ID: 983844932

View in Genome Browser
Species Human (GRCh38)
Location 4:172506332-172506354
Sequence GTTTTTATGAGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 5, 2: 23, 3: 51, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983844932_983844940 11 Left 983844932 4:172506332-172506354 CCCTCCATGATCCTCATAAAAAC 0: 1
1: 5
2: 23
3: 51
4: 243
Right 983844940 4:172506366-172506388 CATTGGAGAGATGGAGTTGAGGG 0: 1
1: 0
2: 3
3: 55
4: 348
983844932_983844939 10 Left 983844932 4:172506332-172506354 CCCTCCATGATCCTCATAAAAAC 0: 1
1: 5
2: 23
3: 51
4: 243
Right 983844939 4:172506365-172506387 TCATTGGAGAGATGGAGTTGAGG 0: 1
1: 0
2: 7
3: 67
4: 362
983844932_983844938 2 Left 983844932 4:172506332-172506354 CCCTCCATGATCCTCATAAAAAC 0: 1
1: 5
2: 23
3: 51
4: 243
Right 983844938 4:172506357-172506379 ACTCAAACTCATTGGAGAGATGG 0: 1
1: 0
2: 1
3: 24
4: 182
983844932_983844936 -6 Left 983844932 4:172506332-172506354 CCCTCCATGATCCTCATAAAAAC 0: 1
1: 5
2: 23
3: 51
4: 243
Right 983844936 4:172506349-172506371 AAAAACCGACTCAAACTCATTGG 0: 1
1: 0
2: 1
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983844932 Original CRISPR GTTTTTATGAGGATCATGGA GGG (reversed) Intronic
901944600 1:12691420-12691442 ATGTTTATAAGGATGATGGATGG + Intergenic
903254174 1:22081586-22081608 GGTTATATAAGGATGATGGATGG + Intronic
903606930 1:24581662-24581684 GGATTGATGAGGCTCATGGAGGG + Intronic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908563598 1:65331632-65331654 GTTATTATGAGGAACATGAGAGG - Intronic
909179327 1:72401424-72401446 GTCTTTTTCAGGAACATGGATGG - Intergenic
912102128 1:106222704-106222726 ATTTTTCAGAGGATCATAGAGGG - Intergenic
912326096 1:108764186-108764208 GTCTTTAGCAGGAACATGGATGG - Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915028553 1:152856032-152856054 GGTTTAATGAGGATCAGAGATGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
915929100 1:160047630-160047652 GTTTTTTTGAGAGTCAGGGAAGG - Intronic
916643376 1:166756466-166756488 GTCTTTTTCAGGAACATGGATGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
919504417 1:198380321-198380343 CCCTTTATGAGGATCAGGGAAGG + Intergenic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
921390641 1:214609842-214609864 GTTTTTTGCAGGAACATGGATGG - Intronic
922354950 1:224766719-224766741 GTTTTCTTGAGGATCAGGAAAGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
923408428 1:233685713-233685735 GTTTTTATGAGAATTATGCCAGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1066058299 10:31701222-31701244 GTGTTTATGAGGTTTATTGAGGG - Intergenic
1067723389 10:48747812-48747834 GTTTCTGTGACAATCATGGAAGG + Intronic
1067942045 10:50665308-50665330 GCATTTATTTGGATCATGGAAGG - Intergenic
1068314817 10:55326421-55326443 GTTCTTTTAAGGATCATGGATGG + Intronic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1069772132 10:70906712-70906734 GTTTTTATGAGGCCCAGAGAGGG - Intergenic
1070863283 10:79690253-79690275 GCATTTATTTGGATCATGGAAGG - Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1074034275 10:109722518-109722540 GTTGTTTTCAGGATCATGGATGG - Intergenic
1074309878 10:112312937-112312959 GATTTTATTAGGAGGATGGAGGG - Intergenic
1077634770 11:3834888-3834910 GTTATAATGAGGTTCAGGGAGGG - Intronic
1078385154 11:10884241-10884263 GTTTTTATTAGGATTTTAGAAGG + Intergenic
1079814643 11:25039989-25040011 GATTTTGGGAGGATCATGGGTGG + Intronic
1079991020 11:27247096-27247118 TTATTTATGAGGATACTGGAAGG + Intergenic
1080152460 11:29069448-29069470 GTTTTTTGCAGCATCATGGATGG + Intergenic
1080975098 11:37329979-37330001 GTCTTTTGGAGGAACATGGATGG - Intergenic
1081771665 11:45654043-45654065 GTCTTGATGAGGACCAAGGAGGG - Intronic
1082216616 11:49578144-49578166 GTGTTTACGGGGATCATGGTGGG + Intergenic
1082889266 11:58121316-58121338 ATTTTAATGAGTATCCTGGATGG - Intronic
1082897899 11:58212597-58212619 GATTTTATTAAGATCTTGGAAGG + Intergenic
1085360887 11:75885943-75885965 GTTTTTATGACACTCATGCAAGG + Intronic
1085954294 11:81372349-81372371 ATTTTTATGAGGACCATTGAGGG + Intergenic
1086296921 11:85379429-85379451 CTTTTTCTGAGGAACATGTAGGG - Intronic
1086977386 11:93150449-93150471 GGTTATATGAGGAACATGGTGGG - Intronic
1087699152 11:101415834-101415856 GTCTTTTTCAGGAACATGGATGG + Intergenic
1088395060 11:109358283-109358305 GTCTTTTTCAGGAACATGGATGG - Intergenic
1090709884 11:129375124-129375146 TTTTTTATGAGGGTAACGGACGG + Intergenic
1091192041 11:133704159-133704181 GTTTTTATAAGAAATATGGAGGG + Intergenic
1091324464 11:134676071-134676093 GTCCTTGTGAGGGTCATGGAGGG + Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092505754 12:9097925-9097947 GTTTTTATAAGAATTATGGCTGG - Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095537626 12:43270429-43270451 GTTTTTATAAGTTTCATGAATGG + Intergenic
1097493534 12:60299107-60299129 GTTTTTTTCAGGGACATGGATGG - Intergenic
1097674714 12:62587115-62587137 GTTTTTATGAGGAGAAAGAAGGG + Intronic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098005029 12:65987211-65987233 TTTTTTAGGAGGTTCATGAAAGG - Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1101528628 12:105554791-105554813 ATGTTTATGAGGATCCTGGTGGG + Intergenic
1101656824 12:106729740-106729762 GTATTTATAAGGATTAGGGAGGG + Intronic
1101698799 12:107152296-107152318 GTTTTGATCAGGGTCAGGGAAGG - Intergenic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1109141337 13:58716275-58716297 ATTTTTCTGGGGATCATGGGAGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111263398 13:85774257-85774279 GTCTTTTTCAGGAACATGGATGG + Intergenic
1111274631 13:85932735-85932757 GTTTTTTGCAGGAACATGGATGG - Intergenic
1111540934 13:89666563-89666585 GTTTTTTGCAGGAACATGGATGG + Intergenic
1111836094 13:93390078-93390100 GTGTTTAAGAGGAACTTGGAGGG + Intronic
1111916081 13:94361879-94361901 CTTTTTATGTTGATCAAGGAAGG - Intronic
1112537122 13:100270186-100270208 GTCTTTAGGAAGATCCTGGAAGG + Intronic
1112560564 13:100509414-100509436 GTTTATCTGTGGATCACGGACGG + Intronic
1113128691 13:107009841-107009863 GTTTTTATGAGAAGAAAGGAAGG + Intergenic
1113180696 13:107622130-107622152 GTTTTTCTAAGAATCATGGCTGG + Intronic
1114392786 14:22328159-22328181 CTTCTTATGAGGCTGATGGATGG + Intergenic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1118635687 14:67747063-67747085 GTTTGTCTCAGCATCATGGATGG + Exonic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124235621 15:27987247-27987269 CTTTTTATTAGGATCCAGGATGG - Intronic
1124468275 15:29960347-29960369 GTTTTTATTATGATCCTGGTAGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1125382847 15:39105383-39105405 GTTTTTTGCAGGAACATGGATGG - Intergenic
1126774265 15:52086458-52086480 GTTTTTAAGAGAATTATGAAGGG - Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1127907169 15:63384426-63384448 GGTTTGATGAAGAACATGGATGG - Intergenic
1128846791 15:70905824-70905846 GGTCTTATGACGCTCATGGAAGG - Intronic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1131505252 15:93012272-93012294 TTTTTTATGATCTTCATGGATGG - Intronic
1131799107 15:96051575-96051597 GTTGTTATGAGGATTATGCCAGG + Intergenic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135121247 16:19768272-19768294 GATTATATGAGTATTATGGATGG + Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138372774 16:56540523-56540545 GTTTTTAAGAGGATCATGACAGG - Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140452434 16:75081504-75081526 GATTTTATGAGGAACAGGCAGGG + Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1145103724 17:20097740-20097762 GTTTTTATGAGTCAAATGGAGGG + Intronic
1145315740 17:21731908-21731930 GTCTTTTTCAGGAACATGGATGG - Intergenic
1145714170 17:27003847-27003869 GTCTTTTTCAGGAACATGGATGG - Intergenic
1147373995 17:40013414-40013436 GTTTTTAACAGGACCATGGAAGG - Intergenic
1148859075 17:50594719-50594741 GTTATTATTAGGATTATGGGGGG + Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149261943 17:54889665-54889687 GTTTTTGTAAGGAACATGGTTGG + Intergenic
1149323874 17:55509977-55509999 TTTTTTATGAGGCATATGGAAGG + Intergenic
1151075795 17:71271085-71271107 GTTTTTTGCAGGAACATGGATGG - Intergenic
1152836813 17:82538616-82538638 GTTTTTCTGTGTATCATGTATGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155665509 18:28303455-28303477 GTTCTTTGGAGGAACATGGATGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156762710 18:40612807-40612829 ATTTCTTTGAGGATCATGAATGG + Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159594427 18:70369420-70369442 GTATATATGAGGATCCTGAAGGG + Intergenic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162797451 19:13094285-13094307 GTTTTTGTGTGGGTCCTGGAGGG - Intronic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1165648229 19:37463051-37463073 GTTTTTATGAGTAACTTGAATGG - Intronic
1168318551 19:55494790-55494812 GTTTTCTTGGGGAGCATGGAGGG - Intronic
925004612 2:431817-431839 GTTTGTATGAAAATCATGGAAGG - Intergenic
925479171 2:4251151-4251173 GTTGTTATGAGGGGCATGGTGGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929491508 2:42400614-42400636 GTTTTTATTAAGATCTTGGATGG + Intronic
929529874 2:42742969-42742991 GTTATTTTGAGGAGCATTGAAGG + Intronic
929532312 2:42760961-42760983 GTTATTATGTGGAGCAGGGAAGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931922086 2:67031144-67031166 GTTTGCATTAGGATCATGGTGGG + Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
935116776 2:100143752-100143774 GTTTGGATGAGGATAATGGAGGG - Intergenic
936673071 2:114682225-114682247 GTTTTTCTGTGTAGCATGGATGG + Intronic
937074395 2:119090505-119090527 GATATGATGAGGATCCTGGAGGG - Intergenic
937748315 2:125442388-125442410 GATATTAAAAGGATCATGGAGGG - Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939332960 2:140788331-140788353 TTATTTATCAGTATCATGGATGG + Intronic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940982351 2:160017815-160017837 ATTTTTCTAAGGGTCATGGAAGG - Intronic
941277395 2:163507387-163507409 GTTAATATGATGATCATTGATGG - Intergenic
941783997 2:169478747-169478769 GTTTTTAAGAGGATCACAGAGGG - Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943536354 2:189155392-189155414 GTTTGTATGAGGATCTGAGAAGG - Intronic
943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG + Intergenic
944079989 2:195776811-195776833 GATTCTATGAGCATCAAGGAAGG - Intronic
944412388 2:199457537-199457559 GTTGTTATGATGATGATGGGGGG + Exonic
944942907 2:204650587-204650609 GTTCTTTTTAGGAACATGGATGG + Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1170035904 20:11989530-11989552 GTTTATTTGAGGGTAATGGAGGG + Intergenic
1170125975 20:12964802-12964824 GTTTTTTTAAGGAGCATGAAGGG + Intergenic
1171061602 20:21968837-21968859 GTTTTTAATAGCAGCATGGATGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1172241708 20:33417314-33417336 CTTTTTATCAGGGCCATGGAAGG - Intronic
1175973772 20:62699988-62700010 CTCTCTCTGAGGATCATGGAGGG + Intergenic
1177227476 21:18276490-18276512 CATTCTATGAGGATCAAGGATGG + Intronic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1183163559 22:36131078-36131100 GTTTCTCAGAGGATCAGGGAGGG - Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950101298 3:10358542-10358564 CCTCTTATGAGGATCAAGGAAGG + Intronic
952157841 3:30662668-30662690 CTTTTTACTAGGATGATGGATGG + Intronic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
954874128 3:53790013-53790035 GTTTTAATGATGAAGATGGATGG - Intronic
955503872 3:59611888-59611910 GTTTTTTTCCTGATCATGGAAGG + Intergenic
958256938 3:91335745-91335767 GTTTTTTACAGGAACATGGATGG - Intergenic
958937068 3:100267256-100267278 GATTTTATGAGCTTAATGGAAGG - Intronic
959304748 3:104647756-104647778 GTCTTTGTGATTATCATGGAGGG - Intergenic
959863198 3:111238470-111238492 GTCTTTTTCAGGAACATGGATGG + Intronic
960160080 3:114340742-114340764 GTTTTAGTTTGGATCATGGAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963353826 3:144185361-144185383 GTTTTTAAAAGGATCATAAAGGG - Intergenic
963362379 3:144290905-144290927 GTTCTTTGCAGGATCATGGATGG - Intergenic
964158821 3:153621125-153621147 GTCTTTTTCAGGAACATGGATGG + Intergenic
964454057 3:156841344-156841366 GTTTTTATGAGAGTTATAGAGGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
970610108 4:17717200-17717222 GTTTTTGTGAGGATCAAATAGGG + Intronic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977425995 4:96867829-96867851 TTTTGTATAAGGATTATGGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979791649 4:124790282-124790304 GTTTTTCTAAGGATCAGGAAAGG + Intergenic
980102266 4:128553394-128553416 GCTTTGCTGAGGAACATGGAAGG - Intergenic
980504009 4:133691266-133691288 GTTTTTGTCAGGTTCATCGAAGG + Intergenic
980548642 4:134303669-134303691 GTCTTTAGCAGGAGCATGGATGG - Intergenic
980750495 4:137080577-137080599 ATTTTAAGGAGGAACATGGAGGG - Intergenic
982810815 4:159824030-159824052 GTTTTTATGGAGATCTTGAAGGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984169022 4:176338922-176338944 GTTTTGAAAAGGGTCATGGATGG + Intergenic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986937431 5:12906716-12906738 GTTTTTATGATCACCATGTAGGG - Intergenic
987229626 5:15880105-15880127 GATTTTAGAAGCATCATGGAAGG - Intronic
987452726 5:18106408-18106430 GATTTTCTGAGGTACATGGAGGG - Intergenic
988213481 5:28240737-28240759 GTTCTTATGAAGAACATAGAGGG + Intergenic
989367302 5:40670978-40671000 GCTTTTATCATTATCATGGATGG + Intergenic
989565588 5:42898216-42898238 ATTCTTATGAGGAGCATGCAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990462330 5:56040915-56040937 GTTTTGATGATGCTAATGGATGG + Intergenic
990535741 5:56720127-56720149 ATTTTTCTCAGGATCAGGGATGG - Intergenic
992172595 5:74119181-74119203 GTTTCTAAGAATATCATGGATGG - Intergenic
994545467 5:101161618-101161640 GTCTTTATCAGGAACATGGATGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996985941 5:129564590-129564612 GATTTTACGAGGATTTTGGAAGG + Intronic
997774239 5:136585242-136585264 GTGTTGAGGAGGATCAGGGATGG + Intergenic
998843963 5:146286966-146286988 GTTTTGATGAGAATGATGGAAGG + Exonic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1003237164 6:4305695-4305717 GTATTTTTCAGGAACATGGATGG + Intergenic
1004122393 6:12836976-12836998 GTTTTAAAGAGGAACATAGAGGG - Intronic
1007146268 6:39636300-39636322 GTTTTTATTATAGTCATGGAAGG - Intronic
1007803032 6:44413893-44413915 GTTTTTATTAGGAATGTGGAAGG + Intronic
1008020655 6:46574214-46574236 GTCTTTATGAAGATCCTGGAAGG + Intronic
1009186872 6:60584687-60584709 GTTTTTTACAGGAACATGGATGG + Intergenic
1012068737 6:94584108-94584130 AATTTTATGAACATCATGGAAGG - Intergenic
1012171985 6:96028043-96028065 GTTTTTATGGGAAGAATGGAAGG + Intronic
1012208691 6:96493992-96494014 GTTTTTTTCAGGAACCTGGATGG + Intergenic
1014103439 6:117537059-117537081 GGTGTTGTGAGGATCATGTAAGG + Intronic
1014507436 6:122276875-122276897 GTTCTTAAGAGTATCATGAACGG - Intergenic
1015480982 6:133709161-133709183 GTCTTTCTCAGGAACATGGATGG - Intergenic
1016380041 6:143468362-143468384 GTTATTATGATGATGATGGTAGG + Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1018375212 6:163203949-163203971 GTTTTAATTAGGATCCTGTAAGG + Intronic
1018450964 6:163907147-163907169 GTTTTAATTAAGATCTTGGATGG + Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1020316240 7:6907208-6907230 GTTTTTATGAGAATTATGCTAGG - Intergenic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021328311 7:19302112-19302134 GTATTTAGGAAGATCAGGGAAGG + Intergenic
1021490673 7:21217210-21217232 GTCTTTATGAGAAAAATGGAAGG + Intergenic
1026287280 7:68974354-68974376 GTTTTTCTGGGGCTCATGGTTGG - Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026855928 7:73754833-73754855 GTCTTTTTCAGGAACATGGATGG + Intergenic
1028078044 7:86538951-86538973 GTCTTTAGGGGGAACATGGATGG + Intergenic
1028331499 7:89600316-89600338 ATTTTTATCAGAGTCATGGAAGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030319830 7:108154040-108154062 GTTTTTATGTGGATCTTGGCAGG + Intronic
1031339364 7:120579877-120579899 GCTTTTGTTAGGATTATGGAGGG + Intronic
1032669905 7:134073315-134073337 GTTTCTATGATGAGGATGGATGG - Intergenic
1033710855 7:143942108-143942130 GTCTTTTTCAGGAACATGGATGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035584751 8:763365-763387 GTTTTTCTGATAACCATGGAGGG - Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1039466667 8:37789461-37789483 GTTTCCATGAGGATCAGGAAAGG - Intronic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040961535 8:53038719-53038741 GTTGTTAGCAGGAACATGGATGG - Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1040986448 8:53298975-53298997 GTCTTTTTCAGGAACATGGAAGG - Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042266869 8:66917263-66917285 GTTCTTATGAGGCTCTAGGAAGG + Intronic
1043337070 8:79189308-79189330 GTTTTTTGCAGGAACATGGATGG + Intergenic
1043493838 8:80778696-80778718 GTCTTTTGCAGGATCATGGATGG + Intronic
1043796648 8:84549941-84549963 GTTTTTATGAGGAACATTTGTGG + Intronic
1045412964 8:101937489-101937511 GTTTTTTGCAGGAACATGGATGG - Intronic
1045619531 8:103958242-103958264 GTCTTTAGCAGGAACATGGATGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1046895683 8:119469654-119469676 GTCTTTTGCAGGATCATGGATGG + Intergenic
1047813878 8:128441381-128441403 GTTTTTTTCAGGAACATGGTTGG + Intergenic
1048320053 8:133392265-133392287 GTTTCTATGTGTATCATAGATGG - Intergenic
1048754598 8:137723594-137723616 GTTTTTTACAGGAACATGGATGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050129039 9:2390384-2390406 TTTTTTATGGGCATCATGTAAGG + Intergenic
1050974956 9:11926310-11926332 GTTTTTGGGGGGAACATGGATGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052766114 9:32642823-32642845 GTTTTTTGCAGGAACATGGATGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057578003 9:96259393-96259415 GTTGTTGTGGGGATCATAGAAGG + Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1058446587 9:105060571-105060593 GGGTTTTTGAGGGTCATGGAGGG - Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1062260779 9:135662220-135662242 TTTCTTATGAGAATCATGGGGGG - Intergenic
1185809149 X:3088895-3088917 TTTTTTAGGGGAATCATGGAGGG + Intronic
1185949226 X:4412622-4412644 GTGTTTTTCAGGAACATGGATGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190125263 X:47699046-47699068 TTTTTTCTGAGGATTAGGGATGG - Intergenic
1190437865 X:50444594-50444616 GTTTTTTGCAGGAACATGGATGG - Intronic
1192158654 X:68766567-68766589 GTTGTTGTGAGGATTATGGGGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193468314 X:81872451-81872473 TTTTCGATGAGGACCATGGAAGG - Intergenic
1193476908 X:81977394-81977416 GTTTTTAGGAGGTTCATGAAAGG + Intergenic
1194022322 X:88707071-88707093 GTGTTTTTCAGGAACATGGATGG + Intergenic
1194434481 X:93853391-93853413 AATTTTCTTAGGATCATGGATGG + Intergenic
1194883872 X:99288386-99288408 GTTAGGATGAGGAACATGGAGGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195824006 X:108977448-108977470 GTCTTTTTCAGGAACATGGATGG - Intergenic
1196180732 X:112686999-112687021 GTTTTTTGGAGGAGCCTGGATGG - Intergenic
1196982048 X:121225276-121225298 GTTTTTAGCAGGAACATGGATGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic