ID: 983841722

View in Genome Browser
Species Human (GRCh38)
Location 4:172465036-172465058
Sequence TTTCCTCGGCTGAGGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983841722 Original CRISPR TTTCCTCGGCTGAGGTTCTT TGG Intronic
900705806 1:4079386-4079408 TTCCCTCGGCTGATGTTTTGGGG - Intergenic
905741307 1:40373848-40373870 TTGCCTGGGCTGAGGGTCTCTGG + Exonic
906536076 1:46551650-46551672 TTTCATAGGCTGAGGTTCAGTGG - Intergenic
909434230 1:75621761-75621783 TCACCTCAGCTGAGGTTTTTAGG + Intergenic
912941954 1:114053135-114053157 TTCCCAAGGCTGAGATTCTTAGG + Intergenic
915029115 1:152861004-152861026 GGTCCTTGGCTGTGGTTCTTTGG - Intergenic
915069274 1:153252655-153252677 TTTCCTCTGCTGAGGTCTTGGGG - Intergenic
918305619 1:183243414-183243436 ATTTCTCAACTGAGGTTCTTGGG + Exonic
920682804 1:208085426-208085448 TCTCCTGGGCAGTGGTTCTTAGG + Intronic
922360558 1:224817801-224817823 TTTCATCAGCTGAGCCTCTTGGG + Intergenic
1064042139 10:11976202-11976224 ATTTCTCAGCTGAGGTTCTTAGG + Intronic
1067661280 10:48237863-48237885 TTCCCTGGGCTGAGGTTTATAGG - Intronic
1069184849 10:65409874-65409896 TTTCCTAGGCAGAGGTCCTGCGG + Intergenic
1071451369 10:85794174-85794196 TTTCCACTGCTGAGGTTATTTGG + Intronic
1074305356 10:112271976-112271998 CTTCTTCTGGTGAGGTTCTTAGG - Intergenic
1078241493 11:9534749-9534771 TTTCCTAGGCTGGGGGGCTTTGG - Intergenic
1080980973 11:37405239-37405261 CTTTCTCAGCTTAGGTTCTTTGG - Intergenic
1083253106 11:61481193-61481215 TTTCCTCTGCAGAGGCTCTGAGG - Exonic
1083406208 11:62459011-62459033 TTTCCTGGGATGAGCCTCTTGGG + Intronic
1084043190 11:66554531-66554553 CTTCCTTGGCTGAGGTTTCTGGG - Exonic
1084599519 11:70136548-70136570 GTTCCTCTGCTGAGGTTCGAAGG + Intronic
1085606646 11:77906081-77906103 TTTTCTGGGCTGTGGTTTTTGGG + Intronic
1087603689 11:100347814-100347836 ATTCCTCTGCTGAGCATCTTCGG - Intronic
1088212110 11:107468152-107468174 TTTCCTTGGTGTAGGTTCTTTGG + Intergenic
1088373156 11:109113204-109113226 TTTCCTCGCCTGCTGTGCTTTGG - Intergenic
1092277986 12:7076676-7076698 TTCCCTCTGCTGATGTTATTGGG + Intergenic
1095136956 12:38616144-38616166 TTTCTTCGGATGCCGTTCTTGGG + Intergenic
1097145970 12:56939525-56939547 TGTCCTAGGCTGAGTTTATTGGG + Intergenic
1097151534 12:56983063-56983085 TGTCCTGGGCTGAGTTTATTGGG + Intergenic
1097691711 12:62740143-62740165 TTTCTGAGGCTTAGGTTCTTAGG - Intronic
1099211999 12:79802318-79802340 TTTTCCAGGCTGATGTTCTTAGG - Intronic
1101260650 12:103026365-103026387 TTCTCTCTGCTGAGGTTCTTGGG - Intergenic
1101260900 12:103028535-103028557 TTCTCTCTGCTGAGGTTCTTGGG + Intergenic
1104841788 12:131829137-131829159 TTTGCTCGGTTGAGGGTGTTGGG + Intronic
1106350481 13:28924741-28924763 GTTCCTTGACTGAGGGTCTTGGG - Intronic
1108749051 13:53427750-53427772 TTTGCTCTGCAGAAGTTCTTTGG + Intergenic
1109119091 13:58430890-58430912 TTTCCTTGGCTTTGATTCTTAGG + Intergenic
1109261283 13:60147908-60147930 TTTCCTTGGCTCTCGTTCTTGGG - Intronic
1112503360 13:99958516-99958538 GATCCTTGGCTGAGGTCCTTTGG + Intergenic
1116941677 14:50797415-50797437 CCTCCTGTGCTGAGGTTCTTTGG - Intronic
1122520268 14:102338882-102338904 ATGTCTCGGCTGAGGTGCTTGGG - Exonic
1127221146 15:56882732-56882754 TTTCCTGGACTGAGGTGCTAGGG + Intronic
1146443674 17:32918481-32918503 CGCCCTCGGCAGAGGTTCTTAGG + Intergenic
1151232265 17:72693624-72693646 TTTCCTTGGCTGTGGGTCTCAGG - Intronic
1152519696 17:80848039-80848061 TTTCTCTGGCTGAGATTCTTGGG - Intronic
1153195464 18:2591110-2591132 TTTCAGCTGCTGAGGTGCTTAGG - Intronic
1156797943 18:41071009-41071031 TTTTCTCCCCTGAAGTTCTTAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161702636 19:5803964-5803986 CTCCCGCCGCTGAGGTTCTTGGG - Intergenic
1162141153 19:8586292-8586314 ATACCTGGGCTGAGGTTCTCTGG - Intronic
1163138346 19:15330355-15330377 TTTCCCTGGCTGAAGTTTTTGGG + Intronic
1163628227 19:18403094-18403116 TTTACTCGGCTGAGATGTTTGGG + Intergenic
1164513813 19:28917711-28917733 CTTCCCCAGCTGAGGTTCTGTGG - Intergenic
1165310428 19:35026354-35026376 TTTGCCCGGCTGAGGTTGTGGGG + Exonic
1165810878 19:38611014-38611036 AATCCTAGGCTGAGGATCTTGGG + Intronic
925798936 2:7577455-7577477 TTTCTTTGGCTGAGCTGCTTTGG + Intergenic
933617154 2:84494178-84494200 AGTCCTGGGCTGAGGTTTTTTGG - Intergenic
933686271 2:85143940-85143962 TTTCCTCGGATGAAGTTCCTGGG - Intronic
935719733 2:105969416-105969438 TTTCCAGGGCTGAGGTGGTTTGG + Intergenic
937131642 2:119518407-119518429 TTCCCTCACCTGAGGCTCTTAGG - Intronic
938743019 2:134250821-134250843 TTACCTAGGCTGAGATTTTTTGG + Intronic
944334696 2:198518318-198518340 TTGCTTCGGCTGAGTTTCTGTGG - Intronic
1169193862 20:3673282-3673304 CTTCCTCCGCTGCGTTTCTTTGG - Intronic
1182657980 22:31904914-31904936 TTTCCTGGACTGAGTTCCTTGGG - Intronic
950740889 3:15051120-15051142 TCTCCTTGGCTGAGTTTCTAGGG + Exonic
952190686 3:31020043-31020065 TTTCCTCAGATGATGTTCCTGGG - Intergenic
952281195 3:31925076-31925098 TCTCCTTGGCTGAGTTTTTTTGG - Intronic
953200918 3:40777886-40777908 TTTCCTCCCTTGAGGTTCTGTGG + Intergenic
953679081 3:45026245-45026267 TTTCCTGGACAGAGGTCCTTTGG + Exonic
957264281 3:77941711-77941733 TTTCCTCGGCTTAGTTCATTTGG - Intergenic
960160222 3:114342527-114342549 TTTCCTTGGCTGAGTGACTTGGG + Intronic
960635365 3:119779864-119779886 TTTTCTCTGATGAGTTTCTTAGG + Intergenic
961551163 3:127671391-127671413 TTTCCTCAGCTGAGGTCCTGGGG - Intronic
961795720 3:129407521-129407543 CTTCCTAGGCAGAGGTTCCTAGG + Intronic
965189607 3:165511497-165511519 TTTCCTCTCCTCAGCTTCTTTGG + Intergenic
969627716 4:8316244-8316266 CTTCCTCGGCTCAGCTTCATGGG + Intergenic
979998938 4:127465981-127466003 TTTCTTTGGCTTAGCTTCTTTGG + Intergenic
980481987 4:133399105-133399127 TTTTCTCAGCTGTGGTTCCTTGG + Intergenic
983125160 4:163942476-163942498 TTTCATCAGTTCAGGTTCTTAGG - Intronic
983841722 4:172465036-172465058 TTTCCTCGGCTGAGGTTCTTTGG + Intronic
986353949 5:6905947-6905969 TTTCCTTGGCTGTGATTCTTGGG - Intergenic
987737403 5:21865139-21865161 TTTCTTCTGCTGAGTATCTTAGG - Intronic
989640735 5:43580722-43580744 TTTCCTAGGCAGAGGTCCCTGGG - Intergenic
998816483 5:146019371-146019393 TTTCCTCAGTTTAGGTTTTTGGG + Intronic
1002118936 5:176986488-176986510 TTGCCTAGGCTGAAGTTCATCGG - Intronic
1003337866 6:5192174-5192196 TTTCCTCTGCTGAGCATCCTGGG + Intronic
1003637097 6:7842324-7842346 GTGCCTCAGCTGAGGTGCTTGGG + Intronic
1003900785 6:10653575-10653597 TTTCCTATGCTGAGTTCCTTAGG - Intergenic
1004124009 6:12854573-12854595 TTTACTCTGTTGAGTTTCTTTGG - Intronic
1004368128 6:15029161-15029183 TTTTCTGGGCTCAGCTTCTTTGG - Intergenic
1015840532 6:137471960-137471982 TTTCCTCAGCTCTGGTTCTGTGG - Intergenic
1018460329 6:163992766-163992788 TTTCCTGGGCTTAGTTTCCTGGG - Intergenic
1019712276 7:2523212-2523234 ATTCCTGGGCTGAGATTCTGGGG + Intronic
1021811955 7:24411084-24411106 TTTCCTTAGCTGAAGTGCTTGGG - Intergenic
1021873880 7:25030591-25030613 TTTCTTTGGCTGAAGCTCTTTGG + Intergenic
1023981311 7:45072212-45072234 TTTGCTGGTCTGAGGGTCTTGGG + Intronic
1024261072 7:47574080-47574102 TTTCCTCGGCTGCTTTTCTGAGG - Intronic
1024573374 7:50743960-50743982 TTTCCTCTGGTGAGGCTTTTAGG - Intronic
1030267176 7:107632403-107632425 TTTCCTGTGCTGAGATTGTTCGG + Intergenic
1031329335 7:120444508-120444530 TGTACTCTGCTGGGGTTCTTAGG - Intronic
1036488418 8:9201003-9201025 TTTCATCTGCAGTGGTTCTTTGG + Intergenic
1036890823 8:12595923-12595945 TCTCATTGGCTGAGGTTGTTGGG - Intergenic
1037745648 8:21642082-21642104 TTTCCTTGACTGAGCTTTTTTGG - Intergenic
1037813868 8:22101930-22101952 TTGCCTCTGCTTCGGTTCTTTGG + Intronic
1039713369 8:40082048-40082070 TTTCCTAGAATGAGGTTCTGTGG + Intergenic
1041042365 8:53860532-53860554 ATTCCTGGTCTGAGGTTCCTGGG - Intronic
1042158607 8:65869511-65869533 TTTCCAGGGCTGAGGTGGTTTGG - Intergenic
1043259586 8:78180008-78180030 TTCACTTGGCTGAGGATCTTTGG - Intergenic
1050542031 9:6678888-6678910 TTTCATGGGTTGAAGTTCTTTGG - Intergenic
1053094582 9:35313583-35313605 TTGCCTCGGCTGAAGTGCTGTGG - Intronic
1056371788 9:85962897-85962919 CTTCCTCAGGTGAGGTACTTAGG - Intronic
1058553116 9:106136777-106136799 TTTCCTCAGTTGAGCTTCCTGGG - Intergenic
1059733406 9:117078418-117078440 TGTCCATGGCTGAGGTGCTTTGG - Intronic
1187344108 X:18447319-18447341 TTTCCTAGGATGAGAATCTTAGG - Intronic
1187576066 X:20556851-20556873 TTTCCTCTGCTGAGCTTCTATGG + Intergenic
1188322398 X:28755953-28755975 TTCCCTAGGCAGTGGTTCTTAGG - Intronic
1189990402 X:46588503-46588525 TTGGCTCGGCTGAGGCTCCTGGG - Intronic
1190699736 X:52978775-52978797 TCTCCTCAGCTGAAGGTCTTGGG + Intronic
1194669811 X:96717743-96717765 TTTCTTGTGCTGGGGTTCTTTGG + Intronic
1199488446 X:148373101-148373123 TTTCCTGAGCTGAAGTGCTTAGG + Intergenic
1199855153 X:151753673-151753695 TTTCTTCGCCAGAGGGTCTTGGG - Intergenic
1200930920 Y:8696320-8696342 ATACCTCCGCTGAGGTGCTTCGG - Intergenic