGGGCACCCTGG - Intronic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062289652 9:135788838-135788860 CAGGACCCCTGGGAGCACCCTGG - Intronic
1062291450 9:135797064-135797086 CAGGCTGCAGGGGAGCCACAGGG + Intergenic
1062613921 9:137387594-137387616 CAGGGTGCCTGGGAGAGCCCTGG + Intronic
1062651681 9:137581016-137581038 CAGGCTGCCTGAGGGCACTCGGG + Intergenic
1190339741 X:49286850-49286872 CAGGCCTCATGTGAGCTCCCAGG + Exonic
1192546478 X:72018680-72018702 GAGGCTGCTTGGAAGCAGCCGGG + Intergenic
1194803570 X:98300748-98300770 CAAACTGCAAGGGAGCAGCCAGG + Intergenic
1195786239 X:108526978-108527000 CAGGCTGGATGTGAACTCCCAGG + Intronic
1198361891 X:135903472-135903494 CAGGCAGCATGCCAGGACCCAGG - Intronic
1198735289 X:139778065-139778087 CAGGCTGGCTGTGAGCTCCCAGG + Intronic
1200178088 X:154132317-154132339 CTGGCTGCTTGGGACCATCCAGG + Intergenic
1200399870 X:156013202-156013224 CAGGAAGCATGAGAGCACCCAGG - Intergenic
1200684176 Y:6245229-6245251 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1200686802 Y:6265547-6265569 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1200989680 Y:9336463-9336485 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1200992349 Y:9356796-9356818 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1200995000 Y:9377074-9377096 CAGGGTCTGTGGGAGCACCCAGG - Intronic
1200997665 Y:9397420-9397442 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1201000177 Y:9465956-9465978 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1201002836 Y:9486266-9486288 CAGGGTCTGTGGGAGCACCCAGG - Intronic
1201005492 Y:9506549-9506571 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1201008155 Y:9526879-9526901 CAGGGTCTGTGGGAGCACCCAGG - Intergenic
1201048459 Y:9909157-9909179 CAGGGTCTGTGGGAGCACCCAGG + Intergenic
1201280724 Y:12339873-12339895 TCGGCTGGCTGGGAGCACCCCGG - Intergenic