ID: 983839715

View in Genome Browser
Species Human (GRCh38)
Location 4:172442072-172442094
Sequence TTTTAAACACATATGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983839714_983839715 24 Left 983839714 4:172442025-172442047 CCATATATAATTAGTTATTTATA 0: 1
1: 1
2: 7
3: 81
4: 1374
Right 983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983839715 Original CRISPR TTTTAAACACATATGAAACA AGG Intronic
No off target data available for this crispr