ID: 983843322

View in Genome Browser
Species Human (GRCh38)
Location 4:172483346-172483368
Sequence CATTGTGAAGGGAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983843322 Original CRISPR CATTGTGAAGGGAGTGCAGA GGG Intronic
900957120 1:5892869-5892891 GTTTGTGAAGGGGGTGCAGGAGG - Intronic
903317200 1:22517445-22517467 TACTGTGAAAGGTGTGCAGATGG - Exonic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
905417334 1:37812954-37812976 TTTGGGGAAGGGAGTGCAGAAGG + Exonic
906000615 1:42421361-42421383 GAGGGTGAGGGGAGTGCAGAAGG + Exonic
906133203 1:43474663-43474685 CATTGAGAAGATAGTACAGAGGG - Intergenic
906699980 1:47850684-47850706 CACTAAGAAGGAAGTGCAGACGG + Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907138292 1:52159637-52159659 CATCCTGAAGGGACTGCAGTAGG + Intronic
908473555 1:64468462-64468484 TATTGTGAAGGCATTTCAGAAGG + Intergenic
913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG + Intronic
914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG + Intergenic
914150609 1:145038802-145038824 CATTGTAAAGGGAGTAGGGAAGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917437975 1:175040291-175040313 CACTGGGAAGGAAGTGTAGAGGG + Intergenic
918190508 1:182169664-182169686 CATGGTTAAGTGGGTGCAGAAGG - Intergenic
918432376 1:184475291-184475313 CTTCGTGAAGGGCCTGCAGAAGG - Intronic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920129462 1:203720617-203720639 CATTGTGAAGGCAGTGATGTGGG + Exonic
920390404 1:205596756-205596778 CATCCTGAAGGCAGTGCTGAGGG + Intronic
920474314 1:206260006-206260028 CATTGTAAAGGGAGTAGGGAAGG + Intronic
920535918 1:206736511-206736533 TCTTGGTAAGGGAGTGCAGAGGG + Intergenic
921768238 1:218999885-218999907 CATTGTGAAGATAGGACAGAGGG + Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
922320160 1:224479991-224480013 CACTGTTAGGGCAGTGCAGAAGG - Intronic
922333442 1:224598027-224598049 CATTGTGTTGTGAGAGCAGAAGG + Intronic
922997887 1:229981378-229981400 CATGGTGCAGGGAGTGCAGAAGG - Intergenic
923573510 1:235137764-235137786 CAATGTGAGGGAAGCGCAGAAGG - Intronic
924741990 1:246799594-246799616 CATTGGGAAGGGGGTCCAGGAGG - Intergenic
1063934564 10:11064334-11064356 CACTCTGAAGGGAGTGCTGGTGG - Intronic
1064505769 10:16028070-16028092 CCTGGGGAAGGGAGTGCACAGGG + Intergenic
1066707977 10:38202003-38202025 CAGAGTGAAGGCAGTGAAGAGGG + Intergenic
1069831078 10:71282740-71282762 CCTTGTGCAGGGAGTCCAGATGG - Intronic
1071222869 10:83490269-83490291 CATGGGGAAAAGAGTGCAGAAGG - Intergenic
1071327806 10:84534295-84534317 CTCTGTGAGGGCAGTGCAGAAGG + Intergenic
1071863772 10:89703221-89703243 CATGGGTAAGGGGGTGCAGAGGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1074877138 10:117622262-117622284 CATTGGGAAGGTGTTGCAGAAGG - Intergenic
1074933282 10:118151506-118151528 CAATGTTAAAGGAGAGCAGATGG - Intergenic
1075406676 10:122200113-122200135 CATTGTGAAGAGGGAGCAGCCGG - Intronic
1075681166 10:124333157-124333179 CATTCGGAAGAGAATGCAGAAGG + Intergenic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1079505563 11:21148658-21148680 CAGTGTGAAAGGTGTGCAGGGGG - Intronic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1081759150 11:45564905-45564927 CATTGAGAATAGACTGCAGAGGG + Intergenic
1081795015 11:45812920-45812942 GATTGTGAGGGGACTGGAGAGGG - Exonic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084412189 11:69011480-69011502 CATTGTGATGTGTGTGCAGTGGG + Intronic
1086341729 11:85854650-85854672 CATTGTGGAAGGAGCGCAGCGGG + Intergenic
1086398984 11:86445461-86445483 CAGTGAGAAGGAAATGCAGAAGG + Intronic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1087603213 11:100342219-100342241 TCTTTTGCAGGGAGTGCAGATGG + Intronic
1088164808 11:106921554-106921576 CTTTGTGAAGGAATTGGAGAAGG - Intronic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089279494 11:117363356-117363378 CAGGGTGAGGGGTGTGCAGAGGG - Intronic
1089458416 11:118639043-118639065 AAGTGGGAGGGGAGTGCAGAAGG + Intronic
1090500775 11:127258458-127258480 GAATGTGAAGGAAGAGCAGATGG - Intergenic
1092277960 12:7076575-7076597 CATTGGGAAGAGAATGCAGGAGG - Intergenic
1092914511 12:13177923-13177945 CAATGTGAAGGGAGTGCTAAAGG + Intergenic
1095216709 12:39557901-39557923 CATTGCTAGGGTAGTGCAGAAGG + Intronic
1095780165 12:46049906-46049928 CATTCTGAAAGAAGTGCATAGGG + Intergenic
1097200322 12:57272800-57272822 AATGGGGAAGGGAGTGCAGCAGG - Intronic
1098327331 12:69316315-69316337 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1099193422 12:79584601-79584623 TATTGTGAAGATAGTACAGAGGG - Intronic
1100038477 12:90281973-90281995 CTTTGTTAGGGCAGTGCAGAAGG + Intergenic
1101425203 12:104582572-104582594 CCATGAGAAGGGCGTGCAGAGGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102250148 12:111381230-111381252 GATAGTGAAGCCAGTGCAGAGGG + Intergenic
1104860981 12:131923374-131923396 CAGGGTGAAGAGAGTCCAGAGGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106697778 13:32195839-32195861 TATTCTGAAGGAAGGGCAGAGGG + Intronic
1107214441 13:37899878-37899900 CATTGTGGAGGAAGTGCTGCAGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1108197458 13:48009309-48009331 AAATTTGAAGGGAGTGAAGAGGG + Intergenic
1108272597 13:48776537-48776559 CATTGTGAGGGGAGTGACAAGGG + Intergenic
1108534632 13:51361664-51361686 TGTTGTGATGGGGGTGCAGATGG - Intronic
1110239542 13:73251924-73251946 CATTTTGAAGCCAGTGCAAATGG + Intergenic
1112104044 13:96221084-96221106 TATGGTGGAGGGAGGGCAGAGGG - Intronic
1115130355 14:30046731-30046753 CATGGAGAGGGGAGTGCGGAAGG - Intronic
1116934154 14:50720695-50720717 ATTTGTGAAGGGAGAGTAGAAGG - Intronic
1119054559 14:71406058-71406080 CAATGTGAAGACAGTGGAGATGG + Intronic
1119105595 14:71920382-71920404 CATTGTGAGGGGAGTCAAGATGG + Intergenic
1119914090 14:78380522-78380544 CAATGTGAAGACAGAGCAGAGGG + Intronic
1120921051 14:89755732-89755754 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1121026139 14:90617670-90617692 CATTGTGAACTGAGTCCAGTGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121752055 14:96365207-96365229 CAATGTAAAGGGAGTGGAGATGG + Exonic
1122985453 14:105209631-105209653 CATCGAGGAGGGAGGGCAGACGG - Exonic
1123918232 15:25052776-25052798 CATGTTGAAGGGCATGCAGATGG + Intergenic
1123919114 15:25058129-25058151 CATGTTGAAGGGCATGCAGATGG + Intergenic
1124235163 15:27983821-27983843 CAGTGTGGAGGCAGTGCGGATGG + Intronic
1126272590 15:46838794-46838816 TATTGTGAAGAAAGTACAGAGGG - Intergenic
1126656397 15:50982146-50982168 CATGGTGAAAGGAAAGCAGAAGG - Intronic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1128358300 15:66943553-66943575 CATTCTGAAGGGAAAGAAGAGGG - Intergenic
1128650040 15:69404377-69404399 CCTAGTGAAGGGAGAACAGAAGG + Exonic
1130823246 15:87517398-87517420 CATTGGGCACGCAGTGCAGAGGG - Intergenic
1131594143 15:93779709-93779731 CAGATTGAAGGGATTGCAGAGGG - Intergenic
1131961118 15:97791439-97791461 CATTGTGGTGGTAGTGGAGATGG - Intergenic
1133226492 16:4343249-4343271 CATTGTGATGGGCGTGCAGGTGG - Exonic
1134747363 16:16598665-16598687 TATTTTGAAAGGAGTGCAGATGG + Intergenic
1134998108 16:18754993-18755015 TATTTTGAAAGGAGTGCAGATGG - Intergenic
1135100190 16:19598538-19598560 CTTTGGGAAGCCAGTGCAGAAGG + Intronic
1135158143 16:20071932-20071954 CATTCTGATGGGAATGCTGAGGG + Intronic
1136107417 16:28040110-28040132 CATGGTGATGGGTGTGGAGAAGG - Intronic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1138456391 16:57123495-57123517 CACTGGGATGGGGGTGCAGAGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140529891 16:75656096-75656118 CAGTGTGATTGGAATGCAGAGGG + Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1143092807 17:4459035-4459057 CATGGAGAAGGGAGTGAGGATGG - Intronic
1143344768 17:6241543-6241565 CATTGTGAGGGGAGTCAACAGGG - Intergenic
1144672845 17:17142663-17142685 CATTGAGAAGGCAGAGCACATGG + Exonic
1148088669 17:45009622-45009644 CATGGTGAGGGGTGGGCAGAGGG - Intergenic
1148527705 17:48357149-48357171 CATTGTATAGGGAATACAGAAGG + Intronic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1149649746 17:58269331-58269353 CCTGGAGAAGGGAGAGCAGATGG - Intergenic
1150937884 17:69657469-69657491 AATTGTGAAAGTAGTCCAGATGG + Intergenic
1151745526 17:76009781-76009803 CATCGTGAAGGAGGTGAAGAAGG - Exonic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152279971 17:79379467-79379489 CATTGAGAAAGGTGTGAAGATGG - Intronic
1153626028 18:7023202-7023224 CACTGTGAAAGGTGTGCTGACGG - Exonic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1155411507 18:25550449-25550471 CAATGTGAAGAGAGTGAAAATGG - Intergenic
1155706114 18:28815396-28815418 CATTCTAAAGGGAGTTCAGTGGG + Intergenic
1157607931 18:48937884-48937906 CATTGTGGAGTGAGGGCAGGGGG - Intronic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157862153 18:51151271-51151293 CCATGTGAAGGCACTGCAGAAGG + Intergenic
1157862178 18:51151428-51151450 CCATGTGAAGGCACTGCAGAAGG + Intergenic
1158221879 18:55159149-55159171 CATGGTGCATGGAGTGCATATGG - Intergenic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
925085113 2:1101595-1101617 CAGGATGAAGGGAGTGCAGGAGG + Intronic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
927401695 2:22719828-22719850 AATTTGCAAGGGAGTGCAGAAGG - Intergenic
928226670 2:29455215-29455237 CAGTGTGAAGAGAGCCCAGAGGG + Intronic
929832332 2:45357157-45357179 CATGGGGAAGGGAGAGTAGATGG - Intergenic
929866476 2:45721428-45721450 AGTTGTCAGGGGAGTGCAGAAGG + Intronic
930186028 2:48413022-48413044 CACTCTGAAGTCAGTGCAGAAGG - Intergenic
931639643 2:64370374-64370396 CAGTGTGGAGGGTTTGCAGAAGG + Intergenic
932417513 2:71582577-71582599 TATAGTGAAGAGAGTGAAGATGG + Intronic
932584976 2:73022042-73022064 CATTCTGAAGGGAGGGCTAATGG + Intronic
933327371 2:80855338-80855360 CCTTGGGATGGGAGTGCAGTGGG - Intergenic
935025630 2:99274120-99274142 AATTGAGAAGCGAGTGCATAAGG - Intronic
936140472 2:109935681-109935703 CCTTGTGAAGGCATTGGAGAAGG + Intergenic
936177163 2:110233626-110233648 CCTTGTGAAGGCATTGGAGAAGG + Intergenic
936204222 2:110435805-110435827 CCTTGTGAAGGCATTGGAGAAGG - Intronic
936594778 2:113837451-113837473 GATTGGGAAGGGAGTGCGTAGGG + Intergenic
937996467 2:127698271-127698293 CACTGTGAATGGAGCCCAGAAGG + Intergenic
940444817 2:153765076-153765098 CTTTGTGAGGGCAGTGCAGAAGG + Intergenic
940695728 2:156975471-156975493 CATTGTGAGGTGAGTTTAGAAGG + Intergenic
941139838 2:161765868-161765890 TATGATGAAGGGAATGCAGAGGG - Intronic
943936431 2:193921721-193921743 AATTGTGCAGGCAGTGCAAATGG - Intergenic
944036264 2:195298083-195298105 CAGTGTGATGGTATTGCAGATGG + Intergenic
944663748 2:201941950-201941972 CCGAGTGAAGGGAGTGCAGGAGG + Intergenic
944853516 2:203744074-203744096 CCTAGTGAAGGGAATGAAGAGGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
946516736 2:220420032-220420054 CATGGGGAAGGGAGAGCAGAGGG + Intergenic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
948103089 2:235390983-235391005 CACTGTGCAGGCTGTGCAGACGG + Intergenic
948218357 2:236249264-236249286 CATTGTGGGAGGAGAGCAGAAGG - Intronic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1170405971 20:16037133-16037155 CATTGTGAAGTGAGGTTAGAAGG + Intronic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171412349 20:24956031-24956053 CATTGTGAAGGGAGGCCACCTGG - Intronic
1177785762 21:25669524-25669546 CAATGTGAAGTGAGGGGAGAGGG + Intronic
1179367147 21:40769112-40769134 CCTTGGGAAGTGAGAGCAGAGGG - Intronic
1180874432 22:19168664-19168686 CAAGGTGGAGGCAGTGCAGAGGG - Intergenic
1181519280 22:23436148-23436170 CAGCGTGCAGGGAGAGCAGAGGG + Intergenic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182619647 22:31611861-31611883 GATGGAGAAGGAAGTGCAGAGGG - Intronic
1184106591 22:42370931-42370953 CCCTGTGATGGGGGTGCAGAGGG - Intergenic
1184255120 22:43282080-43282102 CAGGGTGAAGGGAGTTGAGAAGG + Intronic
1185233581 22:49698607-49698629 CAGAGTGAGGGGAGTGCTGAGGG + Intergenic
949275524 3:2275487-2275509 CATTGCTAAAGGAGTTCAGAAGG - Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
953627059 3:44580081-44580103 CATTGAGAAGGCAGAGCACATGG - Intronic
953680060 3:45032301-45032323 CCCTGTGGTGGGAGTGCAGAAGG - Intronic
954295221 3:49670744-49670766 CACTGTGAAGTGAGTGCACTGGG - Exonic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958501679 3:94918803-94918825 AATTGGGAAGGCAGGGCAGAGGG + Intergenic
959851827 3:111096887-111096909 CTCTGTTAAGGCAGTGCAGAAGG + Intronic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
960747465 3:120906375-120906397 CATTTTGATGGGAGCGAAGAAGG - Intergenic
961127957 3:124438178-124438200 CATTTTGAAGGGAGTTTGGAGGG - Intronic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966989277 3:185212429-185212451 GAGTGGGAAGGGAGTGTAGAAGG - Intronic
967020062 3:185514957-185514979 CACAGTGCAGGGAGTGCAGGTGG - Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
967892672 3:194374109-194374131 CCTCCTGAAGGGAGAGCAGATGG - Intergenic
967898759 3:194425062-194425084 CATTGTGGAGGGAGTTAGGATGG - Intronic
968520707 4:1033578-1033600 CATTGTGAGGGGACCACAGAAGG - Intergenic
968712150 4:2126934-2126956 CATGGGGAGGGGAGTGCAGGGGG + Intronic
969648217 4:8446351-8446373 CATTGTGAATAGAGTGCTGGGGG + Intronic
969917861 4:10508281-10508303 CATTCTGAAGGTGGTGCTGAAGG - Intronic
970987618 4:22176657-22176679 CTTTGTTAAGGCAGTGCAGAAGG - Intergenic
971759459 4:30746401-30746423 CAGCGTGAAGGGAGAGCAGGGGG + Intronic
972301851 4:37792234-37792256 CATGGTGAATGCAGTGCAGAAGG + Intergenic
975124059 4:70761944-70761966 CAGTGTGAAGGTAGTACAGTAGG + Intronic
979464287 4:121018461-121018483 AATTGTAAAGGGAGGACAGAGGG + Intergenic
983024840 4:162722989-162723011 TATTGTGAAGAGAGTGCATAAGG + Intergenic
983553929 4:169043272-169043294 TATGGAGAATGGAGTGCAGAGGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984183586 4:176515006-176515028 CATTGTGAAGGGAGATCTGCAGG + Intergenic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986789667 5:11147461-11147483 CATGGTGAATGAAGAGCAGAGGG + Intronic
987395672 5:17420874-17420896 CAGTGTGCAGGGACTGGAGAGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989469206 5:41795404-41795426 GATTGTGAAGGGAATGGGGATGG - Intronic
992244222 5:74801890-74801912 CATAGTGAAGGGAGAGCATGTGG - Intronic
993536171 5:89088812-89088834 CATTTTGAGGGGAGTGGAGTAGG + Intergenic
994089898 5:95800669-95800691 AAATGTGAAGGGAGGGCACAGGG - Intronic
995565599 5:113430787-113430809 CAGCGTGAAGAGACTGCAGATGG + Intronic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
998453174 5:142250376-142250398 CATTTAGAAGGGAGTGCAGCAGG - Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
998955287 5:147432173-147432195 CATTTTGAAGGGAGTGCCCCAGG - Intronic
1003954982 6:11154470-11154492 CATTGGAAAGGGAGTGCATGAGG + Intergenic
1004698392 6:18055647-18055669 CATGGAGATGAGAGTGCAGAAGG - Intergenic
1006143318 6:31943919-31943941 CATCGTGCAGGGAAGGCAGATGG - Exonic
1006552274 6:34834420-34834442 CATTGTGAAGGGAGAGAATGGGG + Intronic
1006991961 6:38222598-38222620 CATTGTGAGGGGAGGGCACCAGG + Intronic
1009450471 6:63794080-63794102 ATTTGGGAAGGGAGTGCTGAAGG - Intronic
1011213241 6:84976856-84976878 CATTGTGAAGGGTCTTCAAAGGG + Intergenic
1012286444 6:97395448-97395470 CATTGTCAAGGAAGGGCAGATGG - Intergenic
1012429770 6:99152266-99152288 AAATGTGTAGGGAGTGCAGCTGG + Intergenic
1013635712 6:112027422-112027444 CATGGTGCAGAGAGTGCAGTGGG + Intergenic
1013865449 6:114690884-114690906 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG + Intronic
1015101851 6:129490844-129490866 CACTGTTAAGGGGGTGAAGAAGG - Intronic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1016905817 6:149149846-149149868 CATTTTGAAGGTAGAGTAGATGG + Intergenic
1019592000 7:1840183-1840205 CAGCGTGCAGGGAGAGCAGAGGG - Intronic
1021257364 7:18409511-18409533 GGTTGGGAAGGGAATGCAGAGGG - Intronic
1022951230 7:35340099-35340121 CCTTGTGAAGAGAGTTTAGACGG + Intergenic
1023179589 7:37468770-37468792 CAGAGTGAATGGATTGCAGAGGG - Intergenic
1023885369 7:44350071-44350093 CATTGTGAGGGGTGGGGAGAAGG - Intergenic
1024804010 7:53114839-53114861 GCTTGTGGAGGGTGTGCAGAGGG - Intergenic
1025145035 7:56494858-56494880 CCTTGGGAAGGGTCTGCAGAGGG - Intergenic
1025724241 7:64043168-64043190 CAGTATGAAGGGAGTGGGGAGGG - Intronic
1028222977 7:88219034-88219056 CCTTGTGAAGGGCGGGCAGGCGG - Intronic
1028249681 7:88526192-88526214 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1029452704 7:100650134-100650156 CACTGTGGAGAAAGTGCAGAGGG + Exonic
1029648755 7:101875918-101875940 TATGGTGAAGGGAGTAAAGATGG + Intronic
1030557700 7:111047608-111047630 GAGTGTGAAGGGAGTACATACGG - Intronic
1031849750 7:126849790-126849812 CATGGTAAAGGGAGAGGAGATGG - Intronic
1032885980 7:136138786-136138808 CATTGTGCTGGGAGTGTGGATGG + Intergenic
1033532643 7:142280789-142280811 CATAGTGAAGAGCGTGGAGAAGG + Intergenic
1034296459 7:149977127-149977149 GAATGTGAAGGGAGTATAGATGG - Intergenic
1034809571 7:154119690-154119712 GAATGTGAAGGGAGTATAGATGG + Intronic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1038767037 8:30438331-30438353 CATTGTACAGGGAGGACAGAAGG - Intronic
1039440921 8:37594955-37594977 CATTGGGAGGGGCGTGGAGACGG - Intergenic
1040464089 8:47678591-47678613 CACTTTGGAGGGGGTGCAGAGGG + Intronic
1040486997 8:47883095-47883117 CATCGTGATGAGAGTGCACAGGG + Intronic
1040979056 8:53226776-53226798 CATTGAAAAAGGAGTGAAGAAGG - Exonic
1041993604 8:64026007-64026029 CATTTTCAAGTGAGTGGAGAAGG - Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1042758731 8:72247639-72247661 GATTTTGAAGGAAGTGCATATGG - Intergenic
1042989234 8:74620401-74620423 CTCTGTGAGGGCAGTGCAGAAGG - Intronic
1044294555 8:90512190-90512212 CAAGGTGAAGGGAGTGTAAAGGG + Intergenic
1044451634 8:92342569-92342591 CGTTGTTGAGGGAGTGCACATGG + Intergenic
1045081587 8:98631187-98631209 CATTGAGAAGGGATTGTAGCAGG - Intronic
1045422135 8:102026759-102026781 CTTTGTTAGGGCAGTGCAGAAGG - Intronic
1045559023 8:103242973-103242995 CAGTGTGATGGGTGTCCAGAGGG - Intergenic
1047764957 8:127982964-127982986 CAGTGTGATGGGAGTACACAGGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1050290866 9:4153198-4153220 CATTGTCAAGGTAGTGAATAAGG - Intronic
1050981467 9:12021281-12021303 AATTCTGAAGGGAGTGAAAAAGG - Intergenic
1051663393 9:19445916-19445938 TATTTTGAAGGGAGAGCTGATGG + Intronic
1051779980 9:20679608-20679630 CATTTTGAAGTCAGTGTAGAAGG - Intronic
1055935001 9:81596526-81596548 CATGGTGAAGGGATCCCAGAAGG + Intronic
1056087071 9:83161060-83161082 CTCTGTCAGGGGAGTGCAGAAGG + Intergenic
1057420163 9:94905862-94905884 ATTTCTGCAGGGAGTGCAGAAGG + Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1060742744 9:126110395-126110417 CACTCTGAAGAGAGTACAGATGG - Intergenic
1061641802 9:131964043-131964065 GATTGTGAGGAGAGTGGAGAAGG + Intronic
1062121889 9:134838345-134838367 AGGTGTGAAGGGAGCGCAGAGGG + Intronic
1062478418 9:136740787-136740809 GATGGTGGAGGGGGTGCAGAGGG - Intronic
1185636019 X:1552620-1552642 CACGGTAAAGTGAGTGCAGACGG + Intergenic
1186486058 X:9935238-9935260 GGGGGTGAAGGGAGTGCAGAGGG + Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187632946 X:21195193-21195215 CCCTCTGAAAGGAGTGCAGAGGG - Intergenic
1190640736 X:52481427-52481449 CATTGGGTAGGGACTGCAGAGGG + Intergenic
1190646936 X:52531438-52531460 CATTGGGTAGGGACTGCAGAGGG - Intergenic
1190976363 X:55405668-55405690 CAATGTGAAGACAGTGCAAAGGG + Intergenic
1191680058 X:63831494-63831516 CTTTGTTAGGGCAGTGCAGAAGG + Intergenic
1192522273 X:71813423-71813445 CATAGTGAAGGCAGTGGTGAAGG - Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1199411090 X:147523967-147523989 CATTGTAACGGGTGTGTAGATGG + Intergenic
1199659698 X:150036657-150036679 CAGTGTGAAGGAAGTGCCAAGGG + Intergenic
1199874631 X:151920571-151920593 GATGGGGTAGGGAGTGCAGATGG - Intronic
1200285940 X:154822442-154822464 GGATGTGAAGGGAGAGCAGATGG - Intergenic