ID: 983843139

View in Genome Browser
Species Human (GRCh38)
Location 4:172481944-172481966
Sequence GGCAGCCCGAGCCTCCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 3, 2: 12, 3: 49, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983843139_983843150 10 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843150 4:172481977-172481999 CGCAGGGGGCTCAGACATGGTGG No data
983843139_983843143 -5 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843143 4:172481962-172481984 CTGCCAGGAGCCCACCGCAGGGG 0: 1
1: 1
2: 5
3: 23
4: 239
983843139_983843151 11 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843151 4:172481978-172482000 GCAGGGGGCTCAGACATGGTGGG No data
983843139_983843141 -7 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843141 4:172481960-172481982 GGCTGCCAGGAGCCCACCGCAGG 0: 1
1: 0
2: 1
3: 35
4: 333
983843139_983843144 -4 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843144 4:172481963-172481985 TGCCAGGAGCCCACCGCAGGGGG 0: 1
1: 0
2: 4
3: 25
4: 230
983843139_983843148 7 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843148 4:172481974-172481996 CACCGCAGGGGGCTCAGACATGG No data
983843139_983843142 -6 Left 983843139 4:172481944-172481966 CCGTCGGGGAGGCTCGGGCTGCC 0: 1
1: 3
2: 12
3: 49
4: 222
Right 983843142 4:172481961-172481983 GCTGCCAGGAGCCCACCGCAGGG 0: 1
1: 0
2: 4
3: 41
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983843139 Original CRISPR GGCAGCCCGAGCCTCCCCGA CGG (reversed) Intronic
900134141 1:1107064-1107086 CACAGCCCGAGCCTCCCCAACGG + Intronic
900136795 1:1121193-1121215 GCCAGGCCGTGCCTCCCTGATGG + Intergenic
900164082 1:1237772-1237794 AGCGGCCCCAGCCTCCCCCAGGG + Intergenic
900483959 1:2912733-2912755 AGCAGCCAGAGCCTCCCCGCAGG + Intergenic
900603390 1:3512898-3512920 GGCAGCCCGACCCCTCCCCAAGG + Intronic
900640409 1:3685639-3685661 GGCTGCCCGAGCCCACCCGTTGG - Intronic
901040458 1:6360173-6360195 GGCAGCACCAGCCTCCCTGTGGG - Intronic
901841106 1:11954769-11954791 TGTAGCCCCAGCCTCCCCCAGGG + Intronic
902036601 1:13462671-13462693 GGCTGTCCCAGCCTCCACGATGG - Intergenic
902237665 1:15068207-15068229 GCCAGCCTGTGCCTCCCAGAGGG - Intronic
904774015 1:32895793-32895815 GGCAGCTCTGGCCTCCCTGAGGG + Intronic
905170816 1:36108631-36108653 GGCAGCCCGGGCCTCCTCCCAGG + Intronic
905911973 1:41661668-41661690 GGCAGCCCTAGCTTCCCCCAAGG - Intronic
906055943 1:42917057-42917079 CGCAGCCCCAGCCTCCCCGACGG - Intergenic
908301158 1:62761832-62761854 TGCAGCCTGAGCCTCCCCAACGG + Intergenic
908497212 1:64706574-64706596 GTCTGCCCCAGCCTCCCCGAAGG - Intergenic
909317987 1:74247959-74247981 GGCAACCTGAGCCACCCCGACGG - Intronic
910193784 1:84620771-84620793 GGCAGCCCGGGCCTGCCCCGCGG + Intergenic
910625523 1:89302880-89302902 GGAGGCCCAAGCCTCCCCTAGGG - Intergenic
910876779 1:91885785-91885807 GGCAGCCCGCGCCGCGCCGACGG + Intronic
911807917 1:102234872-102234894 CACAGCCCGAGCCTCCCCGATGG - Intergenic
911853986 1:102854077-102854099 CGCCCACCGAGCCTCCCCGATGG + Intergenic
918542650 1:185648991-185649013 GGCGACCTGAGCCTCCCCGACGG - Intergenic
919070660 1:192751392-192751414 TGCAGCCCGAGCCTCCCCGACGG + Intergenic
921155030 1:212432840-212432862 CGCGCCCAGAGCCTCCCCGAGGG - Intergenic
922504705 1:226119752-226119774 AGCAGCCCTGGCCTCCCCTAGGG - Intergenic
924313734 1:242774428-242774450 CGCGGCCCAAGCCTCCCCAACGG - Intergenic
1063672357 10:8109532-8109554 GCCAGCCAGAGCCTTCCAGAAGG + Intergenic
1063848751 10:10161194-10161216 CACGGCCCGAGCCTCCCTGACGG + Intergenic
1066590524 10:36989360-36989382 TGCAGCCTGAGCTTCCCCAATGG - Intergenic
1066615023 10:37285227-37285249 CACAGCCCAAGCCTCCCCGATGG - Intronic
1069280793 10:66651521-66651543 CAAGGCCCGAGCCTCCCCGATGG - Intronic
1071610964 10:87031045-87031067 CACAGCCTGAGCCTCCCTGACGG - Intergenic
1072341802 10:94459553-94459575 CGCGGCCCGAGCCTCCCCGACGG - Intronic
1074160164 10:110830227-110830249 GGCTGCTCCAGCCTCCACGAAGG - Intronic
1074314634 10:112350038-112350060 CGCAGCCCCAGCGTCCCCAAAGG + Intergenic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1076280344 10:129241655-129241677 GGCAGCCCGAGCATCTCTGAAGG - Intergenic
1077920914 11:6641167-6641189 GGCAGCCCGAGCCTGTGGGAAGG + Exonic
1080628359 11:34051626-34051648 GGCAGCCCGAGCGGCCGCGAAGG + Intergenic
1083950582 11:65953507-65953529 GGCAGCAGGAGCCTCACGGAGGG - Intronic
1084642640 11:70434878-70434900 GGCAGCAGGAGCCTCCGCGGTGG + Intronic
1086552552 11:88069349-88069371 CGTGGCCCAAGCCTCCCCGACGG + Intergenic
1089316132 11:117592572-117592594 GGCAGCGCTAGGCTCACCGATGG + Intronic
1090586149 11:128215335-128215357 TGCAGCCTGAGCCTCCCTGACGG - Intergenic
1091018637 11:132078366-132078388 AGCAGCCTGAGCCACACCGAGGG - Intronic
1092196107 12:6550667-6550689 TGCAGCCCCAGGCTTCCCGAGGG - Intronic
1092462442 12:8698224-8698246 GGCGGCCCGCGCTTCCTCGAAGG + Exonic
1097490995 12:60270052-60270074 TTCGGCCAGAGCCTCCCCGACGG + Intergenic
1099191004 12:79561849-79561871 CATGGCCCGAGCCTCCCCGATGG + Intergenic
1101247970 12:102902904-102902926 GGCAGCCCCAGCCACCTGGAAGG - Intronic
1101715601 12:107309322-107309344 GGCAGCCTCAGCCACCCCCAAGG - Intergenic
1102600510 12:114026171-114026193 TGCAGCCCTCCCCTCCCCGAAGG - Intergenic
1103776846 12:123372224-123372246 GGCACCCCCCGCCTCCCAGACGG - Intergenic
1103919303 12:124391095-124391117 GGCAGCACAGGCCTCCCTGAGGG - Intronic
1104373929 12:128247550-128247572 CGTGGCCCGAGCCTCCCTGATGG + Intergenic
1105477349 13:20739989-20740011 CGCAGCCTGAGCCTCCCTGACGG - Intronic
1108686775 13:52826557-52826579 CGCAGCCTGAGCCTCCCTGATGG + Intergenic
1108845717 13:54676871-54676893 CACAGCCCAAGCCTCCCTGACGG + Intergenic
1108991099 13:56659169-56659191 CGTGACCCGAGCCTCCCCGACGG - Intergenic
1109687699 13:65843420-65843442 GGCTGCCCAAGCCTCCGAGAGGG - Intergenic
1109884423 13:68524244-68524266 CGTATCCCGAGCCTCCCCAATGG + Intergenic
1110440243 13:75518853-75518875 GACAGCCCCAGCCTCCCCAACGG + Intergenic
1111220958 13:85205214-85205236 CGCGGCCGGAGCCTCCCCTACGG + Intergenic
1113330139 13:109319111-109319133 CGTGGCCCAAGCCTCCCCGAGGG - Intergenic
1113707769 13:112445491-112445513 GGCAGCCTCAGGCTCCTCGAAGG - Intergenic
1115174546 14:30547567-30547589 TGGGGCCCGAGCCTCCCAGAGGG - Intergenic
1115268586 14:31527141-31527163 TGCGGCCCAAGCCTCCCCAATGG - Intronic
1115284301 14:31700851-31700873 CACGGCCTGAGCCTCCCCGACGG + Intronic
1116152078 14:41154305-41154327 TGGGGCCCGAGCCTCCCTGACGG - Intergenic
1116437646 14:44912465-44912487 CGCGGCTGGAGCCTCCCCGACGG + Intergenic
1117297435 14:54393038-54393060 GGCGGCCCGAGCCTCCCCGATGG - Intergenic
1117837219 14:59819658-59819680 GGAGCCCCCAGCCTCCCCGACGG - Intronic
1119051787 14:71377156-71377178 GGCAGCCCCCACCTCCCAGATGG + Intronic
1119539359 14:75428370-75428392 GGCTGCGGGAGCCTCCCCGCGGG - Intronic
1120214626 14:81668773-81668795 CGCAGCCTGAGCCTCCCCAACGG - Intergenic
1121145438 14:91578275-91578297 CACAGCCTGAGCCTCCCTGAGGG + Intergenic
1121767834 14:96502692-96502714 GCGAGCCCGACCCTCCCCGCTGG + Intronic
1122228479 14:100293109-100293131 GGCAGCCCCAGCCCACCCCAGGG + Intronic
1122824119 14:104361400-104361422 GGCAGCCCGAGCTTCCACCGAGG + Intergenic
1123458006 15:20443555-20443577 GGCAGCCCCAGCCTCTTGGATGG + Intergenic
1123660062 15:22556854-22556876 GGCAGCCCCAGCCTCTTGGATGG - Intergenic
1123707089 15:22958590-22958612 GGCAGCCTGACCCTGGCCGAAGG - Intronic
1124264308 15:28219778-28219800 GGCAGCCCCAGCCTCTTGGATGG + Intronic
1124313923 15:28651349-28651371 GGCAGCCCCAGCCTCTTGGATGG - Intergenic
1127313914 15:57776938-57776960 GGCAGCCTGAGCCCCGCTGAGGG - Intronic
1128262076 15:66239618-66239640 GGCTGCCCCAGCCTCCCCCAGGG + Intronic
1129112237 15:73344190-73344212 GGCTGCCCCATCCTCCCTGAGGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130656355 15:85794547-85794569 GGCACCCCGCGGCTCCGCGAGGG - Intronic
1132378438 15:101348241-101348263 GGCTCCCCCAGCCTCCCCCACGG - Intronic
1132687326 16:1167852-1167874 GGCAGCCCGGGCCCCGCGGACGG - Intronic
1135821936 16:25692570-25692592 GGGAGCCCGAGCCGCCCAGGAGG - Exonic
1136453916 16:30370001-30370023 GGCGGGCCGCGCCTCCCCGGGGG + Exonic
1136522486 16:30805896-30805918 GGCGGCCCGAGGCTGGCCGAGGG + Intergenic
1136702489 16:32156957-32156979 GGCAGCCCCAGCCTCTTGGATGG + Intergenic
1136765178 16:32770531-32770553 GGCAGCCCCAGCCTCTTGGATGG - Intergenic
1136802921 16:33099853-33099875 GGCAGCCCCAGCCTCTTGGATGG + Intergenic
1137252155 16:46748310-46748332 GGCAGCACCAACCTCCACGATGG + Intronic
1137717406 16:50606800-50606822 GGTAGGCAGAGCTTCCCCGAGGG - Intronic
1138511894 16:57513574-57513596 GGTGGCCCCACCCTCCCCGATGG + Intronic
1138660806 16:58515909-58515931 GGCAGCCCGCGCCCCGCCGCGGG - Exonic
1142230580 16:88898364-88898386 GGCGGCCCGGGCGTCCCTGAGGG - Intronic
1142284771 16:89167256-89167278 GACCACCCGAGCCTCCCCGATGG - Intergenic
1203067567 16_KI270728v1_random:1032764-1032786 GGCAGCCCCAGCCTCTTGGATGG - Intergenic
1143444107 17:6997000-6997022 GACATCCTGAGCCTGCCCGAGGG + Exonic
1144206013 17:12979986-12980008 GGCAGCACCAGCCTTGCCGATGG - Intronic
1145050256 17:19654371-19654393 TGCTGCCCGAGCCTCCCTGATGG - Intronic
1147805394 17:43127122-43127144 CGTGGCCTGAGCCTCCCCGACGG + Intergenic
1152111722 17:78360550-78360572 CGCCACCCGGGCCTCCCCGAGGG + Intergenic
1152718450 17:81911097-81911119 TGCAGCCCGACCCTCCCGGCAGG + Intronic
1152759904 17:82102295-82102317 GCCTGCCCCCGCCTCCCCGATGG + Intronic
1152781221 17:82228276-82228298 GGCAGCCCTCGCCTCCCCGAAGG + Intergenic
1153773325 18:8432785-8432807 CTCAGCCCTGGCCTCCCCGATGG + Intergenic
1153815358 18:8785961-8785983 GGCAGCTCGGGCCGGCCCGAGGG + Exonic
1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG + Intergenic
1154115292 18:11608829-11608851 GGCACCCCGCACCTCCCGGACGG - Intergenic
1154231116 18:12557205-12557227 TGAGGCCCAAGCCTCCCCGACGG - Intronic
1156242994 18:35271711-35271733 CGCAGCTGGAGCCTCCCCGGCGG - Intronic
1156495031 18:37520027-37520049 GGAAGCCCCAGTCTCCCCCAAGG - Intronic
1156657869 18:39309394-39309416 CGTTGCTCGAGCCTCCCCGATGG + Intergenic
1157716637 18:49892349-49892371 GGGAGGCCAAGTCTCCCCGAGGG - Intronic
1160242280 18:77132549-77132571 AGCAGCCCGCCCGTCCCCGAGGG + Intronic
1160325241 18:77940667-77940689 GGCAGCCCCCGGCTCACCGAGGG + Intergenic
1160720732 19:595929-595951 GGCAGCCAGGCCCTCCCCGCAGG - Intronic
1160968571 19:1757466-1757488 GGCACCCCGAGCCTCCCGCAGGG + Intronic
1161005716 19:1935262-1935284 GGCAGGCCCAGCCTCCCAGCTGG + Intergenic
1161820962 19:6531232-6531254 GCCAGCCCGAGACTCCGCGAGGG + Exonic
1162725512 19:12687980-12688002 GGCAGCCCTAGGCTCCCCCTAGG + Intergenic
1163234141 19:16021237-16021259 GGCACCCCCAGCCTCTCAGAGGG + Intergenic
1163469073 19:17486484-17486506 GGGAGCCTCAGCCTCCCCGCTGG - Intronic
1164270548 19:23668586-23668608 TGCAGCCCTATCCTCCCTGACGG - Intronic
1164627891 19:29741495-29741517 GGCAACCAGAGCCGCCCCGCCGG + Intergenic
1167330635 19:48853760-48853782 GGGAGCCCCAGCCTCCCTGGTGG + Exonic
925161363 2:1686215-1686237 GGCAGCCCGAGCCCCGCCCTCGG - Intronic
925533019 2:4884517-4884539 AGTGGCCTGAGCCTCCCCGATGG + Intergenic
925915145 2:8599749-8599771 AGCTGCCCCAGCGTCCCCGAGGG - Intergenic
926154729 2:10447771-10447793 GGCCGCCAGGGCCTCCCCAACGG + Intronic
926606841 2:14906637-14906659 GGCAGCCCATGCCACCCCCAGGG - Intergenic
928688604 2:33775651-33775673 CGCAGTCCGAGTCTCCCCGACGG + Intergenic
929280458 2:40072544-40072566 GGCAGCCCAACCCTCCCCGCAGG + Intergenic
933139855 2:78779298-78779320 TACAGCCGGAGCCTCCCTGACGG + Intergenic
935112221 2:100104490-100104512 GGCGGCCCGAGCCTCGGCGGCGG - Exonic
937283826 2:120737401-120737423 GGGACCTCGAGCCCCCCCGAGGG + Intronic
937608163 2:123826807-123826829 TGCGGCCTGAGCCTCCCCAAGGG - Intergenic
938728853 2:134130312-134130334 AGTAGCCCCAGCCTCCCCTACGG + Intronic
941476550 2:165957122-165957144 CCCAGCCCGAGCCTCCTCGAAGG - Intergenic
943443339 2:187952017-187952039 TGCAGCCCAAGCCTTCCCGACGG + Intergenic
945869187 2:215208176-215208198 CGCAGCTCAAGCCTCCCCGACGG + Intergenic
947171955 2:227320925-227320947 CACAGCCTGAGCCTCCCTGATGG + Intergenic
948612879 2:239180847-239180869 GGCTGCCCCAGCCTCCAGGACGG + Intronic
1170930940 20:20768767-20768789 CGCGGCCGGAGCCTCCCCCACGG + Intergenic
1173165378 20:40683728-40683750 GGAAGCCCGGGCCTCCTCCAAGG + Intergenic
1173295155 20:41749228-41749250 GGCAGCACCAGCCTTGCCGAGGG + Intergenic
1174464075 20:50703646-50703668 GGGAGCCTGAGCCTCCCCTCTGG - Intergenic
1181045127 22:20210742-20210764 GGAAGCCCCAGCCTTCCAGAAGG - Intergenic
1181737349 22:24892278-24892300 GGGAGCCCGACCCTCTCCTATGG - Intronic
1182486320 22:30641203-30641225 GGCAGCCCCAGCCTGCAGGAGGG + Intronic
1183490196 22:38111817-38111839 CCCAGCCCCAGCCTCCCTGAGGG - Exonic
1183513211 22:38247969-38247991 GGCAGCAGGAGGCTCCCTGAGGG + Exonic
1184069391 22:42138584-42138606 CGAGGCCCGAGCCTCCCGGATGG + Intergenic
1184098775 22:42330683-42330705 GGCAGGCCCTGCCACCCCGATGG - Intronic
1184294431 22:43514918-43514940 GGCGCCCCGGGCCTCCCCGCAGG - Intergenic
1184787334 22:46678250-46678272 GGCTGCCAGAGCCTCTCGGATGG - Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185032332 22:48450610-48450632 GGCAGCGCCACCCACCCCGAGGG - Intergenic
1185294089 22:50044901-50044923 CGCAGCCTGAGTCTCCCCAAAGG - Intronic
1185309591 22:50146577-50146599 GGAAGCCCCACCCTCCCTGACGG + Intronic
950359613 3:12441128-12441150 GGCCGCCTGAGCCTGCCAGATGG + Intergenic
950547252 3:13645891-13645913 GGCACCACGAGCCTCCACCAGGG + Intergenic
950601272 3:14037507-14037529 CACGGCCCGAGCCTCCCCAACGG + Intronic
951185004 3:19702829-19702851 CGCAGCCAGAGCCTCCCCTACGG + Intergenic
951551838 3:23882590-23882612 CGTGGCCTGAGCCTCCCCGATGG - Intronic
953748760 3:45594260-45594282 GGCCGCCCGTGCGTCCCGGACGG + Intronic
956459266 3:69454730-69454752 TGCAGCCAGAGCCTCCCCAAAGG + Intronic
957209394 3:77240150-77240172 CGTGGCCCGAGCCTCCCCGACGG - Intronic
958548550 3:95588596-95588618 TGTGGCCCAAGCCTCCCCGACGG - Intergenic
960559996 3:119073466-119073488 TGCGGCCTGAGCCTCCCCGATGG - Intronic
961700749 3:128742985-128743007 TGAAGCCCGAGCCTCCCCGACGG - Intronic
962398712 3:135039487-135039509 TGCAGCCCGAGCCTCCCCGACGG - Intronic
962754887 3:138459487-138459509 GGCAGCCAAAGCCTCTCCCAGGG - Intronic
963253394 3:143121211-143121233 GGCTGCAGGAGCCGCCCCGACGG - Exonic
963397935 3:144757197-144757219 CGCAGCCTGAGCCTCCCTGATGG + Intergenic
964129309 3:153269023-153269045 CGCGGCCGGAGTCTCCCCGATGG + Intergenic
965650133 3:170923918-170923940 GGCAGCCCCCACCTCCCGGACGG - Intergenic
965652407 3:170947525-170947547 TGAGGCCCAAGCCTCCCCGATGG + Intergenic
965692284 3:171370655-171370677 GGCAACCCGAGCCTCCTTGAGGG + Intronic
965744169 3:171907113-171907135 CGCTGCCTGAGCCTCCCGGATGG - Intronic
966849436 3:184155567-184155589 GCCGGGCCGAGCCTCCCAGACGG - Exonic
967594876 3:191317071-191317093 CACGGCCCGAGCCTCCCTGACGG - Intronic
968918995 4:3512866-3512888 GCCAGCCCCAGCCACCCTGACGG + Exonic
969214522 4:5711362-5711384 GGCAGCCTGAGCGCCCCGGATGG + Exonic
969269036 4:6086300-6086322 GGCAGCCAGGTCCTCCCCGACGG + Intronic
970691947 4:18630629-18630651 CGCAGCCAGAGCCTCCCCAGCGG - Intergenic
972778686 4:42266318-42266340 CGAGGCCCAAGCCTCCCCGACGG + Intergenic
972913355 4:43846480-43846502 CGCGGCCCAAGCCTCCCGGATGG + Intergenic
973142127 4:46781962-46781984 TGCAGCCCGAGCCTCCCTGATGG + Intronic
973684303 4:53354141-53354163 TGGGGCCCGAGCCTCCCCAACGG - Intronic
974838194 4:67275308-67275330 TGCAGCCTGAACCTCCCTGATGG - Intergenic
975160755 4:71121245-71121267 TGCTGCCCGAGACTCCCCAATGG + Intergenic
975507663 4:75156962-75156984 GGCAGCCTGAGCCTCCCTCATGG - Intergenic
979445641 4:120808670-120808692 TGCAGCCCGAGCCTCTCAGGAGG - Intronic
979678569 4:123435422-123435444 CACAACCCAAGCCTCCCCGACGG - Intergenic
979702564 4:123685166-123685188 GGCACCCCCCGCCTCCCAGATGG - Intergenic
980027233 4:127781827-127781849 CGCAGGCCTCGCCTCCCCGAGGG - Intronic
980563055 4:134502098-134502120 TGCAGCCCGAGCTTCCCTGACGG + Intergenic
982758383 4:159251234-159251256 TGCTGCCTGAGCCTTCCCGACGG + Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
983835353 4:172377595-172377617 TGTGGCCCGAGCCTCCCTGATGG - Intronic
983843139 4:172481944-172481966 GGCAGCCCGAGCCTCCCCGACGG - Intronic
985054610 4:186025546-186025568 TGCGGCCCGATTCTCCCCGAGGG - Intergenic
989559724 5:42836671-42836693 TGCGGCCCGAGCCTCCCCCTTGG + Intronic
990141218 5:52706573-52706595 TGCAGCCCGAGCCACCCCCCAGG - Intergenic
991720773 5:69492932-69492954 GGGAGCCCGAGGGTCCCCGTGGG + Intronic
992050400 5:72935540-72935562 TGCAGCCAGAGCCTCCCCGACGG + Intergenic
993770333 5:91917577-91917599 TGCGGCCCTAGCCTCCCCGATGG + Intergenic
995529177 5:113075338-113075360 TGCATCCCAAGCCTCCCCGATGG + Intronic
996747028 5:126854567-126854589 CTCAGCCTGAGCCTCCCGGACGG - Intergenic
997158152 5:131580094-131580116 CGCGGCCCGAGCCTCCCCAATGG - Intronic
999441258 5:151602516-151602538 GGCAGCTGGTGCCTCCCCAAAGG + Intergenic
999767968 5:154755404-154755426 GGAAGCCCGGGCCGCCCCGGGGG + Intronic
1000085912 5:157887146-157887168 TGCGGCCCGAGCCTCCCTGATGG + Intergenic
1002452259 5:179325737-179325759 GGCAGCCCAGGCCTCCCGCACGG - Intronic
1002758066 6:179897-179919 AGCAGCCTGAGCCTGCCCAAGGG + Intergenic
1002771157 6:292041-292063 CGCGGCCCGAGCCGCCCCGCCGG - Intronic
1003026267 6:2558301-2558323 GGCAGCCCGAGCATCCACGCTGG - Intergenic
1003221575 6:4165238-4165260 GGCTGCCCAAGCCTTCCCTAAGG + Intergenic
1003532909 6:6952635-6952657 TGCGGCCCGAGCCTCCCCAAGGG + Intergenic
1003983929 6:11417054-11417076 CGCGGCCCGAGCCTCCGCAACGG - Intergenic
1004693282 6:18011290-18011312 TGCCGCCGGAGCCTCCCCAACGG - Intergenic
1006351052 6:33521567-33521589 TGAGGCCAGAGCCTCCCCGACGG - Intergenic
1008587485 6:52962691-52962713 TGCTGCCCGAGCCTCCCTGATGG - Intergenic
1010107095 6:72182716-72182738 GGCAGCCAGGGCCTCGCCGCCGG + Exonic
1011129289 6:84037536-84037558 CACTGCCCGAGCCTCCCCAACGG - Intronic
1012131332 6:95497245-95497267 CGCATCCCGAGCCTCCCCAGCGG + Intergenic
1014088336 6:117373348-117373370 CGCAGCCCGAGCCTCCCTGATGG - Intronic
1014586345 6:123202260-123202282 CGCAGCCCGAGCCTCCCCAACGG + Intergenic
1015594655 6:134854880-134854902 GGCAGCAACAGCCTCCCTGAAGG - Intergenic
1016172899 6:141041681-141041703 CGCGGCCCAAGCCTCCCTGATGG - Intergenic
1017787247 6:157766623-157766645 GGCATCCCGAGCCCCACAGAAGG - Intronic
1017971510 6:159315860-159315882 CGCAGCCCCGGCCTCCCCGTGGG - Intergenic
1018619348 6:165715088-165715110 GGCCGCCCGAGAACCCCCGAGGG + Intronic
1018910219 6:168097452-168097474 GGCAGCCCTAGCCCCGCTGACGG + Intergenic
1018926033 6:168207649-168207671 GGCAGGGCGAGCTTCCCTGAAGG - Intergenic
1019086271 6:169480343-169480365 CGTGGCCCGAGCCTCCCTGACGG + Intronic
1019262399 7:88780-88802 TGCAGCCCTGCCCTCCCCGAAGG + Intergenic
1019563578 7:1669356-1669378 CGCAGCCCGCGCGTCCCCGCCGG - Intergenic
1019594643 7:1852794-1852816 GGCAGCCCGAGGGTCCCAGCAGG - Intronic
1022505851 7:30908308-30908330 GGCAGCCAGAGCCACCCCTGTGG - Intergenic
1026098295 7:67364587-67364609 GGCAGCCCGAGACTCCTCGACGG - Intergenic
1028913032 7:96229010-96229032 TGCAGCCTGAGCCTCCCCAACGG + Intronic
1030772180 7:113488192-113488214 CACAGCCTGAGCCTCCCCGACGG - Intergenic
1035683529 8:1507215-1507237 CGCGGCCCAAGCCTCCCTGATGG - Intronic
1036915017 8:12796566-12796588 TGCGGCCCCAGCCTCCCGGAAGG + Intergenic
1038724241 8:30066033-30066055 AGCTGCCCGAGCCTCCATGAAGG + Exonic
1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG + Intronic
1045098722 8:98825304-98825326 GGGAGCCGGAGCCTCCCCTGCGG - Intronic
1045507869 8:102791249-102791271 CGCAGGCAGAGCCTCCCCGGGGG + Intergenic
1046260279 8:111758818-111758840 CGCAGCCCCAGCCTCCCTGATGG - Intergenic
1049399577 8:142418929-142418951 GGCAGCCCAGGCCTCCCCAGAGG + Intergenic
1049766703 8:144358423-144358445 GGCTGCCCCAGCCTCCCGGCAGG - Exonic
1049874572 8:145007943-145007965 GGAAGCCCGAGCGCCCCAGACGG - Intergenic
1050282639 9:4066998-4067020 TGCAGCCAGACCCTCCCCAATGG + Intronic
1050294959 9:4195594-4195616 CGCGGCCTGAGCCTCCCAGATGG + Intronic
1051549728 9:18315394-18315416 CACGGCCCGAGCCTCCCTGACGG - Intergenic
1052122842 9:24738839-24738861 CATGGCCCGAGCCTCCCCGACGG + Intergenic
1057442153 9:95090633-95090655 GGCAGCCCCTGCCTCCCTGCTGG + Intergenic
1059633893 9:116154231-116154253 GGCTGGCCGAGCGTCCCCGCCGG + Exonic
1060756396 9:126217599-126217621 TGCAGCCCCAGCCTCCTCCAGGG + Intergenic
1061291710 9:129654040-129654062 GGGACCCTGAGCCTCCCCGTTGG - Intergenic
1061872954 9:133530343-133530365 AGCAGCGGGACCCTCCCCGATGG - Intergenic
1062452485 9:136621447-136621469 GGCAGCCCCAGCCTGGCCCACGG + Intergenic
1062472687 9:136713217-136713239 GGCGGCCCGGGCCTCCCCTGCGG - Intronic
1188058042 X:25564344-25564366 GGTAGCCCCAGCCTCCAAGATGG + Intergenic
1190927537 X:54922590-54922612 GGAAGCCCCAGGCTCCCCGGGGG - Exonic
1193889984 X:87033222-87033244 GGCAGCCCCCACCTCCCGGACGG + Intergenic
1194340409 X:92699545-92699567 CACGGCCCGAGCCTCCCTGATGG - Intergenic
1195469848 X:105219495-105219517 GGCAGCCCTGGCCTCCACGTGGG + Exonic
1195469864 X:105219537-105219559 GGCAGCCCCAGCCTCCACAGGGG + Exonic
1198583684 X:138096179-138096201 GGCAGCCCTGGCCTCCCCAGTGG + Intergenic
1199612645 X:149631406-149631428 GCCTGCCCGAGCCTCCCTGCGGG - Intronic
1199694908 X:150337057-150337079 GCCAGCCTGAGCCTCCCCAAGGG - Intergenic
1200648777 Y:5816297-5816319 CACGGCCCGAGCCTCCCTGATGG - Intergenic
1201260922 Y:12158501-12158523 CACAGCCTGAGCCTCCCTGATGG - Intergenic
1201424286 Y:13831645-13831667 CGCAGCCCCAGCCTCCCTGACGG + Intergenic
1201499538 Y:14627356-14627378 CGCAGCCCCAGCCTCCCCAACGG - Intronic
1202100550 Y:21303632-21303654 ACCAGCCTGAGCCTCCTCGACGG - Intergenic