ID: 983845978

View in Genome Browser
Species Human (GRCh38)
Location 4:172518470-172518492
Sequence TTTTTTTAGAATTTAGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1969
Summary {0: 1, 1: 0, 2: 10, 3: 176, 4: 1782}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983845978 Original CRISPR TTTTTTTAGAATTTAGAGAA CGG Intronic
900210459 1:1453206-1453228 TTTTGTTTGTATTTAGAGACAGG + Intronic
900680508 1:3913676-3913698 TTTTTTTTCCATTTAGGGAAAGG + Intergenic
901085602 1:6610213-6610235 CTTTTTCTGAATTTAGGGAAAGG + Intronic
901132735 1:6972416-6972438 TTTTTTTTGCATCTGGAGAAAGG + Intronic
901408570 1:9066970-9066992 TTTTTTTTTAATTTTGAGACAGG - Intronic
901423839 1:9168681-9168703 TTTTTTTATTTTTTAGAGACAGG - Intergenic
901593065 1:10362468-10362490 TTTTTTTTAAATTTTGAGACAGG - Intronic
901893577 1:12289252-12289274 TTTTTTTAAACTATAGAGACAGG + Intronic
902351514 1:15859148-15859170 TTTTTTTTTAATTAAGAGATGGG + Intronic
902592020 1:17481968-17481990 TTTTTTTGCAAATTAGGGAAAGG + Intergenic
902908234 1:19575217-19575239 ATTTTTTAAAATTTTGAGACAGG - Intergenic
903348535 1:22703566-22703588 TTTTTTTTTATTTTAGAGATAGG - Intergenic
903380282 1:22891966-22891988 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
903640980 1:24860216-24860238 TTTTTTTAGATATTAGATTATGG - Intergenic
903727873 1:25464982-25465004 TTTTTTTTTAATATAGAGACAGG + Intronic
903936913 1:26901951-26901973 TTTTTTTATTGTTTAGACAAGGG - Intronic
904189146 1:28730054-28730076 TTTTTTTAAAGTTCAGAGTATGG + Intergenic
904276261 1:29386553-29386575 TTTTTTTTAAATTTAGAGACAGG + Intergenic
904332964 1:29776790-29776812 TTTTTTTATTTTTTAGAGACAGG + Intergenic
904667467 1:32134098-32134120 TTTTTTTTGTATTTAAAAAATGG + Intronic
904886359 1:33741651-33741673 TTTTTTGAGTATTTACAGATTGG + Intronic
904886783 1:33744059-33744081 TTTTTTGAGTATTTACAGATTGG + Intronic
905121666 1:35687029-35687051 TTTTTTTTTATTTTAGAGACAGG - Intergenic
905327589 1:37168355-37168377 TGTTTTTAGAACTAAAAGAAAGG - Intergenic
906006248 1:42474141-42474163 CTTCTTTAGAATTTGGAGATTGG - Intronic
906973293 1:50542001-50542023 TTTTTATATAATTTATTGAATGG - Intronic
907032138 1:51182786-51182808 TTTTTTTAAAAAGTAGAGACTGG - Intergenic
907254779 1:53170682-53170704 TTTTTTTTTAATTAAGAGACAGG - Intergenic
907347491 1:53794872-53794894 TTTTTTAAAAATTTTGAGATGGG - Intronic
907373012 1:54015109-54015131 ATTTTTTATATTTTAGAGATAGG + Intronic
907389437 1:54148004-54148026 TTTTTTTTAAATTTTGAGACAGG - Intronic
907511070 1:54960009-54960031 TTTTTTTAGTTTTTAGTGGAAGG + Intergenic
907529152 1:55075793-55075815 TTTTTTTATTTTTTAGAGATGGG - Intronic
907813925 1:57899943-57899965 TTTTTTTATTTTTTAGAGACAGG + Intronic
907977873 1:59449790-59449812 TTTTTTTATTTTTTAGAGATGGG - Intronic
908131605 1:61081107-61081129 TCCTTTTGGAATTTTGAGAAGGG + Intronic
908137553 1:61148876-61148898 TTTTTTTCAAAATTAGAGACAGG + Intronic
908152103 1:61312683-61312705 TTTTTTTATTTTTTAGAGATGGG + Intronic
908169760 1:61492995-61493017 TTCTTTTAGGATTCAGAGACAGG - Intergenic
908202879 1:61815676-61815698 TTTTTTAAAAATATAGAGACAGG - Intronic
908232042 1:62114897-62114919 TTTTTTTTTAATTTACAGATGGG - Intronic
908233998 1:62132894-62132916 TTTTTTTTTAATTTTGAGACAGG - Intronic
908245656 1:62225929-62225951 TTTTTTTTTAATGTAGAGACAGG + Intergenic
908320291 1:62972136-62972158 TTTTTTTAAAATTGAGACAGGGG + Intergenic
908529733 1:65023106-65023128 TTTTTTTAAATTTTAGAGGTAGG + Intergenic
908934716 1:69360803-69360825 TTTTTTTAGTTTCTAGTGAAAGG - Intergenic
909097302 1:71303884-71303906 TCTTTATAGCATTGAGAGAACGG - Intergenic
909156747 1:72087765-72087787 TTTTTTTTTAATGTAGAGACAGG + Intronic
909290171 1:73873100-73873122 CTTTTTAAGAATTTATAGCAGGG + Intergenic
909318363 1:74252278-74252300 TTTTTTTCTATTTTAGAGAAGGG + Intronic
909620123 1:77658345-77658367 TTTTTTTATTTTTTAGAGACAGG + Intronic
909627306 1:77732096-77732118 TTTTTTTTTAAGTTAGAGACAGG - Intronic
909644971 1:77906825-77906847 TTTTTTTAAATTGTAGAGATGGG + Intronic
909776064 1:79486815-79486837 TTTTTTTAAAATTTACAGATAGG - Intergenic
909844256 1:80371189-80371211 CTTATTTAGAACTTAGAGATGGG + Intergenic
909893660 1:81038349-81038371 TGTTTTTAGGACTTAGTGAAGGG - Intergenic
910457580 1:87413917-87413939 TTTTTTTTTAATTTAAAGACAGG + Intergenic
910675800 1:89815458-89815480 TTTTTTTACAGTTTATTGAAGGG + Intronic
910696185 1:90018464-90018486 TATTTTAAGCATATAGAGAAAGG - Intronic
910929124 1:92424938-92424960 TTTGCTTGGAATTTAGTGAATGG + Intergenic
910947863 1:92613595-92613617 TTTTTTTTTAATTTAGAAACAGG + Intronic
911180729 1:94858113-94858135 TTTTTTTAATATTAAAAGAATGG - Intronic
911181835 1:94867848-94867870 TTCTTTTAGAATTTGAAGCATGG - Intronic
911301089 1:96175161-96175183 TTTTTTAAAAAGTCAGAGAAAGG + Intergenic
911404993 1:97426045-97426067 TTTTTTCAAAATTAAAAGAAAGG + Intronic
911489641 1:98547491-98547513 TTTTTTTAGTTTTTCGAGACAGG - Intergenic
911494835 1:98618460-98618482 TCTTCTTAGAATAAAGAGAAAGG - Intergenic
911518473 1:98898842-98898864 TTTTTTTACTATTCAGAGAAAGG + Intronic
911748460 1:101467538-101467560 TATCTTTAGAATGTAGAAAATGG + Intergenic
911928466 1:103868342-103868364 TTTTTGTAGAATCTATGGAAGGG + Intergenic
912134611 1:106645129-106645151 TATTTTTAGATTTTCGTGAAAGG + Intergenic
912407031 1:109448156-109448178 TTTTTTTCTAATCTACAGAATGG - Intergenic
912917266 1:113827808-113827830 TTTTTTTTTAAATTAGAGATGGG - Intronic
913024146 1:114819002-114819024 TTTGTTTTGTTTTTAGAGAAGGG + Intergenic
913096075 1:115516576-115516598 TTTTTTTTTAATTTATAAAAGGG + Intergenic
913232371 1:116750982-116751004 TTTTTTTTAATTTTAGAGACAGG - Intergenic
914921255 1:151848916-151848938 TTTATTTAGAATGCATAGAATGG + Intronic
915184552 1:154093610-154093632 TATTTTTATATTTTAGAGACAGG - Intronic
915223386 1:154392839-154392861 TTTTTTTATTTTTTAGAGACAGG + Intergenic
915322885 1:155065546-155065568 AATTTTTAGAATTTAGAGACAGG + Intronic
915332005 1:155118462-155118484 TTTTTTTTGAGTTTTGAGAGAGG + Intergenic
915395583 1:155581263-155581285 TTTATTTAAAATGTAGATAATGG - Intergenic
915533734 1:156521141-156521163 TTTTTTTTTAATTTAGAGATGGG - Intergenic
916255533 1:162783717-162783739 ATTTTTCAGAATTTTAAGAAAGG + Exonic
916274842 1:162982535-162982557 TTTTTTTTGAATTCAAAGATGGG + Intergenic
916570416 1:166021054-166021076 TTTTTTTACATTTTGGAGACTGG + Intergenic
917054618 1:170966769-170966791 CTATTTTAGAAGTTAGAGAAAGG - Intronic
917246884 1:173013009-173013031 TCTTTTTAGAAAATAGAGATGGG - Intergenic
917580719 1:176375249-176375271 TTTCTTTAGAAGTTGCAGAATGG + Intergenic
917611482 1:176693044-176693066 TTTTTGTAGAAAGGAGAGAAAGG + Intronic
917731056 1:177875378-177875400 TTTTTCTTGATTTTAGAGACTGG - Intergenic
917834037 1:178926578-178926600 TGTTTTTTGTATTTACAGAAGGG - Intergenic
917954525 1:180080179-180080201 TATTTTTAAAATTAAAAGAATGG + Intronic
918074845 1:181162116-181162138 TCTTTTTTGATTTCAGAGAAGGG + Intergenic
918367452 1:183823793-183823815 TTTTCTTTTAATTTAGAGACAGG + Intronic
918437547 1:184532045-184532067 TTTTTTTTTAATTTAGGGAGAGG + Intronic
918872133 1:189988771-189988793 TTTTGCTAGCATTTAGATAAAGG - Intergenic
919032971 1:192268386-192268408 TTTTTTTATGTTTTAGAGAAGGG + Intergenic
919230860 1:194772250-194772272 TTTTTTTACAATTTAATGAATGG + Intergenic
919274282 1:195392515-195392537 CTTATTTAAGATTTAGAGAAGGG + Intergenic
919571852 1:199258962-199258984 TTTTTTTGAAATTAAGAAAATGG - Intergenic
919658578 1:200221448-200221470 TTTTTTTATTTTTTAGAGATGGG + Intergenic
919722561 1:200854280-200854302 TTTTTTTAAAAATAAGAGTATGG - Intronic
920142155 1:203824261-203824283 TTTTTTTTTAATTTTGAGATGGG - Intronic
920582189 1:207120590-207120612 TTTTTTTATTCTTTAGAGATGGG - Intronic
920803462 1:209210700-209210722 TTTTCTCAGAGTCTAGAGAAAGG + Intergenic
921083288 1:211761911-211761933 TTATTTTAGGATTTAGAAGATGG - Intronic
921185624 1:212667134-212667156 TTATTTTATATTTTAGAGATGGG + Intergenic
921248225 1:213269876-213269898 TCTTTTTTAAATTTAGAGACAGG - Intronic
921320067 1:213930067-213930089 TTTTTTTAACATTTATAGATAGG - Intergenic
921329034 1:214016998-214017020 TTCTTTAAGAATGTTGAGAAAGG - Intronic
921345170 1:214176217-214176239 TTTTTTTTTATTTTAGAGACAGG + Intergenic
921441154 1:215187834-215187856 TTTTTTTAAATTTTTGAGACAGG - Intronic
921671342 1:217927226-217927248 TTTTTTTGGAATGGGGAGAAAGG - Intergenic
921689307 1:218129722-218129744 TATTTTTATTTTTTAGAGAAAGG - Intergenic
921705454 1:218317739-218317761 TTTTTTTTTAATTTAAAGACAGG + Intronic
922050214 1:221981960-221981982 TTTTTCTATGATTTAGAAAAAGG - Intergenic
922296958 1:224258966-224258988 TTTTTTTTTAATGTAGAGACAGG - Intronic
922314565 1:224432275-224432297 TATTTTTAGTATAGAGAGAAAGG - Intronic
922317277 1:224453634-224453656 TTTTTTTAATTTTTAGAGATGGG + Intronic
922330272 1:224568746-224568768 TCTTTTTATATTTTAGAGACAGG - Intronic
922521465 1:226256209-226256231 TTTTTTTAGTATGTAGAGATGGG - Intronic
922632359 1:227129267-227129289 AGTTTTAAGAATTTAGAGTATGG - Intronic
922654904 1:227373549-227373571 TTTTTTTAATTTTTAGAGACAGG + Intergenic
922688958 1:227671878-227671900 TTTTTTTACATTTTAAAAAAAGG - Intronic
922936597 1:229427462-229427484 ATTTTTTATATTTTAGAGACAGG - Intergenic
923141950 1:231167965-231167987 TTTTTTTAATATTTTGAGACAGG + Intronic
923142654 1:231174162-231174184 TTTTTTTTCTATTTAGAGACAGG + Intronic
923308836 1:232714471-232714493 TCTTTTTATATTTAAGAGAAAGG + Intergenic
923356987 1:233166968-233166990 TTTTTTTTAAATATAGAGATGGG - Intronic
923468650 1:234270360-234270382 TCTTTATAGAATTTGTAGAATGG - Intronic
923588475 1:235296875-235296897 GTTTTTTAGTATTTAGATACAGG - Intronic
923593501 1:235341158-235341180 TTTTTGTATATTTTATAGAAAGG - Intronic
923822360 1:237459277-237459299 TTTTATTATTATTTAGAGACAGG - Intronic
923860930 1:237891278-237891300 TTTTTCTAGAATTTCAAGACAGG - Intergenic
923966593 1:239147814-239147836 TTTTTTTAATATTTGGAGAGAGG + Intergenic
924179009 1:241422933-241422955 TTTTTTTTTAATATAGAGATGGG + Intergenic
924370559 1:243345108-243345130 TTGTTTTAGAATTTAGAAGTAGG + Intronic
924480069 1:244422102-244422124 TTTTTTTAGAACTTAGTGGATGG + Intronic
924919153 1:248608291-248608313 TTCTTTAAGATTTAAGAGAAAGG - Intergenic
924929740 1:248719170-248719192 CTTTTTTAGAAAATAGAGACAGG - Intronic
1062797525 10:355903-355925 TATTTTTAGTATTTAGAGATGGG - Intronic
1063022659 10:2145349-2145371 TTTTCTTTTAATTTAGAGAATGG - Intergenic
1063048755 10:2421921-2421943 TATTTTTAGATTTTAGAAGATGG + Intergenic
1063138830 10:3239093-3239115 TTTTTTTAAATTTTAGATGAAGG + Intergenic
1063429934 10:5978888-5978910 TTTTTTTAAATTTAAGAGACAGG - Intergenic
1063543494 10:6957743-6957765 TTTATTTATTATTTAGAGATGGG - Intergenic
1063576690 10:7267789-7267811 TTTTTTTATCCTTTAAAGAAGGG - Intronic
1063644365 10:7864450-7864472 TTTTTTTAAAATGTAGAGAGTGG - Intronic
1063674472 10:8128022-8128044 TTTTTTTTTTTTTTAGAGAAGGG - Intergenic
1064202118 10:13293637-13293659 TTTTTTTCCAATATAGACAATGG + Intronic
1064432003 10:15279305-15279327 GTGTTTTAGAATTCAAAGAAAGG - Intronic
1064454604 10:15475087-15475109 TTTCTTTAAAAGTTAGAGGAAGG - Intergenic
1064480677 10:15737410-15737432 TTCTTTTAGAATTTTAATAAGGG - Intergenic
1064502292 10:15986906-15986928 ATTTTTTAGAGTTTAGAAATGGG + Intergenic
1064928844 10:20601205-20601227 TATTTTTTGAACTTAGAGAACGG + Intergenic
1065169945 10:23017082-23017104 TTTTTTTACAAATAAGAGAAAGG + Intronic
1065243765 10:23736526-23736548 TTTTTAGAGATTTTAGAGATGGG + Intronic
1065288999 10:24211593-24211615 TTTTATTTTATTTTAGAGAAGGG + Intronic
1065436304 10:25706916-25706938 TTTATTTTTAATTTAGAGACAGG - Intergenic
1065509806 10:26467075-26467097 TTTTTTTTTAATATAGAGATGGG + Intronic
1065731336 10:28712415-28712437 TTTTTTTTTAATTTAGATATGGG + Intergenic
1065843724 10:29727692-29727714 TTATTGCAGAACTTAGAGAAAGG + Intronic
1065877634 10:30011077-30011099 TTTTTTTTAATTTTAGAGATGGG - Intergenic
1065888490 10:30100234-30100256 TTTATTTATAACATAGAGAAGGG + Intronic
1065896105 10:30164414-30164436 TTTATTTAGTTTTTAGAGACAGG + Intergenic
1065977104 10:30851769-30851791 GTTTTTTAGATTTTAGAGTTGGG + Intronic
1066042275 10:31561893-31561915 TTTTTTTAGATTTAATATAAAGG + Intergenic
1066214938 10:33277097-33277119 TTTTTTTTAATTTTAGAGACAGG - Intronic
1066333419 10:34449868-34449890 TTGTTTTAGAATTTAGATTACGG - Intronic
1066488448 10:35871738-35871760 TTTTTTTTTTATTTAGAGACAGG - Intergenic
1066721996 10:38349375-38349397 ATTTTTCAGAATTTTAAGAAAGG + Intergenic
1066811887 10:39349662-39349684 TTTTTGTAGAATCTGCAGAAGGG - Intergenic
1066815371 10:39402181-39402203 TTTTTTTAGAATTTACAAAGTGG + Intergenic
1067072282 10:43142086-43142108 ATTTTTTAGAAGTTAAAGCAGGG + Intronic
1067367864 10:45652128-45652150 TCTTTTTATATTTTAGAGAGTGG - Intronic
1067489295 10:46683152-46683174 TGTTTTTTAAATTTAGAGACAGG - Intergenic
1067605375 10:47657233-47657255 TGTTTTTTAAATTTAGAGACAGG + Intergenic
1067722283 10:48737440-48737462 CCTTTTTAACATTTAGAGAATGG + Intronic
1068364818 10:56033866-56033888 TTTTTTTAAAATATAGATAATGG - Intergenic
1068401157 10:56529320-56529342 TTTTTTTTTATTTTAGAGATGGG + Intergenic
1068546518 10:58352576-58352598 TTTTTTTCGATTTAAGAGATGGG - Intronic
1068893012 10:62168100-62168122 TTTTTGTACAATTTATAAAATGG + Intergenic
1069079089 10:64068921-64068943 TTTTTTTAGAATTGACTGAGAGG + Intergenic
1069125847 10:64632020-64632042 TATTTTTAGGATTAAGAAAAAGG + Intergenic
1069247409 10:66223576-66223598 TTTGTTTTGAATTTTGAAAATGG + Intronic
1069478283 10:68756814-68756836 ATTTTTTAAATTTTAGAAAATGG - Intronic
1069670949 10:70203406-70203428 TTTTTTTTTAATTTCGAGACAGG + Intronic
1069715508 10:70518613-70518635 TTTTTTTAAAATGTAAAGATGGG - Intronic
1070026930 10:72640688-72640710 TTTTTTTTAAATATAGAGATGGG - Intergenic
1070066517 10:73040230-73040252 TTTTATTGGATTTTTGAGAAAGG - Intronic
1070074748 10:73123936-73123958 CTTTTTTAAATTTTAGAGATGGG + Intronic
1070196437 10:74161535-74161557 TTTTTTTTGTTTTTAGAGACAGG + Intronic
1070201563 10:74210627-74210649 TTTTTTTAATTTTTAGAGACAGG - Intronic
1070203796 10:74235196-74235218 TTTTTTTATCTTGTAGAGAAGGG + Intronic
1070350388 10:75586361-75586383 TTTTTTTTTAAATTAGAGACAGG + Intronic
1070511747 10:77167693-77167715 TTTTTTTTTAATTTTGAGACAGG + Intronic
1070543152 10:77431822-77431844 ATTTTTTATATTTTAGAGATGGG - Intronic
1070543942 10:77438066-77438088 TTTTTTTTGTTTTTAGAGATGGG + Intronic
1070796290 10:79218833-79218855 TTTTGTCAGAACTAAGAGAAAGG + Intronic
1070903487 10:80051214-80051236 TTTTTTTTTAATGTAGAGATGGG - Intergenic
1071008790 10:80913551-80913573 TTTTTTTTATATATAGAGAAAGG - Intergenic
1071369416 10:84935900-84935922 TCTTTTTTGACTTGAGAGAAGGG + Intergenic
1071430879 10:85605737-85605759 TTTTGTTAGAGTTTGGAGAGAGG + Intronic
1071512350 10:86269997-86270019 TTTGTTTAGTATTAAGGGAAGGG - Intronic
1071620934 10:87118628-87118650 TGTTTTTTAAATTTAGAGACAGG + Intronic
1071691574 10:87825705-87825727 TTTTTTTAACTTTTAGAGACAGG + Intronic
1071864490 10:89712257-89712279 TTTTTTTAGTTTTTAGAGACAGG + Intronic
1072093231 10:92150261-92150283 TTTTTTTTTAATATAGAGATGGG + Intronic
1072313765 10:94181909-94181931 TTATTTTAAATTTTAGAGAAAGG - Intronic
1072455601 10:95572919-95572941 TTTTTTTAACATTTGAAGAAGGG - Intergenic
1072644062 10:97238209-97238231 TTTTTTTATTTTTTAGAGACGGG + Intronic
1072646677 10:97260920-97260942 TTTTTTTTAAATATAGAGATGGG - Intronic
1072686283 10:97539283-97539305 TTTTTTTCGAAGTTAGTGAAAGG - Intronic
1072974214 10:100043672-100043694 TTTTTTTTAATTTTAGAGATGGG + Intronic
1072978268 10:100078049-100078071 CTTTTTTTTAATTTAGAGACAGG + Intronic
1072984314 10:100126439-100126461 TTTTTTTTTAAATTAGAGACAGG - Intergenic
1073104218 10:101023084-101023106 TTTTTTTTTTTTTTAGAGAAGGG + Intronic
1073195258 10:101685159-101685181 TTTATCTAGATTTTAAAGAATGG - Intronic
1073258355 10:102170065-102170087 TAGTTTTGGAAATTAGAGAAGGG + Intergenic
1073355573 10:102851331-102851353 TTTTTTTTTAATTGAGACAAGGG + Intergenic
1073409456 10:103328211-103328233 TTTTTTTAGGACTTACAGACTGG + Intronic
1073469139 10:103712038-103712060 TTTTTTTTTAATTTTGAGACAGG - Intronic
1073482621 10:103796355-103796377 TTTATTTAGTTTTTAGAGACAGG - Intronic
1073588466 10:104733355-104733377 TTTTTTTATTTTTTAGAGACAGG + Intronic
1073605612 10:104892893-104892915 TTTTTTAAGGAATTACAGAAAGG - Intronic
1073720024 10:106157845-106157867 TTGTTTCAGAATTCAGAGAGAGG + Intergenic
1073737344 10:106364443-106364465 TTTCTTTAAATTTTAGAGATAGG - Intergenic
1073759862 10:106617732-106617754 TTTTTAAAGTATTTAGACAATGG + Intronic
1074074850 10:110113570-110113592 TTATTTTAGAAAATAGAGACAGG - Intronic
1074322265 10:112414126-112414148 TTTCATTAGAAATTACAGAATGG + Intronic
1074444064 10:113504060-113504082 TTTATTCAGCATTTAGAGGAAGG - Intergenic
1074785722 10:116837633-116837655 TTTCCTTAGAATTTAGAGACTGG + Intergenic
1074842220 10:117366470-117366492 TTTTTTTAAAGTTTAGAGCAGGG + Intronic
1075884613 10:125887642-125887664 TTTTTTTAAATTTTAGAAATAGG + Intronic
1075896186 10:125996916-125996938 TTTTTTTAAGATGTAGAGAGAGG + Intronic
1076293270 10:129364144-129364166 TTTTATTAGATTTTAGAGACAGG - Intergenic
1076652322 10:131998439-131998461 TATTTTTAGTTTTTAGAGACAGG + Intergenic
1076910515 10:133385967-133385989 TTTTCTTAAAATTTAATGAAGGG + Intronic
1077125601 11:934294-934316 TATATTTAAAATTTAGAGACAGG + Intronic
1077148995 11:1060174-1060196 ATTTTTTAGTTTTTAGAGATGGG - Intergenic
1077234657 11:1474157-1474179 TGTTGTTAGCAATTAGAGAAAGG - Intronic
1077768381 11:5187322-5187344 CTTTTTTAGACATTAAAGAAAGG + Intergenic
1077942521 11:6858612-6858634 TTCTTTCATGATTTAGAGAATGG - Intergenic
1078236524 11:9490176-9490198 TTTTTATTTAATTTAGAGACAGG - Intronic
1078375982 11:10793472-10793494 TTTTTTTAAATTTTTGAGACAGG + Intergenic
1078388375 11:10913064-10913086 TTTTTTTAGACTCTGGAGAATGG + Intergenic
1078613978 11:12847692-12847714 TTATTTTAGTTTTTAGAGACGGG + Intronic
1078878726 11:15425944-15425966 CTCTTTAAGAACTTAGAGAAGGG - Intergenic
1079136037 11:17776511-17776533 TTTTTTTAAACTTTGGAGCAAGG - Intronic
1079158226 11:17968696-17968718 TTTTTTTTTAAATTAGAGACAGG - Intronic
1079193524 11:18303046-18303068 TTGTTTTAGAAGTTCCAGAAAGG + Intronic
1079210934 11:18460260-18460282 TTTATTTATATTTTAGAGACAGG - Intronic
1079296587 11:19240785-19240807 TTTTTTTTAAATTTAAAAAAGGG + Intronic
1079382636 11:19951602-19951624 TCTTTTTAGAATTGAAAGACTGG - Intronic
1079532242 11:21468243-21468265 TATTCTTAGAATTTGGGGAAAGG + Intronic
1079814431 11:25038197-25038219 TTTTTAAAGAATTTAAAAAATGG - Intronic
1079996084 11:27296455-27296477 TTTTTAGAAAATTCAGAGAAAGG - Intergenic
1080520318 11:33062872-33062894 TTTTTTTAAATTTTAGAGACAGG + Intronic
1081025488 11:38008100-38008122 TTTTGTTAGACCTTAGAGCAAGG - Intergenic
1081156674 11:39701790-39701812 ATGTTTTAGATTTGAGAGAAGGG - Intergenic
1081251226 11:40837010-40837032 TTCTTTAAGAGTTTAGGGAATGG - Intronic
1081370671 11:42298317-42298339 TTTATTTAGTCTTTAGAGATAGG + Intergenic
1081404855 11:42685407-42685429 TATTTTTAGAAGGTAGAGTATGG - Intergenic
1081842446 11:46212542-46212564 TTTTTTTTAATTTTAGAGACAGG - Intergenic
1082086567 11:48055178-48055200 TTTTTTTTTTATTTAGAGATGGG - Intronic
1082201263 11:49371749-49371771 TTGTTTTAGAAATTACAGAATGG + Intergenic
1082265731 11:50115989-50116011 TTTTTGTAGAATTTGCAAAATGG - Intergenic
1082290357 11:50362581-50362603 TTTTTGTAGAATTTGCAAAATGG + Intergenic
1082297777 11:50463984-50464006 TGTTTTTGGAATTCAAAGAAAGG - Intergenic
1082633260 11:55565658-55565680 TTTTTGTACAATTTAAATAAAGG + Intergenic
1082893258 11:58162997-58163019 TTTGTTTGGAATTTACAGAGGGG + Intronic
1083251764 11:61472578-61472600 TTTTTTTTTTTTTTAGAGAAAGG - Intronic
1083553391 11:63607486-63607508 ATTTTTTAAATTTTAGAGATGGG - Intronic
1084017201 11:66391410-66391432 CTTTTTTTAAATTTAGAGACAGG - Intergenic
1084049369 11:66589554-66589576 TTTTTTTCAATTTTAGAGATGGG - Intergenic
1084140754 11:67226931-67226953 TTTTTTTAACTTTTAGAGACAGG - Intronic
1084343496 11:68526259-68526281 TTTTTTTTAAATTTTGAGACAGG + Intronic
1084351860 11:68607402-68607424 TTGTTTTAGAATGTAGATTAGGG - Intronic
1084457461 11:69276535-69276557 TCTTTTTTAAATTTAGAGATAGG + Intergenic
1084619035 11:70256024-70256046 TTTTTTTAGTATGTATAGAGAGG - Intergenic
1084988562 11:72901027-72901049 TTTTTTAAAAATTTAAATAATGG + Intronic
1085103694 11:73823667-73823689 TTTTTTTTTAATTTAGAGACAGG + Intronic
1085141169 11:74143356-74143378 TATTTTTTAAATTTAGAGACAGG + Intronic
1085468718 11:76742543-76742565 TTTTTTTAAATTTTAGAGACAGG - Intergenic
1085526808 11:77168791-77168813 TTTTTTTAAATTTTAGAGACAGG - Intronic
1085531879 11:77196790-77196812 TTTTTATAGAATGTAGACACAGG - Intronic
1085615847 11:77997825-77997847 TTTTTTTAAAATATAGAGACAGG - Intergenic
1085663437 11:78391283-78391305 TTATTTTTTAATTTAGAGACAGG - Intronic
1085704656 11:78775787-78775809 TAATTTTAAAGTTTAGAGAAGGG + Intronic
1085809746 11:79669168-79669190 TTTTTTAAAAATTTATACAAGGG - Intergenic
1086359729 11:86045505-86045527 TTTTTTTTGAATTTCAAGACAGG - Intronic
1086654417 11:89334489-89334511 TTGTTTTAGAAGTTACAGAATGG - Intronic
1087189873 11:95242396-95242418 TTTTGTTCCAAGTTAGAGAACGG + Intergenic
1087409484 11:97773849-97773871 TTCTCTTAGAATTCAAAGAAAGG + Intergenic
1087456715 11:98395973-98395995 TTTTTTCAGAATATAGATATGGG + Intergenic
1087456993 11:98399105-98399127 TTTTTTCAGAATGTAGATATGGG + Intergenic
1087493208 11:98854658-98854680 TTTTTTCTGATGTTAGAGAAAGG - Intergenic
1087764414 11:102134712-102134734 TTTTTTTAAATTTGAGAGATAGG + Intronic
1088093577 11:106073271-106073293 TTTTTTTTTAATTTAGAGATGGG + Intronic
1088173324 11:107020355-107020377 TTTCATTATAATTTAGAAAAAGG - Intergenic
1088201812 11:107344783-107344805 TATTTTGAGAATTAAGAGACTGG + Intronic
1088245644 11:107815376-107815398 TTTTTTTTTATTTTAGAGATGGG - Intronic
1088381568 11:109199073-109199095 TTTTTTTTTAATGGAGAGAATGG - Intergenic
1088671018 11:112140685-112140707 TTTTTTTTAATTGTAGAGAAGGG - Intronic
1088681951 11:112251270-112251292 TTTTTTTTTAATTTACAAAAAGG - Intronic
1089251110 11:117162591-117162613 TTTTTTTTAAATCTAGAGACAGG - Intronic
1089536644 11:119164545-119164567 ATTTTTTAAAATGTAGAGATGGG + Intergenic
1089637634 11:119826313-119826335 TTTTTTTAATTTTTAGAGACAGG + Intergenic
1089666706 11:120025250-120025272 TATTTTTAAATTTTAGAGACAGG - Intergenic
1089991075 11:122860707-122860729 CTTTTTTAAAATTTTGAGACAGG + Intronic
1090031520 11:123210599-123210621 TTTTTTTTAAATTTAAAGATGGG + Intergenic
1090718351 11:129450652-129450674 ATTTTTTAGAATTTAGCCTAAGG + Intronic
1090820785 11:130339544-130339566 TGTTTTTAAACTTTAGAGACAGG + Intergenic
1090910959 11:131118862-131118884 TCTTTTTAAAATGTAGAGAAGGG + Intergenic
1091469511 12:714631-714653 TTTATTTATAATTTTGAGACAGG - Intergenic
1091472005 12:736872-736894 TTTTTTTTAATTTTAGAGATGGG - Intergenic
1092158057 12:6297437-6297459 TTGTTTTTTAATTTAGAGATAGG + Intergenic
1092187378 12:6490817-6490839 GTTTTTTAAAATATAGAGATGGG + Intergenic
1092418202 12:8308316-8308338 TTTTCTTAGAAATTGGGGAAGGG - Intergenic
1092822769 12:12368614-12368636 TTTTTTTTTAATTTAGAGATGGG + Intronic
1092871269 12:12807807-12807829 TTTTTTTAGTTTTTAGAAACAGG - Intronic
1092895494 12:13006561-13006583 CTTTTTTTAAATTTAGAGACAGG + Intergenic
1092990583 12:13894054-13894076 TTTATTTAGATTTTAGAGGGGGG + Intronic
1093084721 12:14853940-14853962 TTTTTTTCAAATTTAAATAAAGG + Intronic
1093399472 12:18727170-18727192 TTTTTTTTACATTTAGAGACAGG - Intronic
1094072803 12:26437207-26437229 AGTTTTTAAAAGTTAGAGAATGG - Intronic
1094200885 12:27793534-27793556 TTTTTTTTTATTTTAGAGACTGG - Intronic
1094248770 12:28334661-28334683 TTTTTTTATACTTTAGAAAATGG + Intronic
1094286382 12:28798892-28798914 TTTTTTTAATTTTTAGAGACAGG - Intergenic
1094445941 12:30530360-30530382 TTTTTTTGGTATTTGGAAAATGG - Intergenic
1094605716 12:31947300-31947322 TATTTTAAGAATTTATAGGATGG - Intergenic
1094652741 12:32393467-32393489 TATTTTTAATTTTTAGAGAAAGG - Intergenic
1095076317 12:37931549-37931571 TTTTTGTAGAAATCTGAGAAGGG - Intergenic
1095092816 12:38122648-38122670 TTATTTTATATTTTAGAGACAGG - Intergenic
1095271118 12:40220762-40220784 TTTTTTTTTAGTTTAGAGACAGG + Intronic
1095390388 12:41699045-41699067 TTTTTATAGAATTGGGACAATGG + Intergenic
1095506874 12:42907649-42907671 TTTTTTTTCATTTTAGAGACTGG + Intergenic
1095560659 12:43561497-43561519 TTTTTTTAAAAATTAATGAAGGG + Intergenic
1096061620 12:48705442-48705464 TTTTTTTTAAATATAGAGACAGG + Intronic
1096160641 12:49374074-49374096 TTTTTTTATTGTTTAGAGACAGG - Intronic
1096338342 12:50775110-50775132 TTTTTTTTTAATTGAGATAATGG + Intronic
1096859551 12:54515052-54515074 TTTTTTTATAAATGAGAAAATGG + Intronic
1096903349 12:54908412-54908434 TATTTGTGGAATTTAGAGCATGG + Intergenic
1097043297 12:56169356-56169378 ATTTTTTAAAGCTTAGAGAAGGG + Intronic
1097364673 12:58699072-58699094 TTTTTTTATAAGTGAGAGAGTGG + Intronic
1097446888 12:59682556-59682578 TTAATTGAGAATTTAGAGAAGGG + Intronic
1097679235 12:62633245-62633267 TTTTTATGGAAGTTACAGAAAGG - Intergenic
1097780729 12:63701563-63701585 TTTTTTTTCAAATTATAGAAGGG - Intergenic
1097850082 12:64403043-64403065 TTTTTCTTGTTTTTAGAGAAAGG - Intergenic
1097884060 12:64711411-64711433 TTTCTCTAGTATTTAGACAAAGG + Intergenic
1097952896 12:65452445-65452467 TCTCTTCAGAATTTAGAAAATGG + Intronic
1098028580 12:66231339-66231361 TTTTTTTTTAAAGTAGAGAATGG - Intronic
1098068717 12:66648398-66648420 TTTTGTTGGAACTTAGAGAAGGG - Intronic
1098167950 12:67717588-67717610 TTTTTTTAGTTTTTTGAGACAGG - Intergenic
1098308236 12:69122517-69122539 ATATTTTAGAATTTAGCAAAGGG - Intergenic
1098336865 12:69413340-69413362 TTTTTTTTTCATTTAGAGACAGG - Intergenic
1098484801 12:71008421-71008443 TTTCTTTTGAAATTAAAGAATGG + Intergenic
1098984739 12:76999963-76999985 ATCTTGTAGAAATTAGAGAAGGG + Intergenic
1098993107 12:77087825-77087847 TTTCTTTGGAGTTTAGGGAATGG - Intergenic
1099272798 12:80533114-80533136 TTATTAAAGAATTTAGATAAGGG - Intronic
1099322890 12:81173607-81173629 TTTTTTCTTAATTTAGAAAAAGG - Intronic
1099869163 12:88324789-88324811 TTTTTTAAGCCTATAGAGAAAGG + Intergenic
1099962854 12:89413209-89413231 CTTTTTTAAAATTTAGAAACAGG + Intergenic
1100139264 12:91596641-91596663 TTTTTTTTTTTTTTAGAGAAGGG - Intergenic
1100181775 12:92093953-92093975 TTTTTTTAAATTTTAGAGACAGG + Intronic
1100231343 12:92611389-92611411 TTTTTTTTGTATTTTAAGAAAGG - Intergenic
1100317368 12:93457224-93457246 TTTTTTTTTAATGTAGAGATGGG - Intergenic
1100484790 12:95014879-95014901 TTTTTTCAAATTTTAGAGACAGG + Intergenic
1100620094 12:96262823-96262845 TTTTTTTTAAATTTAGAGACGGG + Intronic
1100641504 12:96485899-96485921 TTTTTTTAAAAATCAGAGACAGG + Intergenic
1100675896 12:96867272-96867294 TTTTTTTTAAATAAAGAGAAAGG - Intronic
1100899806 12:99225147-99225169 TTTCATTAGAATTCAGGGAAAGG - Intronic
1101152578 12:101896590-101896612 TTTTTTTATTTTTTAGAGACAGG - Intronic
1101282811 12:103276957-103276979 TATTTTTAAAAATTAGAGAAGGG + Intronic
1101368396 12:104099603-104099625 TTTTTTTTAAATTTAGAGATAGG - Intronic
1101392246 12:104312141-104312163 TTTTTTTATATTGGAGAGAAGGG - Intronic
1101766478 12:107704888-107704910 TTTTTTTTTAAATAAGAGAACGG + Intronic
1101810229 12:108101660-108101682 TTTTTTTATTTTTCAGAGAAAGG + Intergenic
1101904299 12:108813700-108813722 TTTTTTTTTAATTTGGAGACAGG - Intronic
1102008410 12:109603329-109603351 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
1102368400 12:112359876-112359898 TTTTGTTAAAATGTAGAGTAAGG - Intronic
1102643169 12:114384279-114384301 TTTTTTTAATATTTGGAGACAGG + Intronic
1103217219 12:119211296-119211318 TATTTTTAGTAAGTAGAGAAGGG + Intronic
1103397037 12:120615807-120615829 TTTTTTTTTATTTTAGAGATGGG - Intergenic
1103603485 12:122069450-122069472 CTTTTTTAAAATTTAGAGATAGG - Intergenic
1103660506 12:122511683-122511705 TTTTATTAGATTACAGAGAATGG - Intronic
1103749204 12:123147992-123148014 TTCTTTTAGAATTTAGGGCCAGG - Intronic
1103813157 12:123632096-123632118 TTTTTTTGTATTTTAGAGACAGG - Intronic
1104450290 12:128863547-128863569 TTTTTTTAGTAAATAGAGACGGG + Intronic
1105341570 13:19530941-19530963 TTTTTTAAAAGTTCAGAGAATGG - Intronic
1105343975 13:19556695-19556717 TTTTTCTATTTTTTAGAGAAAGG + Intergenic
1105371771 13:19808152-19808174 TTTTTTTTAAATTTAGACATAGG + Intergenic
1105377390 13:19858188-19858210 TTTTTTTAATTTTTAGAGACAGG - Intronic
1105429470 13:20324180-20324202 TTTTTTTGGATTTTAGTGGAGGG + Intergenic
1105487733 13:20853483-20853505 TTTTTTTAAATTTAAGAGACAGG - Intronic
1105536062 13:21264894-21264916 TTTTTCTATTTTTTAGAGAAAGG - Intergenic
1105694967 13:22879111-22879133 TTTTTTTTAAATTTAGAGACAGG + Intergenic
1105895342 13:24712504-24712526 TTTTTCTAGAATGAAGAGCATGG + Intergenic
1105987310 13:25580530-25580552 TTTTTTTTAAATATAGAGACAGG + Intronic
1106048720 13:26169735-26169757 TAATTTTAGAATTTGGAGTAAGG - Intronic
1106278260 13:28236385-28236407 TTTTTTAAAAATATAGATAAAGG - Intronic
1106401058 13:29431555-29431577 TGTTTCTGGAATTTAGTGAAAGG + Intronic
1106516491 13:30459337-30459359 TTTTTTTAAGATGTTGAGAATGG - Exonic
1107030466 13:35847031-35847053 TTTTTTTAGAGTATAGTGATTGG + Intronic
1107134881 13:36933011-36933033 TTTTTTTTTTTTTTAGAGAAGGG - Intergenic
1107205701 13:37784317-37784339 TTTATTTAGAAGTTAAAGTAAGG + Intronic
1107412192 13:40168285-40168307 TGTTTTTTAAATTTAGAGATGGG + Intergenic
1107458203 13:40575161-40575183 TTTTTTTTTAATGTAGAGACAGG - Intronic
1107477474 13:40752908-40752930 TTTTTCTATTTTTTAGAGAAAGG + Intronic
1107629088 13:42325096-42325118 TTTTTTAAGTATGTGGAGAAGGG + Intergenic
1107973853 13:45670573-45670595 TTTTTTTACAATGCAAAGAATGG + Intergenic
1108009273 13:45987437-45987459 TCTTATTAAAATTTATAGAAAGG + Intronic
1108331844 13:49394299-49394321 TTTTTTTTTATTATAGAGAATGG - Intronic
1108557848 13:51613201-51613223 TTTTTTTATTTTTTAGAGACAGG - Intronic
1108618038 13:52154949-52154971 CTTTTTTAAAATTTATAGATGGG - Intronic
1108953502 13:56120201-56120223 TTTTTTTAGAACTTCGTTAAAGG - Intergenic
1109040133 13:57323477-57323499 TTTTGTTAGAATTTAGGCATGGG + Intergenic
1109137203 13:58668035-58668057 TTTTTTTAAAAGTCAGAAAATGG - Intergenic
1109344343 13:61096781-61096803 TTTCTTTAGAAATTAGAGTGGGG + Intergenic
1109507864 13:63330755-63330777 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1109523070 13:63537366-63537388 TTATTTTAGGGTTTAGAGTATGG - Intergenic
1109673882 13:65647195-65647217 TTTTTTTAAAAGATACAGAATGG + Intergenic
1109690959 13:65888062-65888084 TCTTTTAAGAATTTGGAGAATGG + Intergenic
1109739341 13:66531660-66531682 CATTTTAAGTATTTAGAGAATGG - Intronic
1109745585 13:66619319-66619341 TTTTATTAGTCTTTAGAAAATGG + Intronic
1109881238 13:68480112-68480134 TTATTTGAGAAATTAGGGAAAGG + Intergenic
1109889775 13:68595292-68595314 TTTATGTAAAATTTAGAAAAAGG + Intergenic
1109927639 13:69167262-69167284 TATTTGTAGAATTTAGATAGTGG - Intergenic
1109998142 13:70157153-70157175 TTATTTTAAAATTTAGAAACTGG + Intergenic
1110020568 13:70464156-70464178 TCTATTTAGAATGTAGATAATGG + Intergenic
1110197679 13:72809311-72809333 TATATTTAGAACTTGGAGAATGG + Intronic
1110327550 13:74234855-74234877 TTTATTTAAAATTTATAAAAAGG + Intergenic
1110438366 13:75500215-75500237 TTTTTTTTAAATTGAGTGAAAGG - Intergenic
1110808463 13:79786289-79786311 TTTTTTTACAGTTCAGAGATAGG + Intergenic
1110975089 13:81821487-81821509 ATTTTTAAGAATTTAGAAAATGG - Intergenic
1111174379 13:84574267-84574289 TCTTTCTTGAATTTAGATAATGG - Intergenic
1111184057 13:84706017-84706039 TTTTATTACAAGTTAGAGTATGG + Intergenic
1111277515 13:85968985-85969007 TTTTTTAAGAATTTATAGTGAGG - Intergenic
1111316902 13:86575269-86575291 TTTTATTAGTATTTATAGCATGG - Intergenic
1111323286 13:86658877-86658899 TTTATATAGAAAATAGAGAAGGG - Intergenic
1111528175 13:89501212-89501234 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
1111893618 13:94114145-94114167 TTTTTTTTTAATTTAGAAAATGG - Intronic
1111905051 13:94245566-94245588 TTTTTTTATTTTTTAGAGACAGG - Intronic
1111925892 13:94463140-94463162 TTCTTTTTTAATTTAGAGATAGG + Intronic
1111936246 13:94559818-94559840 TATTTTTATACTTAAGAGAATGG - Intergenic
1112270834 13:97967957-97967979 ATTTTTTTCAATATAGAGAAGGG + Intronic
1112280545 13:98059296-98059318 TTATTTTAGAGGTGAGAGAACGG + Intergenic
1112288518 13:98124915-98124937 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1112424727 13:99287430-99287452 TTTTTTTTAAATTTTGAGACAGG + Intronic
1112500795 13:99941614-99941636 GTTTTTTAGTTTTTAGAGACAGG + Intergenic
1112528583 13:100178506-100178528 GTTTTTAAGAATTTTGAGAGTGG + Intronic
1112535167 13:100246911-100246933 TTTTTTTTTAATTAAGACAATGG + Intronic
1112842260 13:103594700-103594722 TATTTTTAGACTTCAGGGAAGGG + Intergenic
1113124792 13:106965308-106965330 TATTTTTTAAATTTAAAGAATGG + Intergenic
1113211165 13:107983172-107983194 TTGATTTTGAATGTAGAGAAAGG + Intergenic
1113271293 13:108677555-108677577 TTTTTGTATATTTTAGGGAAGGG + Intronic
1113571980 13:111364562-111364584 TTTTTTAAGAAATAAGTGAATGG + Intergenic
1114230500 14:20777196-20777218 TTTTTTTAAAAAATAGAGATGGG + Intergenic
1114232741 14:20798918-20798940 ATTTTTTAAAATTTTGAGACAGG + Intergenic
1114798535 14:25743952-25743974 ATTTTTTTTAATATAGAGAAGGG + Intergenic
1115106030 14:29763111-29763133 TTTTTTTTAATTTTAGAGACAGG - Intronic
1115213523 14:30991912-30991934 TTTTTTTAAAGAATAGAGAAGGG - Intronic
1115273488 14:31580607-31580629 ATTTTTTATATTTTAGAGATGGG - Intronic
1115553653 14:34526864-34526886 TTTTTTTTTAATTTAAAGACAGG - Intronic
1115590879 14:34863992-34864014 TTTTTTGAGAGTGTAGAGATGGG + Intronic
1115619828 14:35130809-35130831 TTTTTTTTAAATATAGAGACAGG + Intronic
1115626907 14:35202633-35202655 TTTTTTTATTTTTTAGAGACAGG + Intronic
1116259137 14:42600685-42600707 TTTTCTTAGAATTATGACAATGG - Intergenic
1116390861 14:44387615-44387637 TTTTTTTTTAATGTAGAGATGGG + Intergenic
1116463739 14:45208718-45208740 TATTTTTAGTATTTAGTGCAGGG - Intronic
1116937051 14:50751568-50751590 TTATTTTATTATTTAGAGATAGG + Intronic
1117163384 14:53010903-53010925 AATTTTTAGAATTTAGAGAATGG + Intergenic
1117355789 14:54922594-54922616 TCTTTTTTTAATATAGAGAAAGG - Intergenic
1117360070 14:54964100-54964122 TTTTTGTATTTTTTAGAGAAAGG - Intronic
1117475872 14:56094628-56094650 TTTGTTCACAAATTAGAGAAGGG + Intergenic
1117637778 14:57764297-57764319 TTTTTTTAGAACCTACAGCAAGG - Intronic
1117683640 14:58230928-58230950 TTTTTGTATTATTTAGAGACAGG + Intronic
1117886892 14:60373054-60373076 TTTTTATAGAAATGTGAGAATGG + Intergenic
1118038989 14:61897552-61897574 TTTTTTCAGAATAAGGAGAATGG + Intergenic
1118242981 14:64079712-64079734 TTTTTTTAAATTTTTGAGATAGG + Intronic
1118575403 14:67237491-67237513 TTTTTTTAATTTTTAGAGAAGGG + Intergenic
1118648381 14:67863640-67863662 TTTTTTTAACATTGAGAGGAAGG - Intronic
1118671738 14:68135901-68135923 TTTTTATAGAATATGGTGAACGG - Intronic
1118992033 14:70805919-70805941 TTTTTTTAATTTTTAGAGACAGG - Intronic
1119056928 14:71432077-71432099 TTTTTTTTAATTTTTGAGAAAGG + Intronic
1119071289 14:71587362-71587384 TTTTTTTAGAATATAAATTATGG + Intronic
1119279782 14:73396036-73396058 TTTTTTTATTTTTTAGAGACAGG + Intronic
1119356775 14:74013917-74013939 TTTTTTTAAAAAATAGAGACAGG + Intronic
1119547702 14:75484634-75484656 TTTTTTTAAAAAATAGAGACAGG - Intergenic
1119580684 14:75777073-75777095 TTTTTTCATCATTTAGAGACAGG - Intronic
1119734008 14:76969577-76969599 TTTTTTTTAAATGTAGAGACAGG - Intergenic
1120118417 14:80648338-80648360 TTTTGGTAGAATATTGAGAAAGG + Intronic
1120254432 14:82100873-82100895 TATATTTAAAATTAAGAGAATGG + Intergenic
1120292827 14:82598419-82598441 TTTTTTTAGAATCTCTTGAATGG - Intergenic
1120401241 14:84034738-84034760 TTTTTTTTTAATTGAGACAAAGG - Intergenic
1120653081 14:87158194-87158216 TATTTATAGAATTTAAAGATTGG - Intergenic
1120992499 14:90390214-90390236 CTTTTTTAAAATTTCTAGAATGG + Intergenic
1121136194 14:91501024-91501046 TGTTTTTAAATTTTAGAGACAGG - Intronic
1121374728 14:93397886-93397908 GTTTTTTAAAATTTTGAGACAGG - Intronic
1121590778 14:95106755-95106777 TTTTATAAAAATTTAGGGAATGG - Intronic
1121649445 14:95546940-95546962 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1121747692 14:96312744-96312766 TTTTTTTATTTTTTAGAGACAGG - Intronic
1121807297 14:96840272-96840294 TATTTTCAGAAATTAGACAATGG - Intronic
1122068124 14:99187859-99187881 TTTTTTGTGGATTTAAAGAAAGG - Intronic
1122332964 14:100938594-100938616 TTTTTTTTTAATTAAGAAAAGGG + Intergenic
1122447135 14:101777939-101777961 TTTTTTTTTAATGTAGAAAAGGG + Intronic
1122469903 14:101959383-101959405 TTTTTTTAAAAAATAGAGACAGG + Intergenic
1122538991 14:102486288-102486310 TTTTTTTTTAATTTGAAGAATGG - Intronic
1123159635 14:106265498-106265520 TTTTTTAAAAAGTTAGAGAACGG - Intergenic
1123173244 14:106393855-106393877 TTTTTGAAAAAGTTAGAGAATGG - Intergenic
1202894321 14_KI270722v1_random:189594-189616 TTTTTATAGCAATGAGAGAACGG - Intergenic
1123496920 15:20835852-20835874 GTTTTTTGTAATTCAGAGAAAGG - Intronic
1123554154 15:21409444-21409466 GTTTTTTGTAATTCAGAGAAAGG - Intronic
1123590399 15:21846809-21846831 GTTTTTTGTAATTCAGAGAAAGG - Intergenic
1123960962 15:25399747-25399769 TTTTTTTTAATTTTAGAGACAGG + Intronic
1123989614 15:25673746-25673768 TTTTCTTTGCATTTAAAGAAGGG + Intergenic
1124859458 15:33424619-33424641 TTTTTATAGGCTTCAGAGAAAGG - Intronic
1125168531 15:36739397-36739419 TTTGTTTTGCATTTAGAGACAGG - Intronic
1125572485 15:40731535-40731557 TTAATTTAGAAGTGAGAGAAGGG - Exonic
1125959701 15:43819311-43819333 ATTTTTTAAAAGGTAGAGAAAGG + Intronic
1125980948 15:44000817-44000839 CTTTTTTAGTATTTGGAGATAGG + Intronic
1126007702 15:44274112-44274134 TTTTTTTTGTATTTTGAGATGGG + Intergenic
1126014725 15:44339638-44339660 TCTTTTTAAAATTTTGAGACAGG + Intronic
1126059204 15:44762743-44762765 TTTTTCAAGAATGTAGAGGAAGG - Intronic
1126108924 15:45164472-45164494 TTTTTTTTTAATTTAAAGAAAGG + Intronic
1126504653 15:49390794-49390816 TTTTGTTAGTATTAAAAGAATGG - Intronic
1126516281 15:49541928-49541950 TGATTTTAGAATTTAAAAAATGG - Intronic
1126644551 15:50861815-50861837 TTTTTTTTAATTTTAGAGACAGG + Intergenic
1126647672 15:50891440-50891462 TTTTTTTTAATTTTAGAGACAGG + Intergenic
1126909185 15:53400305-53400327 TTGTTTTAAAAATTAGACAAAGG + Intergenic
1127125896 15:55811827-55811849 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1127127843 15:55830703-55830725 TTTATTTATATTTTAGAGATGGG + Intronic
1127134782 15:55908717-55908739 TTTATTAAGGAATTAGAGAATGG - Intronic
1127413091 15:58729184-58729206 TTTTTTTAAAAAATAGAGACAGG - Intronic
1127413673 15:58734692-58734714 TTTTTTTTTAATTTTGAGACAGG - Intronic
1127415996 15:58757622-58757644 TTTTTTTTTAATTTTGAGACAGG - Intergenic
1127529252 15:59827055-59827077 TTTTTTTAAATTTTTGAGACAGG - Intergenic
1127622373 15:60746298-60746320 TTTTTTTTTAATTTAATGAATGG + Intronic
1127648490 15:60982845-60982867 TTTTTCTAGCTTTTATAGAAGGG + Intronic
1127678198 15:61265293-61265315 TTTTTTTTTATTTTAGAGACAGG + Intergenic
1127680835 15:61296396-61296418 TTTTATTAGAATTTAAAAACAGG - Intergenic
1127956372 15:63857382-63857404 TTTTCTTTGAATGTACAGAAAGG - Intergenic
1128280308 15:66388523-66388545 TTTTCTAAAAATCTAGAGAAAGG - Intronic
1128281024 15:66394620-66394642 TAATTTTAAAATTTAGAGATAGG + Intronic
1128613069 15:69089229-69089251 TTTTTTTAGTTTTTGGAGACAGG - Intergenic
1128642586 15:69350635-69350657 TTTTTTTATTTTTTTGAGAAAGG - Intronic
1128813791 15:70590812-70590834 TTATTTTGGAAGTTAGAAAAGGG - Intergenic
1128998117 15:72311781-72311803 CCTTTTTATAATTTACAGAAAGG - Intronic
1129081854 15:73048335-73048357 TTTTTTTTTAATGTAGAGACCGG + Intergenic
1129551705 15:76457680-76457702 TATTATTATAATATAGAGAATGG - Intronic
1129663957 15:77568901-77568923 TTTTTTTATTATTTTGAAAAGGG + Intergenic
1129833374 15:78685269-78685291 TTGTTTTTGAAACTAGAGAATGG + Intronic
1130016378 15:80189681-80189703 TTGTTTTTTAATTTTGAGAAAGG + Intergenic
1130065546 15:80600666-80600688 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
1130236834 15:82143080-82143102 TTTTTTCAGAATTTAGGAAAGGG + Intronic
1130262697 15:82370742-82370764 TACTTTTAGAATTCAGAGCAAGG + Intergenic
1130278530 15:82498199-82498221 TACTTTTAGAATTCAGAGCAAGG - Intergenic
1130537192 15:84795163-84795185 TTTATTAATAATTTGGAGAATGG + Intronic
1130581301 15:85139442-85139464 TTTCTTTATGATTTAGAGACAGG - Intergenic
1130719112 15:86369195-86369217 TTTTATGAGAAATTACAGAAAGG + Intronic
1130924266 15:88373535-88373557 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1130935245 15:88464668-88464690 ATTTTGTGGAATTTAGAGGAAGG + Intronic
1131031400 15:89188870-89188892 TTTTTTTTTAATTTTGAGAAGGG - Intronic
1131499380 15:92946924-92946946 TTTTTTTTTTTTTTAGAGAACGG - Intronic
1131714410 15:95092733-95092755 TTTTTTTAATATTTAGAAATAGG - Intergenic
1202962501 15_KI270727v1_random:136640-136662 GTTTTTTGTAATTCAGAGAAAGG - Intergenic
1132729348 16:1353527-1353549 TTTTTTTATTTTTTAGAGACGGG + Intronic
1132753118 16:1468075-1468097 TTTTTTTTAATTTTAGAGATAGG - Intronic
1132820361 16:1864144-1864166 TTTTTTTAAAAATTTGAGATAGG - Intronic
1132955389 16:2589681-2589703 TTTTTTTCCAATTTTGAGACAGG - Intronic
1133101066 16:3480293-3480315 TTTCTTTAAAAGTTAGAGAAGGG + Intronic
1133274755 16:4630820-4630842 TTTTTTTTTAATTTTGAGATAGG + Intronic
1133357564 16:5147920-5147942 TTTTTTTAGAGATTCGGGAAGGG - Intergenic
1134176294 16:12009116-12009138 TTATTTTAAAATTTAAAAAATGG - Intronic
1134562460 16:15222335-15222357 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1134592305 16:15464449-15464471 TTTTTTAAAAAATTAGAGACAGG - Intronic
1134758579 16:16692810-16692832 TTTTTTTTTAAATAAGAGAAGGG + Intergenic
1134777667 16:16867093-16867115 TTTTTTTATTTTTTAGAGATGGG - Intergenic
1134923002 16:18133962-18133984 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1134924684 16:18148758-18148780 TTTTTTTAGTATTTTGTGTATGG - Intergenic
1134987493 16:18666371-18666393 TTTTTTTTTAAATAAGAGAAGGG - Intergenic
1135061006 16:19271431-19271453 TTTTTTTTAAATTTTGAGACAGG + Intergenic
1135141012 16:19921994-19922016 TTTTTTTTGTCTTTAGAGACTGG + Intergenic
1135189088 16:20340196-20340218 TGTTTTTAATATTTTGAGAATGG - Intronic
1135194315 16:20381902-20381924 TTATTTTAAAATTTAGAGACAGG + Intronic
1135262553 16:20993687-20993709 TTTTTTTAAATTTTTGAGACAGG + Intronic
1135357256 16:21779856-21779878 TTTTTTTCAAAATTAGAGATGGG + Intergenic
1135405306 16:22193430-22193452 TTTTTTTAAATTTTAAAGATGGG - Intergenic
1135414715 16:22260335-22260357 TTTTTTTAAGCTTTAAAGAAAGG - Intronic
1135431164 16:22384633-22384655 TTTTTTTTAATTTTAGAGATAGG + Intronic
1135433521 16:22408297-22408319 TTTTTTTTTAATTTAGAGACAGG + Intronic
1135477355 16:22788613-22788635 TTTTTTTAAAATTTAGAGACAGG - Intergenic
1135498223 16:22971105-22971127 TATTTTAAGAATTTTCAGAATGG - Intergenic
1135542217 16:23339417-23339439 TTTTTTTTAAATATAGAGACAGG + Intronic
1135650787 16:24204701-24204723 GTTTTTTAGTTTTTAGACAAAGG - Intronic
1135688998 16:24521293-24521315 TTTATTTAGAATGCAGAGATTGG - Intergenic
1135696718 16:24594337-24594359 TTTTTTTAGAATTTGAGAAATGG - Intergenic
1135789781 16:25383242-25383264 TTTTTTAATTTTTTAGAGAAAGG + Intergenic
1135798990 16:25474948-25474970 TTTTTTTTCATTTTAGAGACAGG + Intergenic
1135887166 16:26320697-26320719 TTATTTTATATTTTAGAGACAGG - Intergenic
1135995321 16:27243654-27243676 TTATTTTATATTTTAGAGATGGG + Intronic
1136174768 16:28508992-28509014 TTTTTTTTTTAATTAGAGAAGGG - Intronic
1136469457 16:30469550-30469572 TTTTTTTAAATTTTTGAGACAGG - Intergenic
1136489043 16:30593355-30593377 TCTTTTTTTAATTTAGAGATGGG - Intergenic
1137072712 16:35919600-35919622 TTTTTATAGAATCTAAAAAAAGG - Intergenic
1137316437 16:47328846-47328868 TATTTTTAGAATTCAGATTATGG - Intronic
1137469977 16:48745478-48745500 TTTTTTTAGAAAATGGAGGAAGG + Intergenic
1137631691 16:49950861-49950883 TTTTTTTGTAAATTAGAGACTGG - Intergenic
1137659078 16:50187854-50187876 TTTTTTTAAAATATAGAGATGGG - Intronic
1137709556 16:50556743-50556765 TTTTTTTTAAATTTAGAGACAGG + Intronic
1138059956 16:53879678-53879700 TTTTTTTTTAATTTTGAGATAGG - Intronic
1138104605 16:54281217-54281239 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1138104630 16:54281399-54281421 TTTTTCTTTAATTTAGAGACAGG - Intergenic
1138234112 16:55365837-55365859 TTCTGTAAGAATTTAGAAAATGG - Intergenic
1138408377 16:56817464-56817486 TTATTTTAGATTTTAGTGTATGG + Intronic
1138482080 16:57310218-57310240 CTTATTTATATTTTAGAGAAAGG + Intergenic
1138556608 16:57774697-57774719 TTTTTTTTTAATGTATAGAAGGG + Intronic
1138723412 16:59109048-59109070 TCTTTTGAGAATTTAGCCAATGG + Intergenic
1138950799 16:61910137-61910159 TTTTGATAGAATTCAGAGAAAGG + Intronic
1138990845 16:62389037-62389059 TTTTTTTTAATTTTAGAGATGGG - Intergenic
1139032274 16:62899493-62899515 TTTTCTTAGAATATACAGAAAGG + Intergenic
1139085069 16:63574551-63574573 TTTTTTTAATTTTTTGAGAAAGG - Intergenic
1139626700 16:68195496-68195518 TTTTTTTCAATTTTAGAGACAGG - Intronic
1139670339 16:68488520-68488542 TTTTTTTTGTTTTTAGAGACGGG - Intergenic
1139732534 16:68958930-68958952 GTTTTTTTAAATTTAGAGACAGG - Intronic
1139764048 16:69211826-69211848 TTTTTGAAGAACTTAAAGAAAGG - Intronic
1139807401 16:69579709-69579731 TATTTTTAGAAATTAAAAAATGG + Intronic
1139837950 16:69854859-69854881 GTTTTTTAAAATTTTGAGACAGG + Intronic
1140064629 16:71600537-71600559 TTTTTTTTTAATTTAGAGACAGG - Intergenic
1140069043 16:71633706-71633728 TTTTTTTTTAAATTAGAGATGGG + Intronic
1140084344 16:71780483-71780505 TTTTTTTTAAATTAAGAGACAGG - Intronic
1140180483 16:72712248-72712270 TTTTTTTAAAAATTAGAGACAGG + Intergenic
1140245070 16:73240904-73240926 GTTTTGTACAATTTAAAGAAGGG - Intergenic
1140648337 16:77059273-77059295 TTATTTGAAAATTTAGAAAAAGG - Intergenic
1140750288 16:78017313-78017335 TTGTTAAAGAATTTACAGAAAGG - Intergenic
1140767430 16:78173467-78173489 TTTTTTTTTAATGTAGAGGAAGG + Intronic
1141452395 16:84114132-84114154 TTTTTTTGTATTTTAGAGACGGG + Intronic
1142054993 16:87988436-87988458 TTTTTTTTTAAATTAGAGATGGG + Intronic
1142113904 16:88346522-88346544 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1142372874 16:89692648-89692670 TTTTTTTCTAAAATAGAGAAGGG + Intronic
1142405845 16:89889212-89889234 TTTTTTTATTTTTTAGAGACAGG + Intronic
1142728547 17:1834226-1834248 TTTTTTTATTTTTTAGAGATGGG + Intronic
1142743896 17:1945520-1945542 TTTTTTTAAAAAATAGAGATGGG + Intronic
1142865871 17:2791197-2791219 TTTTTTTCTTTTTTAGAGAAGGG - Intronic
1143569546 17:7747150-7747172 TTTTTTTTGAATGTGGAGACAGG + Intronic
1143669876 17:8389255-8389277 TTTTTTTAAAAAATAGAGATAGG + Intergenic
1143700623 17:8657227-8657249 TTTTTTTTTATTTTAGAGACGGG - Intergenic
1143936647 17:10492872-10492894 TTTTTTCAGAATCCTGAGAATGG + Intronic
1143997143 17:11016715-11016737 TTTTTTTTTAATATAGAGACAGG + Intergenic
1144143474 17:12373483-12373505 TTTTTTTTAAATTTAAATAATGG + Intergenic
1144389193 17:14777938-14777960 TTCTTTTATATTTTAGAGACAGG - Intergenic
1144509468 17:15863348-15863370 TTTTTTTATTTTTTAGAGATGGG + Intergenic
1144547632 17:16212898-16212920 TTTTTTTTGTTTGTAGAGAAAGG - Intronic
1144868344 17:18351848-18351870 TTTTTTTTAAATTTAGAAACAGG + Intronic
1145103329 17:20094681-20094703 TTTTTTTTTTATTTAGAGAGAGG + Intronic
1145173579 17:20680981-20681003 TTTTTTTATTTTTTAGAGATGGG + Intergenic
1145404544 17:22574592-22574614 TTATTTTAGACAATAGAGAAAGG - Intergenic
1145413931 17:22697085-22697107 TTTTATCAGCATTTAGATAAGGG - Intergenic
1145414225 17:22701685-22701707 TTTTATCAGTATTTAGATAAGGG + Intergenic
1145849532 17:28078774-28078796 TTTATTCACAATTGAGAGAATGG - Intronic
1146025326 17:29315550-29315572 TTTTTTTAAAATTTAAAGGTAGG + Intergenic
1146319674 17:31837064-31837086 TTTTTTTTGTATTTTCAGAAGGG - Intergenic
1146339213 17:32005747-32005769 TTTTTTAAAAATTTTGAGACAGG + Intergenic
1146543100 17:33714818-33714840 TTTTTTTTGATTTTTGAGACAGG + Intronic
1146785826 17:35720592-35720614 TTTTTTTTTAATATAGAGATAGG + Intronic
1146815603 17:35939666-35939688 TTTTTTTATTTTTTAGAGATGGG + Intronic
1146860365 17:36292262-36292284 TCTTTTTAAAATTGAGATAAGGG - Intronic
1147014517 17:37480654-37480676 TTTTTTTTTAATGTAGAGATGGG - Intergenic
1147055975 17:37835455-37835477 TTTTTTTAAAGATTAGAAAACGG - Intergenic
1147090693 17:38096356-38096378 TCTTTTTAAAATTGAGATAAGGG - Intergenic
1147106520 17:38224170-38224192 TCTTTTTAAAATTGAGATAAGGG + Intergenic
1147255434 17:39178392-39178414 TTTTTTTAAATTTTAGAGACTGG + Intronic
1147364130 17:39949381-39949403 TTTTTTTTTTATTTAGAGACAGG + Intergenic
1147441461 17:40450012-40450034 CTTTTTTAAAATTTTGAGACAGG + Intronic
1147475542 17:40708292-40708314 TTTATGGAGAATTAAGAGAATGG + Intergenic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1147634713 17:41956585-41956607 TTTTTTTATTTTTTAGAGATAGG - Intronic
1147698346 17:42374280-42374302 GCTTTTTAGAATTTAGATCATGG - Intronic
1147782599 17:42954437-42954459 TTTTTTTATATTTTTGAGATGGG + Intronic
1147802735 17:43105243-43105265 TTTTTGTTTAATTTAGAGACAGG + Intronic
1147924789 17:43939588-43939610 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1147937100 17:44018318-44018340 TTTTTTTACTTTTTAGAGATGGG - Intronic
1147941601 17:44052228-44052250 TTTTTTTTTAATTTAGAGATAGG - Intronic
1147958220 17:44149583-44149605 TTTTTTTAAGAATTAGAGATTGG + Intronic
1148002335 17:44397204-44397226 ATGTTTTAAAATTTACAGAAGGG + Intronic
1148043394 17:44726431-44726453 TTTTTTTTAATTTTAGAGACAGG + Intronic
1148181938 17:45612490-45612512 TTTTTTTTTAATATAGAGATGGG - Intergenic
1148266919 17:46233202-46233224 TTTTTTTTAAATATAGAGATGGG + Intergenic
1148298404 17:46524263-46524285 TTTTTTTTGTATTTATAGTAGGG - Intronic
1148384623 17:47225205-47225227 TTTTCTTAGAATTTACAGTCTGG + Intergenic
1148718674 17:49734417-49734439 TTTTTTTTGTTTTTAGAGACGGG - Intronic
1148728323 17:49813033-49813055 TTATTTTAAATTTTAGATAAGGG + Intronic
1148729304 17:49821905-49821927 TTTTTTTTTAATTTAAGGAAGGG - Intronic
1148761628 17:50005435-50005457 TTTTTTTAATTTTTAGAGACAGG - Intergenic
1148831529 17:50435415-50435437 TTTTTTTAATTTTTTGAGAAAGG + Intronic
1148934518 17:51154166-51154188 TTTTTTTGGAAGTTGCAGAATGG + Intronic
1149010612 17:51852916-51852938 TCTCTTAAGAATTAAGAGAATGG - Intronic
1149279104 17:55082611-55082633 TATTTTTGGCATTTAGTGAAAGG - Intronic
1149757849 17:59202555-59202577 TTTTTTTAATTTTTAGAGATGGG - Exonic
1149780319 17:59392304-59392326 TTTTTTTGGTATTTAGTCAAAGG - Intronic
1149824360 17:59813831-59813853 TTTTACTATAATTTATAGAAAGG - Intronic
1149884270 17:60325410-60325432 TTTTTTTTGTATTTTGAGACAGG - Intronic
1149889340 17:60372667-60372689 TTTTTTTTTAATGTAGAGAACGG - Intronic
1149938369 17:60833166-60833188 TTCTTTTAGAATATATAAAATGG - Intronic
1150036284 17:61802452-61802474 TTTTATTACTATTTAGAGATAGG - Intronic
1150042498 17:61879022-61879044 TTTTTTTTCATTTTAGAGATGGG + Intronic
1150404187 17:64885685-64885707 TTTTTTTTGTATTTATAGTAGGG + Intronic
1150692021 17:67375219-67375241 TATTTTTAAATTTTAGAGACAGG + Intergenic
1150783722 17:68144977-68144999 TTTCTTTAGTGCTTAGAGAAAGG - Intergenic
1151228218 17:72662263-72662285 TTTTTTTAGAAAGAAAAGAAAGG + Intronic
1151341808 17:73476621-73476643 TTTTTTTATTTTTTAGAGACAGG + Intronic
1151424573 17:74022530-74022552 TTTTTTTGAAATTTTGAGACTGG - Intergenic
1151487391 17:74409808-74409830 TTATTTTATATTTTAGAGAATGG + Intergenic
1151579418 17:74969770-74969792 TTTTTTTATTTTTTAGAGATAGG + Intronic
1151640445 17:75388610-75388632 TTTTTTTTTAATTTGGAGATGGG + Intronic
1151839004 17:76604051-76604073 TTTTTTTAAATAATAGAGAAGGG + Intergenic
1151941460 17:77295170-77295192 TTTTTGTAAAATTTACAAAATGG - Intronic
1152220506 17:79062295-79062317 TTTTTTTTTATTTTAGAGATGGG + Intergenic
1152789107 17:82268925-82268947 TTTTTTTTGTATTTATAGTAGGG - Intronic
1152990737 18:361663-361685 TATTTTTGAAATTTAGAGAAAGG + Intronic
1153347845 18:4047801-4047823 ATTTTTTAGTTTTTAGAGATGGG + Intronic
1153350439 18:4075319-4075341 TCTTTTTACACTGTAGAGAAAGG - Intronic
1153417450 18:4863762-4863784 ATTATATAGAATTTACAGAATGG + Intergenic
1153931688 18:9884967-9884989 TATTTTTAGTTTTTAGAGACGGG + Intergenic
1154233927 18:12584756-12584778 TTTATTTTTAATTTAGAGACAGG - Intronic
1154403327 18:14063884-14063906 TTGTTTTAGTATTTTGAGAGAGG + Intronic
1154454936 18:14512242-14512264 GTTTTTTGTAATTCAGAGAAAGG - Intronic
1154505793 18:15039658-15039680 TGTTTTTAGCATTTCTAGAATGG + Intergenic
1154512064 18:15116447-15116469 TTTTTTTAGCATTTATTTAAAGG + Intergenic
1154999054 18:21669049-21669071 TTGTTTTTTAATTTAGAGACAGG - Intronic
1155269342 18:24124290-24124312 TTTTTTTAAATTTTAATGAATGG + Intronic
1155290845 18:24340030-24340052 TTCCTTTGGAATTCAGAGAAAGG - Intronic
1155298962 18:24411325-24411347 TTTTTTTTTAATTTAGAGTTTGG + Intergenic
1155543886 18:26894377-26894399 TTTGTTAAGAATTAAGAAAAGGG + Intergenic
1155590032 18:27417276-27417298 TTATTTTAGATTTTTGACAAAGG + Intergenic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1155740788 18:29285417-29285439 TTTTATTAGGAATGAGAGAATGG - Intergenic
1155877784 18:31107961-31107983 TATTTTAAGAAATCAGAGAAAGG + Intergenic
1155967576 18:32050323-32050345 ATTTTTTAAAATTTGGAGACAGG + Intronic
1156152399 18:34258140-34258162 TTTATTTAAAAATTATAGAAAGG - Intergenic
1156438868 18:37164069-37164091 TTTCTTTCCATTTTAGAGAATGG - Intronic
1156872973 18:41968988-41969010 TTTTTTTATTTTTTAGAGATGGG + Intronic
1156902885 18:42321827-42321849 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
1157312752 18:46564523-46564545 TTTATTTAGTTTTTAGAGACAGG - Intronic
1157378511 18:47189426-47189448 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1157634693 18:49140048-49140070 TATTTTTTGAATTTATTGAATGG - Intronic
1157772546 18:50362051-50362073 TTTTTTTAAAAAATAGAGATGGG + Intergenic
1157852016 18:51063416-51063438 TTTTTTTAAATTTTTGAGACGGG + Intronic
1158345007 18:56507386-56507408 TATTTTTAGTTTTTAGAGACAGG - Intergenic
1158474574 18:57768681-57768703 TATTTTTAGAACTTGGAGTAAGG - Intronic
1158498681 18:57980274-57980296 TTTTTTTAAATTATAGAGACAGG - Intergenic
1158566437 18:58557941-58557963 TTTTTATATATTTTAGAGACGGG - Intronic
1158590978 18:58778570-58778592 TTTTTTTTAAATTTAGAAACAGG - Intergenic
1158747892 18:60222780-60222802 TTGTTCCAGATTTTAGAGAAAGG + Intergenic
1158872756 18:61704505-61704527 TTATTTTTGAATTTAGAAACAGG - Intergenic
1159252446 18:65897293-65897315 TTGTTTGAAAAGTTAGAGAATGG + Intergenic
1159341353 18:67137632-67137654 TGTTTTTAGAGTTTTGAAAATGG + Intergenic
1159410332 18:68066195-68066217 TTTTTTTTTATTTTATAGAAAGG - Intergenic
1159442961 18:68505550-68505572 GTTTTTTAAAATTTAGAGATTGG + Intergenic
1159835658 18:73331950-73331972 TTGTTTAAGAATTAAGATAATGG + Intergenic
1161035998 19:2084892-2084914 TTTTTTTTTTATTTAGAGACAGG + Intronic
1161212477 19:3074664-3074686 TTTTTTTAAATTTCAGAGACAGG + Intergenic
1161232769 19:3183168-3183190 TTCTTTTATATTTTAGAGACAGG + Intergenic
1161294215 19:3511536-3511558 TGTTTTTAAAATATAGAGATGGG - Intronic
1161342205 19:3749343-3749365 ATTTTTTAAATTTTAGAGATAGG + Intronic
1161354594 19:3811764-3811786 TTTTTTACGTATTTAGAGACAGG + Intronic
1161512706 19:4680397-4680419 TGTTTTTCTAATTTAGAGATGGG - Intronic
1161744445 19:6046935-6046957 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
1161822964 19:6542311-6542333 TTTTTTTTTAATTTTGAGATAGG + Intergenic
1162434535 19:10649449-10649471 TTTTTTTTTAATGTAGAGATGGG + Intergenic
1162586919 19:11565548-11565570 TTTTTTTTTATTTTAGAGATAGG + Intronic
1162712623 19:12607166-12607188 ATTTTTTAAATTTTAGAGACAGG - Intronic
1162733927 19:12735169-12735191 GTTTTTTAAAAATTAGAGACGGG + Intergenic
1162745329 19:12794541-12794563 CTTTTTTATATTTTAGAGACGGG + Intronic
1162837695 19:13331967-13331989 GTTTCCTAGAATTTAGAGATAGG - Intronic
1162903852 19:13811660-13811682 TTTTTAAAAAATTTAGAGACAGG - Intronic
1163015691 19:14452686-14452708 TTTTTTTTTAATTTAGAGACAGG - Intronic
1163042187 19:14610688-14610710 TTTTTGTAGCATTTAAAGAGAGG + Intronic
1163121477 19:15220815-15220837 TTTTTTTAATTTTTAGAGACTGG + Intergenic
1163211518 19:15844359-15844381 TTTTTTTTTAATTTAGAGGCTGG - Intergenic
1163284842 19:16339929-16339951 TTTTTTTTTAAATTAGAGACAGG - Intergenic
1163299300 19:16433650-16433672 TTTTTTGAGTTTTTAGAGATGGG - Intronic
1163333187 19:16654551-16654573 TTTTTTTAAAATATAAAGATGGG + Intronic
1163541066 19:17910594-17910616 TTTTTTTAGATTTTTGAGGCAGG - Intergenic
1163794185 19:19326884-19326906 TTTTTTTAAAGTTTTGAGACAGG - Intronic
1163912530 19:20209718-20209740 AATTTTTAGGATTTAGATAAAGG + Intergenic
1164334095 19:24292629-24292651 TTTCTCTAGAATTTGCAGAAGGG + Intergenic
1164349045 19:27310209-27310231 TTTTTGTAGAATCTACAAAATGG + Intergenic
1164376910 19:27695302-27695324 TTTTTGTAGAGTTTACAAAAGGG - Intergenic
1164798440 19:31055422-31055444 TTTTATTATTTTTTAGAGAAAGG - Intergenic
1164804472 19:31105838-31105860 TATTTTAAGAATTTATAGAGTGG + Intergenic
1164939077 19:32237868-32237890 TTTTTTAAGTTTTTAGAGACAGG + Intergenic
1165125346 19:33591936-33591958 TTGTTTTAGTTTTTAGAGATGGG + Intergenic
1165166814 19:33862889-33862911 TTTTTTTAATTTTTAGAGACAGG - Intergenic
1165206023 19:34187064-34187086 TTTTTTTTTAAATTAGAGACTGG - Intronic
1165218418 19:34294415-34294437 TTTTTTTTGCTTTTAGAGATGGG - Intronic
1165238996 19:34448421-34448443 TTTTTTTCGTTTTTAGAGATGGG - Intronic
1165409114 19:35647923-35647945 TTTTTTTAAATTTTTGAGACAGG - Intergenic
1165474262 19:36020857-36020879 TTTTTTTCTATTTTAGAGACAGG + Intronic
1165524152 19:36338512-36338534 TTTTTTTTTTTTTTAGAGAAAGG - Exonic
1165822977 19:38688563-38688585 TTTTATTATTATTTAGAGACAGG - Intronic
1165859089 19:38897842-38897864 CTTTTTTACTTTTTAGAGAAAGG + Intronic
1165859283 19:38898801-38898823 CTTTTTTACTTTTTAGAGAAAGG + Intronic
1165945949 19:39442349-39442371 TTTTATTATTATTTAGAGACAGG + Intronic
1166061282 19:40327323-40327345 TTTTTTTTAAATGTAGAGACAGG + Intronic
1166084130 19:40464089-40464111 TTTTTTTAAATTTGAGAGACAGG + Intronic
1166093345 19:40524331-40524353 TTTTTTTTAATTTTAGAGAAGGG - Intronic
1166212331 19:41314988-41315010 TTTTTTTTTAATTTAAAGATTGG + Intronic
1166386961 19:42387683-42387705 TTTTTTTAGAAATTGGAGGCTGG + Intronic
1166547643 19:43643190-43643212 TTTTTTTATTATGTAGAGACAGG + Intergenic
1166650316 19:44569034-44569056 TTTTTTTAAAATTTAGAGATAGG - Intergenic
1166663762 19:44664717-44664739 TTTTTTTTTATTTTAGAGAAAGG + Intronic
1166794463 19:45418053-45418075 TTTTTTTAATTTTTAGAGACAGG - Intronic
1166850544 19:45758433-45758455 TTTTTTTTAAATTTTGAGACAGG + Intronic
1167174593 19:47856968-47856990 TTATTTTAGAAATTATAGAGAGG + Intergenic
1167341159 19:48917215-48917237 TTTTTTTATTTTTTAGAGACAGG - Intronic
1167511691 19:49898465-49898487 TTTTTTTCTTTTTTAGAGAAAGG - Intronic
1167864299 19:52311799-52311821 TTTTTTTAATTTTTAGAGACAGG - Intronic
1167926735 19:52827235-52827257 TTTTTTTTGTTTTTAGAGACAGG - Intronic
1168045458 19:53791070-53791092 TTTTTAAAAAATTTAGAGATAGG + Intergenic
1168261175 19:55195740-55195762 ATTTTTTAAAATGTAGAGATGGG + Intronic
1168360720 19:55737726-55737748 TTTTTTTTTTTTTTAGAGAAAGG - Intronic
1168501198 19:56895079-56895101 TATTTTTAGGTTTTAGAGATGGG + Intergenic
1168652397 19:58099920-58099942 TTTTTTTAAAAATTAGAAAATGG - Intronic
925472877 2:4182105-4182127 TTTTTTTAAAATCTAGGAAATGG + Intergenic
925730231 2:6914833-6914855 TTTTTTAAAAAATTAGACAAGGG - Intergenic
925880735 2:8350207-8350229 CTTTTTGAGAATTTGGTGAAAGG - Intergenic
926026312 2:9548059-9548081 TTTTTTTTGGATTTTGAGACAGG - Intronic
926127473 2:10280425-10280447 TCTTTTTAAAATTTTGAGATTGG + Intergenic
926376594 2:12235054-12235076 TTTTTTTAGATTTTAGATTTGGG + Intergenic
926536304 2:14117245-14117267 TCTATTTAGAATTTAGGTAATGG - Intergenic
926877054 2:17492970-17492992 TTTTTTAAGAAATGATAGAATGG + Intergenic
927125468 2:20009217-20009239 TTTTTTTGGCTTTTAGAGACTGG - Intronic
927583502 2:24277533-24277555 TTTCAATAGAATTTAGAGAAAGG - Intronic
927587136 2:24318151-24318173 TTTTTAAAAAATTTAGAGACAGG + Intronic
927692469 2:25217796-25217818 TTTATTTATTATTTAGAGATGGG - Intergenic
927808420 2:26168527-26168549 TTTTTTTTCATTTTAGAGACAGG - Intergenic
927976023 2:27338837-27338859 CTTCTTTAAAATTTAGAGACAGG + Intronic
928500254 2:31885005-31885027 TTCTTTTAAAATTTAGAGTAAGG + Intronic
928502492 2:31911809-31911831 TTTTTTTACTTTTTGGAGAAAGG + Intronic
928521721 2:32095558-32095580 TTTTTTTTAAATTTAGACATGGG - Intronic
928557217 2:32439882-32439904 TTATTTTAGAGTTTTGAGACGGG + Intronic
928901399 2:36322096-36322118 TTTTTTTTGAGTTTAGAGCAAGG - Intergenic
929252207 2:39770974-39770996 TATTTATAAAATTTAGAGAGTGG + Intronic
929451083 2:42037852-42037874 TTTGTTTTGTTTTTAGAGAAGGG + Intergenic
929481840 2:42315700-42315722 TCTTTTTTGATTTTAGAGATGGG - Intronic
929505524 2:42525202-42525224 TTTTTTTTGAATTTTGAGTTTGG + Intronic
929623065 2:43377203-43377225 ATTGTTTAGAGTTTAGATAACGG + Intronic
929986428 2:46737841-46737863 TTTTTTTAGAAAGGACAGAAAGG - Intronic
930179674 2:48340871-48340893 CTTTTTTAGAATGTAGAAGATGG + Intronic
930388392 2:50727930-50727952 TCTCTTTACAAATTAGAGAAAGG + Intronic
930419116 2:51128249-51128271 TTTTATTTGAATTTAGAAAGAGG - Intergenic
930718717 2:54618326-54618348 TTTTTTGAGGATTTATGGAAAGG + Intronic
930810207 2:55532194-55532216 TTTTTTTTTAATTTTGAGACAGG - Intronic
930854586 2:55999733-55999755 TTTTTTTAGTATATAGAAATTGG + Intergenic
930858589 2:56045212-56045234 TTTTTTTAAATTTAAGAGATAGG + Intergenic
930983354 2:57554943-57554965 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
930998670 2:57754590-57754612 TTTTTTTAAACTATAGAGAAGGG - Intergenic
931023500 2:58078843-58078865 TTTTTTATTATTTTAGAGAAAGG + Intronic
931061269 2:58532338-58532360 TTTTTTTTTAATTTTGAGACAGG + Intergenic
931089714 2:58872585-58872607 TTTGTTTTTAATTTAAAGAATGG - Intergenic
931095809 2:58939423-58939445 TTTTTTTGGAATGTGGGGAAGGG - Intergenic
931257630 2:60587148-60587170 TTTTTGAAGGATTTACAGAATGG - Intergenic
931273726 2:60725846-60725868 TTTTTTTTTAAATTAGAGATGGG + Intergenic
931411945 2:62041410-62041432 TTTTGTTAGTATTTTGAGATAGG + Intronic
931729755 2:65142469-65142491 TTTTTTTATTTTTTAGAGATGGG - Intergenic
931878029 2:66535364-66535386 TTTTTTTAAGACTTTGAGAAGGG - Intronic
931986872 2:67750740-67750762 TATTTTTATATTTTAGAGACAGG - Intergenic
932373467 2:71212922-71212944 TTTTTTTTTTTTTTAGAGAAGGG + Intronic
932382610 2:71299048-71299070 TTTTTTTCTTATTTAGAGACAGG - Intronic
932747568 2:74346575-74346597 TTTTCTTTGTTTTTAGAGAAAGG + Intronic
932987331 2:76741713-76741735 TTTTTTTTGCATTTGGAAAAGGG + Intergenic
932994609 2:76835463-76835485 TTATTCTTGCATTTAGAGAAAGG + Intronic
933028033 2:77287262-77287284 TTGTTTTAGAACTTAGAGAATGG + Intronic
933096047 2:78182470-78182492 TTTTTTTAAACTTTAGATACAGG - Intergenic
933357526 2:81231088-81231110 TTCTTCTAGAATCTACAGAATGG - Intergenic
933371551 2:81421411-81421433 TGTTTTTGGAAGTTTGAGAAAGG - Intergenic
933375021 2:81467885-81467907 TCTTTTTTGTTTTTAGAGAAAGG + Intergenic
933442632 2:82333560-82333582 TTTTTCTGGAATTAAGAAAATGG - Intergenic
933483670 2:82890846-82890868 TTTTTTTACAATTTACATATAGG - Intergenic
933654436 2:84875985-84876007 TTTTTTTTTAATTTTGAGATAGG - Intronic
933686451 2:85145496-85145518 CTTTTTTGGAATTTACAGAGGGG - Intronic
933721021 2:85397844-85397866 TTTTTTTAAAAGATAGAGATGGG - Intronic
934694365 2:96388501-96388523 TTTTTTTTTAATGTAGAGACAGG + Intergenic
934710982 2:96513836-96513858 TTGTTTTAGAATTAACAAAACGG - Intergenic
934843004 2:97642927-97642949 TTTTTTTAAAAAATAGACAAAGG + Intergenic
935252539 2:101276658-101276680 TTTGTTTAGAATTATGAGAAAGG - Exonic
935300386 2:101688628-101688650 TTTTTTTTCAAATTAGAGACAGG - Intergenic
935320686 2:101885979-101886001 TTTTTTTATATTTTATTGAAGGG + Intronic
935992188 2:108729123-108729145 TTTTTTTAGAAGTCAATGAAAGG + Exonic
936002517 2:108847973-108847995 TTTTTTTAAGATTTGGAGATAGG - Intronic
936127502 2:109801774-109801796 TTTTTTTAGAAGTCAATGAAAGG + Exonic
936217195 2:110569711-110569733 TTTTTTTAGAAGTCAATGAAAGG - Exonic
936312172 2:111395195-111395217 TTTTTATATTATATAGAGAAGGG + Intergenic
936426334 2:112424294-112424316 TTTTTTTAGAAGTCAATGAAAGG - Exonic
936444601 2:112585888-112585910 TTTTTTTATTTTTTAGAGACAGG - Intronic
936551935 2:113451397-113451419 TTTTATTAGATTTTGAAGAAGGG + Intronic
937137109 2:119563146-119563168 ATTTTTTATATTTTAGAGACAGG - Intronic
937375397 2:121332803-121332825 TTTTTTTATTTTTTAGAGACAGG - Intergenic
937421942 2:121764431-121764453 TTTGTTTTTAATATAGAGAAGGG - Intronic
937779800 2:125823886-125823908 ATATTTTATATTTTAGAGAAAGG + Intergenic
937840162 2:126517128-126517150 TTTTATTAGTTTTTAGAGACAGG - Intergenic
938323068 2:130378150-130378172 TTATTTTAGAATATACAAAATGG + Intergenic
938594889 2:132778219-132778241 TTTTTGTGTAATTTAGACAAGGG - Intronic
938625919 2:133109092-133109114 TTTTTATATAATTTTAAGAAGGG - Intronic
939198168 2:138999215-138999237 TTTTTTAATAAGTAAGAGAATGG - Intergenic
939225824 2:139362948-139362970 TTATTTTAGAAATAAGAGGAAGG - Intergenic
939978905 2:148755154-148755176 TTTTTTTAAACATTAGAGGATGG + Intronic
940157448 2:150673908-150673930 TTAATTTAGTTTTTAGAGAAAGG - Intergenic
940220745 2:151348857-151348879 GTTTTTTGGAATTCATAGAATGG + Intergenic
940257071 2:151742680-151742702 TGTTTTTAGATTTTATATAATGG + Intergenic
940276273 2:151944032-151944054 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
940294010 2:152103599-152103621 TTTTTTCAAATTTTAGAGATGGG - Intergenic
940384993 2:153060068-153060090 TTTTTTTAAAAATTATAAAAAGG + Intergenic
940488903 2:154331475-154331497 TTTTTTTAAAATGTAGAGACTGG + Intronic
940648247 2:156414331-156414353 TTTATATACAATTTAAAGAATGG - Intergenic
940665232 2:156600979-156601001 GATTTTTAGAAATAAGAGAATGG - Intronic
940754633 2:157668117-157668139 ATGTTTTAAAATTTAGAGGAGGG - Intergenic
940868320 2:158838559-158838581 TTTTTTGAGTTTTTAGAGACAGG + Intronic
940956788 2:159737781-159737803 TTTTTTTTTAATTTTGAGACAGG - Intronic
941091244 2:161178824-161178846 CTTTTAGAGAATTAAGAGAAAGG + Intronic
941125519 2:161579506-161579528 ATTTTTTTGGATTTAAAGAATGG + Intronic
941127422 2:161601449-161601471 TTTTTTTTGCATTTATGGAAAGG + Intronic
941135479 2:161712400-161712422 TTTTTTAAGCCTTTAAAGAAAGG - Intronic
941208691 2:162608531-162608553 TTTATTTAGCATTAGGAGAAAGG + Intronic
941436025 2:165474232-165474254 TTATTTTATATTTTAGAGATAGG + Intronic
941470564 2:165880416-165880438 TTCTTTTAGAAGGAAGAGAAGGG + Intronic
941510413 2:166401339-166401361 TTTTTTAAAATTTTAGAGACAGG + Intergenic
941699719 2:168591828-168591850 CTTCGTTAGATTTTAGAGAAGGG + Intronic
941799289 2:169638326-169638348 TTTTTTTAAAGTTTAGAGAAGGG - Exonic
942108793 2:172659673-172659695 TCTTTTCAGAATTTACTGAATGG - Intergenic
942720303 2:178944241-178944263 TTTTATGATAATTTAGATAATGG + Intronic
942919102 2:181349458-181349480 TTTTTTTTTAAATTAAAGAATGG + Intergenic
942967002 2:181907087-181907109 TCTTTTTAAACTTTAGAGGAAGG + Intronic
943063516 2:183062719-183062741 TTTTTTTAATTTTTAGAGATGGG - Intergenic
943766530 2:191668659-191668681 TTTGTTTGGAATTGAAAGAAGGG - Intergenic
943868599 2:192962138-192962160 TTTTTTCAGAATTTATAGCTTGG - Intergenic
943930209 2:193840975-193840997 TTTTTCAAGAATTTTGAGCATGG - Intergenic
943984347 2:194600682-194600704 TTTTTTTAAAGTTTAGACAGAGG - Intergenic
944003372 2:194870237-194870259 TTTTTTTAAATTTTAGCAAAGGG - Intergenic
944299827 2:198110863-198110885 TTGCTGTAGAATCTAGAGAAAGG + Intronic
944311375 2:198237343-198237365 TTTTTTTAATTTTTAGAGATGGG + Intronic
944421218 2:199532600-199532622 GTTAATTAAAATTTAGAGAATGG - Intergenic
944505213 2:200404005-200404027 TTTTCTAAGAATTCAGAGAAAGG - Intronic
944626863 2:201579453-201579475 TTTGTTTTGTTTTTAGAGAAAGG + Intronic
944940439 2:204619782-204619804 ATTGTTTAGAAATAAGAGAAGGG + Intronic
945012753 2:205482446-205482468 GTTTTTTAAAGTTTAGTGAAAGG + Intronic
945414151 2:209550042-209550064 ATTTTTAATAGTTTAGAGAAAGG + Intronic
945492706 2:210475338-210475360 TTTTTTTATTTTTTAGAGACAGG + Intronic
945603600 2:211897933-211897955 TTTTTTTTAATTATAGAGAAGGG + Intronic
945635146 2:212339790-212339812 CTTTTTTAAAATTTTGAGATAGG + Intronic
945755607 2:213842770-213842792 TATTTTTATCATTTAGAGACAGG + Intronic
945806113 2:214491656-214491678 GTTTCTTAGAATTGAGTGAAAGG - Intronic
945881315 2:215327900-215327922 TTTTTTTTAAATTAAGACAACGG + Intronic
945883717 2:215352985-215353007 TTTGTTGAGAATTTAGAAAAAGG + Intergenic
946510688 2:220352720-220352742 TACTTTGAGAATTTAGACAAAGG - Intergenic
946619200 2:221542848-221542870 ATTTTTTAGAATGAAAAGAAAGG + Intronic
946780385 2:223188705-223188727 TTTTTCTGGAATTTGCAGAAGGG + Intronic
946904187 2:224400499-224400521 TTTTTTTATTTTTTAGAGATGGG - Intronic
946999697 2:225439849-225439871 TTTCTTTAAAAATTAGAGTATGG - Intronic
947013777 2:225594714-225594736 TTTTTTTGGAATTCAGTAAATGG + Intronic
947311080 2:228803124-228803146 ATTTTTTAAAATTTAGAAATGGG - Intergenic
947707150 2:232285509-232285531 CTCTGTTAGAATCTAGAGAAGGG + Intronic
947862488 2:233370759-233370781 TTTTTTTAAATTTTTGAGACAGG + Intronic
948018461 2:234709915-234709937 TTTTTATAGAATTGGGACAATGG - Intergenic
948408409 2:237740234-237740256 TTTTTTTACTGTTTAGAGATGGG - Intronic
948443880 2:238017232-238017254 GTTTTTGAGAATTCAGAGAAGGG + Intronic
949030946 2:241797028-241797050 TGTTTTAAGAATGTAGAGATGGG + Intronic
1168777975 20:463864-463886 TTTTTTTAGTTTTTATAGAGGGG + Intergenic
1168987841 20:2065592-2065614 TTGTTTTAGAAATTAAAAAAAGG + Intergenic
1169148920 20:3274058-3274080 TTTTTTTTTAGTTCAGAGAAGGG - Intronic
1169242067 20:3990868-3990890 TTTTTTTAATTTTTAGAGACAGG - Intronic
1169370388 20:5024615-5024637 TTTTTTTTTAATTTTGAGACAGG + Intergenic
1169706348 20:8509581-8509603 GTTTTTTAGCATTTAGACTATGG + Intronic
1169834492 20:9862726-9862748 TTTTTTTTGACTTGTGAGAAAGG - Intergenic
1170052774 20:12164937-12164959 TTTTTTTTTATTTTAGAAAAGGG - Intergenic
1170187961 20:13612948-13612970 TTATTTTAGGATATAGAGGATGG + Intronic
1170272538 20:14544239-14544261 TTTTTTTAGAAAATAGGGTAGGG + Intronic
1170635100 20:18097302-18097324 TTTTTTTAATATTTTGAGACAGG - Intergenic
1170641873 20:18161547-18161569 TTATTTTAAAATTTAGATATGGG + Intronic
1170910228 20:20559092-20559114 TTTTCTTAGAATGAAAAGAATGG - Intronic
1171113778 20:22507121-22507143 TATTTTTATATTTTAGAGACAGG - Intergenic
1171734107 20:28749946-28749968 TTTTTGTAGAATTTGCAAAAGGG + Intergenic
1171981018 20:31629134-31629156 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1172141909 20:32728735-32728757 TTTTTTTTTAATGTAGAGACAGG + Intronic
1172262365 20:33579237-33579259 TTTTTTTAAAATTTAGCGATGGG + Intronic
1172281635 20:33711967-33711989 TTTTTTTAATTTTTAGAGACAGG - Intronic
1172368887 20:34371589-34371611 CTTTTTTATAATCAAGAGAAAGG + Intronic
1172379770 20:34479614-34479636 TTTCTTTTGATTTCAGAGAATGG + Exonic
1172406894 20:34696474-34696496 TTTTTTTATTTTTTAGAGATGGG - Intergenic
1172651117 20:36502336-36502358 TTTTTTTAAAATTTAGCAAATGG - Intronic
1172685486 20:36750792-36750814 TTTTTTTTTAATTTTGAGATAGG + Intergenic
1173096228 20:40031257-40031279 TTTTATTAGAATTCTTAGAATGG - Intergenic
1173321335 20:41989844-41989866 TTTTTTTAAAAATTAAAAAATGG - Intergenic
1173509813 20:43618225-43618247 TTTTTTTAATTTTTAGAGACAGG + Intronic
1173526285 20:43735334-43735356 TTTTTTAAAAAATTAGAGACGGG + Intergenic
1173553863 20:43951715-43951737 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
1173627469 20:44483803-44483825 TTTTTTTATATTTTTGAGACAGG + Intronic
1173696413 20:45018734-45018756 TTTTTTTTTAATTTGGAGACAGG + Intronic
1173787046 20:45801615-45801637 TTTTTTTTTATTTTAGAGACAGG - Intronic
1173937267 20:46877857-46877879 TTTTTTTAATATTTAGGGACAGG + Intergenic
1174307981 20:49628239-49628261 ATTTTTTAAAATATAGAGACAGG + Intergenic
1174708684 20:52682963-52682985 TTTTTTTTAATTTTAGAGACAGG - Intergenic
1174992673 20:55528819-55528841 TTTTCTAAGAATTTAGACAAAGG + Intergenic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1175707089 20:61187756-61187778 TTTATTCAGGATTTAGAAAATGG - Intergenic
1176253211 20:64136818-64136840 ATTTTTTAAAATGTAGAGACAGG + Intergenic
1176792069 21:13329368-13329390 TGTTTTTAGCATTTCTAGAATGG - Intergenic
1176819226 21:13641074-13641096 GTTTTTTGTAATTCAGAGAAAGG + Intronic
1177131528 21:17262057-17262079 TTTTTTTTTAATTTATATAAGGG - Intergenic
1177144469 21:17392654-17392676 TTTTATTTTACTTTAGAGAAGGG - Intergenic
1177149494 21:17440724-17440746 TTTCTTTAATATTTAGAGGAAGG + Intronic
1177232667 21:18342645-18342667 TTTTCTGATAATTCAGAGAAGGG - Intronic
1177427638 21:20945009-20945031 AATTTTTAGTATTAAGAGAAAGG + Intergenic
1177489391 21:21802954-21802976 TTTTTTTAGTATTTGAAAAAGGG + Intergenic
1177583450 21:23058234-23058256 CATTATTAGAAATTAGAGAAAGG + Intergenic
1177928204 21:27246233-27246255 TTTTTTTAATAATTAGAGGAAGG + Intergenic
1177935982 21:27347142-27347164 TTTTTATAGCAGTTTGAGAATGG - Intergenic
1178080805 21:29062793-29062815 TTGTTCTAGAATTGGGAGAATGG + Intronic
1178341414 21:31788504-31788526 TTTTTTTTAATTTTAGAGATGGG - Intergenic
1178640418 21:34340882-34340904 TTTTTTTAGAAAAGAGAAAATGG + Intergenic
1178943918 21:36930514-36930536 TTTTTTTTAAATTTAGAGACAGG + Intronic
1179010727 21:37554084-37554106 CTTTTTTAAATTTTAGAGACAGG + Intergenic
1179212147 21:39333937-39333959 TTTGTTTCTATTTTAGAGAATGG - Intergenic
1179224229 21:39439241-39439263 CTTTTCTAGAAGTTAGAAAAGGG + Intronic
1179327583 21:40363602-40363624 ATTTTTTAAAATTTAGGGAAAGG + Intronic
1179386686 21:40950044-40950066 TTTTTTGAGAATTTGAAGAGTGG - Intergenic
1180359152 22:11870950-11870972 TTTTTTTTTTATTTAGAGACAGG - Intergenic
1180632529 22:17239607-17239629 TTATTTTTTAATTTAGAGACAGG + Intergenic
1180885093 22:19237301-19237323 TTTTTTTAAAAAGTAGAGATGGG - Intronic
1180886709 22:19250342-19250364 TTTTTTTTAATTTTAGAGACAGG + Intronic
1180985542 22:19902025-19902047 TTTTTTTAGTTTGTAGAGATGGG - Intronic
1180989172 22:19923970-19923992 TTTTTTTTTAATTTAAAAAAAGG + Intronic
1181290650 22:21790357-21790379 TTTTTTTAATTTTTAGAGAAAGG - Intronic
1181319444 22:21993303-21993325 TTTTTTTACTCTTTAGAGACAGG - Intergenic
1181379316 22:22487434-22487456 TTTTTTTTTACTTTAGAGACAGG - Exonic
1181590150 22:23879148-23879170 TTTTTTTATCTTTTAGAGACAGG + Intronic
1181662834 22:24365850-24365872 TTTTTTTTTTTTTTAGAGAATGG + Intronic
1181828575 22:25540140-25540162 TTTTTTTTGTAATTGGAGAATGG + Intergenic
1182154177 22:28053757-28053779 TTTTTTTAATAATTAGAGAAAGG + Intronic
1182195663 22:28513594-28513616 ACTTTTTAAAATTTAGAGACAGG - Intronic
1182196003 22:28518600-28518622 TTTTTTTAAAAAATAGAGACAGG - Intronic
1182283141 22:29229331-29229353 TTTTTTTTAATTTTAGAGACAGG - Intronic
1182285463 22:29244418-29244440 TTTTTTTGTATTTTAGAGATGGG - Intronic
1182288510 22:29261586-29261608 TTTTTTTAATTTTTAGAGACAGG - Intronic
1182408970 22:30165444-30165466 TTTTATTGGGATTTTGAGAAAGG + Intronic
1182415586 22:30219112-30219134 TTTATTTATTTTTTAGAGAAGGG - Intergenic
1182503599 22:30766213-30766235 TTGTTTTTGTTTTTAGAGAAAGG - Intronic
1182657442 22:31901881-31901903 TTTTTTTAGCTCCTAGAGAAAGG + Intronic
1183145869 22:35991086-35991108 AATTTTTAAAATTTAGAGATGGG - Intronic
1183765622 22:39870999-39871021 TTTCTTTTTAATGTAGAGAAGGG - Intronic
1183765781 22:39872994-39873016 TTTTTTTTTAATGTAGAGACAGG + Intronic
1183817927 22:40319257-40319279 TTTTTTTTAAATTCAGAGATGGG - Intronic
1183957889 22:41393167-41393189 TTTTTTTATTTTTTAGAGACAGG - Intronic
1184126235 22:42489268-42489290 TTTTTTTAATTTTTAGAGACAGG - Intergenic
1184134177 22:42536609-42536631 TTTTTTTAATTTTTAGAGACAGG - Intergenic
1184435030 22:44467631-44467653 TTTTTTTATCATTTTGAGACAGG + Intergenic
949123913 3:422217-422239 TTTTTTTTTAATATAGAGACAGG - Intergenic
949402015 3:3674924-3674946 TCTTTATAGAATTTACACAAAGG - Intergenic
949560835 3:5200901-5200923 TTTTTTTTCATTTTAGAGCAGGG + Intronic
949818756 3:8092227-8092249 TATTTTAAAAATTCAGAGAAAGG + Intergenic
949968278 3:9378493-9378515 TTTTTAAAGAATTTAGAAGAGGG + Intronic
950068317 3:10131478-10131500 TTTTTTTTGTTTTTAGAGACAGG + Intergenic
950204592 3:11069020-11069042 TTTTTTTAGCATCTAGTGGAAGG + Intergenic
950331022 3:12156279-12156301 TTATTTTGGAGTTCAGAGAACGG - Intronic
950381885 3:12622989-12623011 TTTTTTTTAAATTTAGAAATGGG - Intronic
950985715 3:17363463-17363485 TTTTTTTATTTTTTAGAGACAGG + Intronic
951065278 3:18257185-18257207 TTTTTTTATTTTTTAGAGATGGG - Intronic
951353971 3:21641645-21641667 TTTTTTTTTAATATAGAGATGGG + Intronic
951524789 3:23643493-23643515 TTTTTTGAGTTTTTAGAGACAGG - Intergenic
951548340 3:23851783-23851805 TTTTTTTATTTTTTAGAGACAGG - Intronic
951553112 3:23895181-23895203 TTTTTTTAATTTTTAGAGATGGG + Intronic
951730495 3:25805643-25805665 TTTTCTTATAATTTAGTGAAGGG + Intergenic
951782170 3:26376153-26376175 TTCTGTTAAAATTGAGAGAAGGG + Intergenic
951980446 3:28560321-28560343 TTTTTATATAATTTAGAATAAGG - Intergenic
951997048 3:28742608-28742630 TTTTTTTGGACTTTATATAATGG + Intergenic
952002852 3:28807116-28807138 GTTTTTTAAAAATTACAGAATGG - Intergenic
952116904 3:30193417-30193439 TTTTCTTAGAATTTATAATAAGG - Intergenic
952160054 3:30684410-30684432 ATTTTTCAGAAGTTAAAGAAAGG + Intronic
952307566 3:32159457-32159479 TTTTTTTTTTTTTTAGAGAATGG - Intronic
952331582 3:32368464-32368486 TTTTTTTTTTTTTTAGAGAAGGG + Intronic
952370116 3:32714306-32714328 TTTTTATAGAATTGAAAGATTGG + Intronic
952719067 3:36513605-36513627 TATTATTAGAAAGTAGAGAAGGG - Intronic
952872625 3:37914885-37914907 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
953347714 3:42189949-42189971 TTTTTTTAGAGTTCACAGCAGGG + Intronic
953362720 3:42312773-42312795 TTAATTTAGAATTTTGATAATGG + Intergenic
953699143 3:45182556-45182578 TTTTTTTCTAACCTAGAGAAGGG - Intergenic
953700370 3:45191035-45191057 TTTTTTTAAAATTTACAAATTGG + Intergenic
953941912 3:47107090-47107112 CTTTTAGAGAATTAAGAGAAGGG - Intronic
954002766 3:47570846-47570868 TTCATTTAGACTTTAGATAAGGG + Intronic
954242818 3:49307457-49307479 TTTTTTTAATTTTTAGAGATAGG + Intronic
954448270 3:50558142-50558164 TATTTATAGCATTTAGAGGAGGG + Exonic
954535504 3:51356556-51356578 TTTCTTTAGTCCTTAGAGAAGGG - Intronic
955201991 3:56859708-56859730 TTTTTTTTTAAGTTAGAGACAGG + Intronic
955626959 3:60928578-60928600 TTTTTTTAGCATTTAAAAATAGG - Intronic
955920762 3:63953379-63953401 GGTATTTAGTATTTAGAGAAGGG + Intronic
956368215 3:68529428-68529450 TTTTTTTTTTTTTTAGAGAATGG - Intronic
956602632 3:71038667-71038689 TTTTTTTTTAATTAAGAGACAGG + Intronic
956683850 3:71806174-71806196 TTTTGTTAGTTTTTAGAAAAAGG - Intergenic
957017799 3:75090166-75090188 ATTTTTTAGCGTCTAGAGAAGGG - Intergenic
957062136 3:75490758-75490780 TTTTTTTAGAGATTGGAGCAGGG - Intergenic
957183545 3:76912813-76912835 TTTTGTCTGAATTTGGAGAAGGG + Intronic
957188308 3:76972418-76972440 GTTTTTTTGAATGCAGAGAAAGG + Intronic
957290899 3:78277057-78277079 TATTTTTATAATGTAGAGATGGG - Intergenic
957539812 3:81552738-81552760 TTTTTTTAAAATTGAGAAAATGG + Intronic
957738513 3:84232970-84232992 TTTTATTAGCAGTTTGAGAATGG - Intergenic
957815872 3:85296427-85296449 TTTTTTTCTATTTTAAAGAATGG + Intronic
958598892 3:96267684-96267706 TTATTTGAGACTTTAGAGAGAGG + Intergenic
958674077 3:97243570-97243592 TTTTTTTCAAATTTTGAAAATGG + Intronic
958735511 3:98004566-98004588 GATTTTGAGAATTTTGAGAAAGG + Intronic
958791993 3:98662453-98662475 TTATTTTAAAATTTACAAAATGG + Intergenic
958877915 3:99637266-99637288 TTTTTTTTTAATTTAAAGAAAGG - Intergenic
959388092 3:105738362-105738384 TTTTTTTATGATTTAGCAAAAGG + Intronic
959608876 3:108271572-108271594 TTTTTTTAAATTTTAGAGATAGG - Intergenic
959767658 3:110051369-110051391 TTTTTTAAATATTTAGAGATGGG - Intergenic
960008273 3:112804538-112804560 TTTTTGTAGAAAGTAGAAAAGGG - Intronic
960162634 3:114367270-114367292 TTTTTTTATTTTTTAGAGACAGG + Intronic
960291802 3:115894862-115894884 TCTTTTTAAAATTTAAATAAAGG - Intronic
960353675 3:116624470-116624492 TTGTTTCAGACTTTAAAGAAAGG + Intronic
960369839 3:116821468-116821490 TTATTCTAGAGTTTAGTGAAAGG - Intronic
960410431 3:117316846-117316868 TTTATGTACAATTAAGAGAAAGG - Intergenic
960449169 3:117784681-117784703 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
960475796 3:118126318-118126340 TTTTTCTAGATTTTAAATAATGG + Intergenic
960509535 3:118531720-118531742 TTTTTTTAGAATTATGCAAATGG + Intergenic
960774112 3:121229559-121229581 TTTTTTTACTTTTTAGAGACAGG + Intronic
960789212 3:121408905-121408927 ATTTTTTTGAACTTAGATAACGG + Intronic
960825242 3:121775950-121775972 TATTTTTAGAATTTACATAAAGG + Intronic
960837102 3:121918073-121918095 TGTTTCTATAATGTAGAGAAAGG + Intronic
960952004 3:123005365-123005387 TATTATTATTATTTAGAGAAAGG + Intronic
961002882 3:123385829-123385851 TTTTTGTAGACTATAGAGAGAGG - Intronic
961054312 3:123775035-123775057 TTTTTTTTAATTTTAGAGATGGG + Intronic
961062791 3:123845659-123845681 TTTTTTTATTTTTTAGAGACAGG + Intronic
961231989 3:125322197-125322219 TTTTTTTTGTATGTAGAGACAGG + Intronic
961707458 3:128798807-128798829 TTTTTTTTAAATTTAGAGACAGG - Intronic
961766691 3:129217194-129217216 TTTTTTTTTAATTAAGAGATGGG + Intergenic
962046148 3:131761219-131761241 TTTTTTTTTTTTTTAGAGAAAGG + Intronic
962166217 3:133051390-133051412 TTTTTATAGATTTTGGATAATGG + Intronic
962493069 3:135912116-135912138 TTTTTTAAAAATTTAGAGTGAGG + Intergenic
962566656 3:136667489-136667511 TTTTCTTAGAGTTTGGAGAAGGG + Intronic
962821278 3:139049738-139049760 TTTTTTTAAAAAATAGAGATGGG + Intronic
963618988 3:147580821-147580843 TTTTTTTATTTTTTAGAGACAGG + Intergenic
963746031 3:149126029-149126051 TAATTTTAGAGTTCAGAGAAAGG + Intergenic
963754536 3:149220136-149220158 TTTGTTTAGAATTTGGTGAATGG - Intronic
963796557 3:149636518-149636540 ATTTTTTAGAATTTATAGTCGGG + Intronic
963877988 3:150498306-150498328 CTTTTTTAGGTTTTAGAGACAGG + Intergenic
964082213 3:152773270-152773292 TTTTTTTAAATTTTTGAGACGGG + Intergenic
964093897 3:152909133-152909155 TTTGTTTTTAATTTAGGGAAGGG + Intergenic
964198399 3:154090154-154090176 TTCTTTAAGAATTTAGGGCAGGG - Intergenic
964292426 3:155196137-155196159 TTTTGTGAGAATCTGGAGAATGG - Intergenic
964599301 3:158478052-158478074 TATTTTTAATATTTAGAGATGGG - Intronic
964733285 3:159890518-159890540 TTGTTTTAAAATTAAGAGAAAGG + Intronic
964750313 3:160048309-160048331 TTTTTTTATTTTTTAGAGACAGG + Intergenic
965219977 3:165916630-165916652 TATTTTTATAATTTAGAGCAAGG - Intergenic
965295819 3:166944335-166944357 TTTTTTTATAAATAAGAAAAGGG - Intergenic
965414562 3:168376547-168376569 TTTATTAATAATTTTGAGAAAGG - Intergenic
965415397 3:168386435-168386457 TCATTTTAGAATTTAGAACAAGG - Intergenic
965462938 3:168991368-168991390 TTTGTTTAGTATGAAGAGAACGG + Intergenic
965474955 3:169146156-169146178 TTTAGGTAGACTTTAGAGAAAGG + Intronic
965488767 3:169311717-169311739 CATTTTAAAAATTTAGAGAAAGG - Intronic
965565854 3:170116968-170116990 TTTTTATAATTTTTAGAGAAAGG - Intronic
965642794 3:170848733-170848755 TATTTTTATATTTTAGAGACGGG + Intronic
965670658 3:171144435-171144457 TTATTTTAGACATTAGAGAAAGG + Intronic
965925864 3:173978822-173978844 TTTTTTTTTTAATTAGAGAAGGG - Intronic
966004131 3:174987631-174987653 TTTTTTTTGAAGTTATAGACAGG + Intronic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966290660 3:178353970-178353992 TTTTTTAAAAAATGAGAGAAAGG + Intergenic
966406392 3:179602941-179602963 TTTTTTTCTTATTTAGAGACTGG + Intronic
966479599 3:180391520-180391542 TTTTTTAAGAGTTTAGGGAAAGG - Intergenic
966495654 3:180577462-180577484 TTTTTTTCTAAATTAGAAAAGGG + Intergenic
966632215 3:182089754-182089776 TTTTATCAGAAATAAGAGAAAGG + Intergenic
966752511 3:183335853-183335875 TTTGTTTTGATTTTAGAGATGGG - Intronic
966839867 3:184079707-184079729 TTTTTTTAATTTTTAGAGACAGG - Intergenic
967164525 3:186768647-186768669 TTTTTTTTAAATATAGAGATGGG + Intergenic
967177826 3:186875787-186875809 TTTATTTATATTTTAGAGATAGG + Intergenic
967368180 3:188711807-188711829 TTCTTTGAGAATTCAGAAAAAGG + Intronic
967369356 3:188726249-188726271 TCTTGTGACAATTTAGAGAAGGG + Intronic
967530499 3:190544007-190544029 GTTTTTTATATATTAGAGAATGG + Intronic
967762308 3:193240491-193240513 TTTTTTTAGCAGTGAGAAAAAGG + Intergenic
968012688 3:195295575-195295597 TTTTCTTAGAATATGTAGAAGGG + Intronic
968020641 3:195385232-195385254 TTTTTTTTGAATACAGAGATAGG - Intronic
968239161 3:197060301-197060323 TTTTTTTAAAATTTAAGGGACGG + Intronic
968257588 3:197290882-197290904 TTTTTTTACTATTTGGAGACAGG - Intronic
968415388 4:428420-428442 TTTTTTTTTAATTTTGAGACAGG + Intronic
968832117 4:2937902-2937924 ATATTTTAGAAATCAGAGAAGGG - Intergenic
969110671 4:4842260-4842282 TTTTATTAGAAATTGAAGAATGG - Intergenic
969286211 4:6203859-6203881 TTGTTTTCAAATTTGGAGAAAGG + Intergenic
969745743 4:9069751-9069773 TTTTTTTTTAAGATAGAGAAGGG - Intergenic
969984276 4:11190956-11190978 TCTTTATAGCAGTTAGAGAATGG - Intergenic
970121410 4:12757207-12757229 TTTTTTTAAATTTTGAAGAATGG + Intergenic
970245538 4:14058138-14058160 TTTTTTTAAAAAATAGAGACAGG - Intergenic
970579461 4:17461547-17461569 TTTTTTCAGTATTAAGACAAAGG + Intronic
970674126 4:18429525-18429547 ATCATTAAGAATTTAGAGAACGG + Intergenic
971039683 4:22737918-22737940 GTTTTTTAGACTTTGGAGTAAGG - Intergenic
971206993 4:24580399-24580421 TTTTTTTATTTTTTAGAGACAGG - Intronic
971229320 4:24786836-24786858 CTTTTCTAGAAAATAGAGAAGGG - Intergenic
971279672 4:25232756-25232778 TTTTTTTTGCATTTTGAGGAGGG + Intronic
971875677 4:32305458-32305480 AGTTTTTAGAATTTTTAGAATGG - Intergenic
972151810 4:36100608-36100630 TTTTTTTATAATTTTGATGAGGG + Intronic
972343757 4:38175740-38175762 TTTTTTTAGTTTTTTGAGATAGG + Intergenic
972405249 4:38740005-38740027 TATTTTTTGTATTTAGAGACAGG + Intergenic
972483379 4:39519224-39519246 TTTTTTTTTAATTTGGAGATGGG + Intronic
972488254 4:39562676-39562698 TTTTTTTATTTTTTAGAGACAGG + Intronic
972517849 4:39825966-39825988 TTTTTATATAGTTTAGGGAAAGG - Intronic
972639163 4:40910242-40910264 TTTTTTTAATTTTTAGAGAGGGG + Intronic
972658181 4:41087132-41087154 TTTATTTATTTTTTAGAGAAAGG - Intronic
972662766 4:41132145-41132167 TTTTTTTACAATGTAGATAATGG - Intronic
972869365 4:43277611-43277633 TTTTTTCTGAAGTTAGAGAAAGG + Intergenic
973028163 4:45300180-45300202 TTTTTATAGCAATTTGAGAATGG + Intergenic
973042569 4:45489731-45489753 TTTATTTAGAATTAATACAACGG - Intergenic
973059967 4:45711400-45711422 TTTTTTTGGAATTTATTGACTGG + Intergenic
973297001 4:48534672-48534694 TATTTTTAGCTGTTAGAGAAAGG - Exonic
973976706 4:56270228-56270250 TTTTTTTATTTTTTAGAGATGGG + Intronic
974226947 4:59058893-59058915 TTTTGTTAGTATTTAGCTAAAGG + Intergenic
974390012 4:61254249-61254271 TTTTTTTAGAAGTTTTAAAATGG + Intronic
974392218 4:61286313-61286335 TTTTTTGAAATTTTAGAGTATGG + Intronic
974751598 4:66148746-66148768 TTTTTTTAGATTTTAATGGAAGG + Intergenic
974867175 4:67595525-67595547 TATTTTTACTTTTTAGAGAAAGG - Intronic
974886138 4:67819407-67819429 TTTTTTTTTAATTTAGACACAGG - Intergenic
974939538 4:68449132-68449154 TTTTTTTAGAATTTAAGGGTAGG + Intronic
975090574 4:70397872-70397894 TTTTATTGGAGTTAAGAGAAAGG - Exonic
975135712 4:70872067-70872089 ATTTTTTATATTTTAGAGACAGG - Intergenic
975355272 4:73395400-73395422 TTTTTTTTAAATTTGGAGACAGG + Intergenic
975432110 4:74305692-74305714 ATTCTTTAGGATTTGGAGAAAGG + Intergenic
975539465 4:75491074-75491096 TTTTTTTCAAATTTTTAGAAAGG - Intronic
975708627 4:77136437-77136459 TTTTTTTAAATTTAAGAGACAGG - Intergenic
975898674 4:79123751-79123773 TTTTTTTAAAAATCAGAAAAAGG - Intergenic
975914623 4:79309577-79309599 TTTTTTTAGAATTGAAAACAGGG + Intronic
976252481 4:83067071-83067093 TTTTTTTTGTTTTTAGAGACAGG + Intronic
976290330 4:83411302-83411324 TTTTTTTTAAATTTAGAGATAGG + Intronic
976415035 4:84762938-84762960 TTTTTTTATTTTTTAGAGATTGG - Intronic
976467993 4:85393253-85393275 TTTTATAAGAATATAGGGAATGG + Intergenic
976514598 4:85950492-85950514 ATTTTTTATTTTTTAGAGAAAGG - Intronic
976568556 4:86581243-86581265 TTTTTTTAAATTTCAGACAAGGG - Intronic
976607139 4:86994723-86994745 ATTTGTTAGAGTTTAGATAATGG + Intronic
976628895 4:87217659-87217681 TTTTTTTGGAATATAGAGAAAGG + Intronic
976718597 4:88149206-88149228 TATTTTTATATTTTAGAGAAAGG - Intronic
976759130 4:88529449-88529471 TTTTTTTATTTTTTAGAGACAGG - Intronic
977091640 4:92684116-92684138 TATTTTTAAAATTTACATAATGG - Intronic
977188489 4:93970531-93970553 TATTATTAGGAGTTAGAGAAAGG + Intergenic
977330101 4:95627093-95627115 TTTTTCATGAATATAGAGAAAGG + Intergenic
977727546 4:100314342-100314364 TTCTTTTAGGATTTAGCAAAGGG + Intergenic
977758733 4:100705048-100705070 TTTTTTTTAAATGTAGAGATGGG - Intronic
977890460 4:102304888-102304910 TATTTTTAGAATTATGAGAATGG - Intronic
977942591 4:102875094-102875116 TATTGTTAGAATTTAATGAAAGG - Intronic
978563301 4:110055958-110055980 TTTATTAAGAGTTTAGTGAAGGG + Intronic
978643487 4:110899779-110899801 TCTTTATAGAATTTAAAGAATGG + Intergenic
978738854 4:112114817-112114839 TTTTTTTGGAATTCAATGAAAGG - Intergenic
978851218 4:113339164-113339186 TTATTTTAGAATCTAGAGTCTGG + Intronic
978863862 4:113483780-113483802 TTTTTTTATTTTTTAGAGACAGG - Intronic
979083147 4:116368926-116368948 TTTTTTAAGAATCTAGGGCATGG - Intergenic
979089880 4:116469063-116469085 TTTTCTTTGAGTTTGGAGAATGG + Intergenic
979704537 4:123706596-123706618 ATTTTTAAAAATTTATAGAATGG + Intergenic
979737148 4:124101287-124101309 TATTTTTTAAATTTAGAGACAGG - Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
979952989 4:126918520-126918542 TTTATTTTGAAACTAGAGAAAGG + Intergenic
979967733 4:127095855-127095877 TTGTTTTAGAGATTAGGGAATGG + Intergenic
980028342 4:127793616-127793638 TTATGTGAGAATTAAGAGAATGG - Intronic
980030868 4:127828433-127828455 TTATTTTACAATTAAGAAAACGG + Intronic
980067971 4:128212082-128212104 TTTTTTTAAATTGTAGAGATGGG + Intronic
980153242 4:129074705-129074727 TCTTTTTAAAAATTAGAGACAGG + Intronic
980160496 4:129156430-129156452 ATGTTTGAGAATCTAGAGAACGG - Intergenic
980314101 4:131174029-131174051 TTTTTTTACAATTAAAAAAAGGG + Intergenic
980407539 4:132373033-132373055 TTTTTTTATAATATAGTGGAAGG + Intergenic
980656443 4:135793429-135793451 TTTTGTTATAACTTACAGAAAGG + Intergenic
980701706 4:136441404-136441426 TTATTTTGGAATTTAAAAAATGG - Intergenic
980889565 4:138799997-138800019 TCTGATTAGATTTTAGAGAAGGG + Intergenic
980904555 4:138934782-138934804 TTTTTTTCTGATTTAGAAAAAGG - Intergenic
980950066 4:139366612-139366634 TTTTTTTAAATTTTTGAGACAGG + Intronic
980968956 4:139551379-139551401 TATTTACAGAAGTTAGAGAAAGG + Intronic
981024988 4:140069008-140069030 CTTTTTCAGAATATAAAGAAGGG - Intronic
981207232 4:142057050-142057072 TTCTTTTAAATTTTAGAGTATGG + Intronic
981291569 4:143082448-143082470 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
981389049 4:144166391-144166413 TTTTTTTTGGATTTTGAGACGGG - Intergenic
981447623 4:144858407-144858429 TTGTTTCAGAATTAAGAAAATGG - Intergenic
981510732 4:145554793-145554815 ATTTTTGAGAATTCAGAGACAGG - Intronic
981945561 4:150339551-150339573 ATTTTTTAGAATATAGAAAGAGG + Intronic
982015882 4:151153251-151153273 TTTTTTTATTTTTTAGAGACAGG + Intronic
982071178 4:151695761-151695783 TTTTTTTAAAGTTTAGAGACAGG + Intronic
982124985 4:152176802-152176824 TTTTTTTAGCCTTTAGAGACAGG + Intergenic
982232195 4:153219565-153219587 TTATTTTAGAATTTTAAAAATGG + Intronic
982268777 4:153565420-153565442 TTATTTTAGAAATTATAGAATGG + Intronic
982551425 4:156805336-156805358 ATTTTTTTGTATTTAGAGACTGG - Intronic
982861899 4:160462997-160463019 TATTTTTGGAATTAAAAGAAGGG - Intergenic
982896572 4:160936305-160936327 TTTTTTTTGAATTGAGATGATGG + Intergenic
982916622 4:161218397-161218419 TTATTTTCGTATTTAGAGACGGG - Intergenic
983196617 4:164813586-164813608 TTTTTTTTTAATATAGAGATGGG - Intergenic
983368063 4:166820809-166820831 TTTTTTAAAAATTTTGAGACGGG - Intronic
983443756 4:167821776-167821798 TTTTTATAGCATTATGAGAAAGG + Intergenic
983619613 4:169746512-169746534 TTTTTTTAAAGGTTAAAGAATGG - Intronic
983632516 4:169863659-169863681 TTTTTTTTTAATATAGAGATGGG + Intergenic
983728075 4:170954929-170954951 ATTTTCTAGAGTTTAGAAAAAGG - Intergenic
983758165 4:171368401-171368423 TATTTGTAGCACTTAGAGAAAGG - Intergenic
983806021 4:171993137-171993159 TTATTATAGAATTCAGACAATGG + Intronic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
984007437 4:174329670-174329692 TTTTTTTTAGGTTTAGAGAAAGG + Intronic
984032544 4:174621935-174621957 AATTTTTAAAATTTAGAGATGGG + Intergenic
984153561 4:176165153-176165175 TTTTTTTGTATTTTAGAGATGGG - Intronic
984479195 4:180277171-180277193 TTGTTTTAAAATTTTCAGAATGG - Intergenic
984555123 4:181204403-181204425 ATTTTTTAAAATTAACAGAATGG - Intergenic
984556560 4:181220835-181220857 TTTTTTTACAATGTAGAAAATGG - Intergenic
984582107 4:181521921-181521943 TTTTTTTTTAAATTAGAGACGGG - Intergenic
984607034 4:181797185-181797207 TTCTTTTAGGATTGAGAGGAAGG - Intergenic
984672021 4:182501115-182501137 TTTTTCTAGAATTTTAAGAGTGG - Intronic
984924917 4:184798318-184798340 TGTTTTTAGATATTGGAGAAGGG - Intronic
985054138 4:186021378-186021400 TTTATTTAAACTCTAGAGAAAGG - Intergenic
985482444 5:123424-123446 TTTTTGGAAAAATTAGAGAAGGG + Intergenic
986015775 5:3755479-3755501 TTTTTTTTTAATTGAGATAAGGG + Intergenic
986046898 5:4046971-4046993 TTTTTTTCTACTTTAGATAAGGG - Intergenic
986340073 5:6781302-6781324 TTTTTTTATTTTTTATAGAATGG + Intergenic
986513445 5:8534099-8534121 TTTTTTGATAATTTAGAAAGTGG + Intergenic
986920329 5:12672461-12672483 TATTTTTATAATTTGGAGACAGG - Intergenic
986973298 5:13363355-13363377 AATTTTAAGAAATTAGAGAATGG + Intergenic
987074714 5:14370128-14370150 TTTTTTTTTAATTCAGCGAAGGG + Intronic
987086778 5:14477376-14477398 TATTTTTAGAAGTTAGTGACAGG + Intronic
987178438 5:15341151-15341173 TTTTTATAGAAATGTGAGAATGG - Intergenic
987436283 5:17897549-17897571 TTACTTTAGAAAATAGAGAATGG + Intergenic
987709249 5:21487647-21487669 TTTTTTTTAAATTAAGAGACAGG - Intergenic
987994737 5:25262131-25262153 TTCTTTTAGAAGTTAGTGTAAGG + Intergenic
988401878 5:30773026-30773048 AATTTTTAGAATTTAGAAAAAGG - Intergenic
988465129 5:31482823-31482845 TTTTTTTAATTTTTAGAGATAGG + Intronic
988468965 5:31518947-31518969 TTTTTTTAACACTTTGAGAAGGG + Intronic
988750363 5:34186505-34186527 TTTTTTTAAAATTAAGAGACAGG + Intergenic
988805671 5:34738250-34738272 TTTTTTTAAATTTTAGAGATGGG - Intronic
988910659 5:35838418-35838440 TTTTTTGAGAATTTGGAGCAAGG + Intergenic
988949798 5:36244847-36244869 ATTTTAGAGAATTTAGAGAGAGG + Intergenic
989025560 5:37063296-37063318 TATTTTTAAATTTTAGAGTAAGG - Intronic
989068012 5:37483054-37483076 TTTTTTTTAAATTAAGAGACAGG - Intronic
989532086 5:42519678-42519700 TTTATTTAAAATGTAGATAAGGG - Intronic
989573480 5:42967401-42967423 TTTTTTTTAATTTTAGAGACTGG - Intergenic
989803416 5:45573664-45573686 TTTTTTAAGTATATAGTGAATGG - Intronic
989971550 5:50531079-50531101 TTTATTTACATTTTAGAGACAGG - Intergenic
990090571 5:52041777-52041799 TTTTATCAGGATTTATAGAAAGG - Intronic
990120412 5:52444238-52444260 ATGTTTTAGTATTTAGAGACAGG + Intergenic
990146853 5:52770866-52770888 TTTTTTTTAATTTTAGAGATGGG + Intergenic
990409924 5:55532493-55532515 TTTGTTTATATTTTAGTGAAAGG - Intronic
990470245 5:56108726-56108748 TTTTTTTAAAAAGTAGAAAAGGG - Intronic
990477759 5:56177603-56177625 TTTTTTTTGAATTTTTAGACAGG - Intronic
990618442 5:57532384-57532406 TTTTTTTAGAATTTTGGATAAGG + Intergenic
990628095 5:57636725-57636747 TTTTGTTCAAATTTACAGAACGG - Intergenic
990765881 5:59182261-59182283 TTTTTTTAAAGTTTTGAGATAGG + Intronic
990778548 5:59331751-59331773 TTTTATTAGAATTGCAAGAAAGG - Intronic
990958868 5:61371884-61371906 ATATTTTAGAATTTACAGATTGG + Intronic
991112876 5:62921370-62921392 TTTTTTTAGTTTTGAGAGACAGG - Intergenic
991315305 5:65297045-65297067 TTTATTTAGACTATAGAGAAAGG - Intronic
991452365 5:66766519-66766541 TTTTTTTTTTACTTAGAGAAAGG + Intronic
991552517 5:67855990-67856012 TTTTTTTTGAATTTTAAAAAGGG - Intergenic
991592062 5:68263378-68263400 TTTTTTGAGAATGTAGTGATAGG + Intronic
991662799 5:68967489-68967511 TTTTTTAAAAAATTAGAGACAGG - Intergenic
991738624 5:69649704-69649726 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991759574 5:69906723-69906745 TTTTTTTTTAATTAAGAGACAGG - Intergenic
991787762 5:70211395-70211417 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991790199 5:70229445-70229467 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991814947 5:70504536-70504558 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991818083 5:70525821-70525843 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991838803 5:70781789-70781811 TTTTTTTTAAATTAAGAGACAGG - Intergenic
991880207 5:71211759-71211781 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991882647 5:71229785-71229807 TTTTTTTTAAATTAAGAGACAGG + Intergenic
991985717 5:72284416-72284438 TTTTTTTTTAATTTAAAGACAGG - Intronic
992345404 5:75871062-75871084 TTATTTCAGAATTGAAAGAATGG + Intergenic
992445359 5:76828493-76828515 TTTTTTTTTAATATAGAGACAGG + Intronic
992481118 5:77153254-77153276 TTGTTTTATAATTTAAAAAAAGG + Intergenic
992697509 5:79304773-79304795 TTTTTTGATAATTTAGAGAATGG - Intronic
992705799 5:79391010-79391032 TTTTTTTAGCATTTTGAAAGGGG - Intronic
992712014 5:79467945-79467967 TTTTTTTAGTTTCTAGAGATGGG + Intronic
992746370 5:79824980-79825002 TTTCTGTAGATTTTAGAGAGAGG - Intergenic
992929931 5:81632940-81632962 TCCTTTTAGGATTTAGGGAAAGG - Intronic
992952673 5:81876087-81876109 TTTATTTTTAATTTAGAGATGGG + Intergenic
993224339 5:85147243-85147265 CTTTTGTAGAATATACAGAAGGG + Intergenic
993313231 5:86364441-86364463 TTTTTTTTAATTTTTGAGAAAGG + Intergenic
993357107 5:86927948-86927970 TTTTTGTAGAAATTAGTGACGGG + Intergenic
993424352 5:87744078-87744100 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
993512317 5:88786441-88786463 ATGTTTTAGAATTTAGAGAGGGG + Intronic
993565854 5:89474164-89474186 TTTTTTCAGAATTTAGAACTTGG + Intergenic
993588486 5:89762466-89762488 TTTTTTGAGTACTTAGAAAATGG + Intergenic
993645637 5:90457120-90457142 TTTTTATAGTATGTAGTGAAGGG + Intergenic
993732953 5:91444685-91444707 TTTTTTTTTAATTTAAAAAAAGG + Intergenic
993928749 5:93908677-93908699 TTTTTTTACAATTTCTACAAAGG + Intronic
993962867 5:94321936-94321958 TTTGTTTGGAATTCAGAGTAGGG - Intronic
994011860 5:94913878-94913900 TTTGTTTTGTTTTTAGAGAAAGG + Intronic
994226247 5:97254458-97254480 TTTTTTTTAAATTTTGAGACAGG + Intergenic
994421370 5:99528990-99529012 TTTTTTTTAAATTAAGAGACAGG - Intergenic
994485672 5:100385324-100385346 TTTTTTTTAAATTAAGAGACAGG + Intergenic
994639094 5:102383744-102383766 TTTTTTAAAAAGTTTGAGAAAGG + Intronic
994733330 5:103521045-103521067 TATTTTTAAAATTTAGAGATGGG - Intergenic
994813254 5:104549992-104550014 TTTTTTTTTAATGTAAAGAAAGG + Intergenic
994881027 5:105496524-105496546 TTTGTATAGAATTTAATGAAGGG - Intergenic
994905009 5:105829340-105829362 TTTTTTTTTAAGTTGGAGAAAGG + Intergenic
994910749 5:105902966-105902988 TATTTTTCGATATTAGAGAAAGG - Intergenic
995150242 5:108835137-108835159 TTTTTTTAAATTTTAGATAATGG + Intronic
995378018 5:111499675-111499697 TTTTTTTTAAATTTTGAGACAGG - Exonic
995437486 5:112153211-112153233 TTTTTTTAAATTTTTGAGACAGG - Intronic
995487678 5:112655750-112655772 TTTTTTTTTAATATAGAGATGGG - Intergenic
995551981 5:113290853-113290875 TTTTTTTAAAATTGAGATTAAGG - Intronic
995704510 5:114973382-114973404 TTTTTCAAAAATTAAGAGAATGG - Intergenic
995758434 5:115538110-115538132 TTTTTTTAAACTTTAGCAAATGG + Intronic
995917089 5:117261025-117261047 TTTTTTTTTAATTTAAAAAATGG + Intergenic
996030614 5:118700285-118700307 TTTTTTTTTAATTTAGTGAGAGG + Intergenic
996461971 5:123755356-123755378 TTTTTTTAGATTTTTGGGAGGGG + Intergenic
996573136 5:124954193-124954215 TTTTTTTTAAATTTAGAGATGGG - Intergenic
996705779 5:126497004-126497026 TTTTTTTTCAAATTAGAAAAGGG - Intergenic
996918838 5:128743444-128743466 TTTTTTTTTTATTGAGAGAAGGG - Intronic
997030397 5:130120935-130120957 TTTTTGTACAAATTAGAAAAAGG - Intronic
997055963 5:130445010-130445032 TGATTTTAGAAATTAGAAAAAGG - Intergenic
997096476 5:130919006-130919028 TTTTTTTAAAAGTAAAAGAATGG + Intergenic
997288331 5:132700826-132700848 GTATTTTAGAATTTATAAAAAGG - Intronic
997448376 5:133960569-133960591 TTTTTTTTGAATTTAGGAGAGGG - Intronic
997537104 5:134631074-134631096 TTTTTTTTTAATGTAGAGACTGG + Intronic
997580903 5:135016288-135016310 TTTTTTTACATTTTAGAGACGGG - Intergenic
997908750 5:137847312-137847334 TTTGTTTTGATTTTAGAGACAGG - Intergenic
997934062 5:138095511-138095533 TTATTTTAGAAGATAGAGAAAGG + Intergenic
997944837 5:138190856-138190878 TTTTTTTGTAATTTATAGATAGG - Intronic
998096501 5:139398565-139398587 TTTATTTATTATTTAGAGACAGG - Intronic
998225941 5:140326283-140326305 TTTATTTAGTTTTTAGAGATGGG + Intergenic
998469199 5:142370206-142370228 TTTTTTTTTTATTTAGAGATGGG + Intergenic
998619245 5:143776281-143776303 TTTTTTTAGGTTTTAAAGACAGG - Intergenic
998766204 5:145490383-145490405 TTATTTTAGAATTTATATTATGG + Intronic
998842056 5:146264522-146264544 ATCTTTAAGAATTTAGTGAAGGG + Intronic
998865088 5:146491156-146491178 TTTTTTTTGCATGTAGAGATGGG + Intronic
999727333 5:154447074-154447096 TTGGTTTAGACTTTAGAGCAGGG + Intronic
999759002 5:154685816-154685838 TTTTTTTAAATTTTAGAGACGGG + Intergenic
999780545 5:154846554-154846576 TTTTTTTAATTTTTAGAGATGGG + Intronic
1000111994 5:158117082-158117104 TTTTTTTTAAATTTTGAGATAGG + Intergenic
1000173662 5:158728734-158728756 TTTTTTTAGTTTGTAGAGATAGG + Intronic
1000348879 5:160337185-160337207 TTTTTTTAGGGTGTAGAGACAGG + Intronic
1000509004 5:162158742-162158764 TTTTATTAGTAATTACAGAAAGG - Intergenic
1000987769 5:167879674-167879696 TTTTTTTAAAGTTTAAATAAAGG + Intronic
1001077597 5:168642114-168642136 TTTTTTTAGCAGTGTGAGAATGG + Intergenic
1001530984 5:172461512-172461534 TGTTTTAAGAATAGAGAGAACGG - Intergenic
1001965920 5:175909929-175909951 TTTTTTTGAATTTCAGAGAAAGG + Intergenic
1002016346 5:176326402-176326424 TTTCTTTATAATTTAGAAACAGG + Intronic
1002128363 5:177063890-177063912 CTTTTTTAAAATTTTGAGACAGG - Intronic
1002148621 5:177207609-177207631 TTTTTTTTTTTTTTAGAGAAGGG + Intronic
1002203977 5:177550141-177550163 TTTTTTTTTAATTTAGAGATAGG - Intronic
1002251025 5:177929271-177929293 TTTTTTTGAATTTCAGAGAAAGG - Intergenic
1002273688 5:178089695-178089717 TTTTTTTAATTTTTAGAGATGGG - Intergenic
1002693509 5:181068270-181068292 TTTTTTTATAGTTTAGGGAAAGG - Intergenic
1002761981 6:209457-209479 AATTTTGAGAATTTTGAGAATGG + Intergenic
1003003206 6:2356913-2356935 TTTTTTTAAAAATTTGAGATGGG + Intergenic
1003406721 6:5832412-5832434 TTTTTTTAAATTTAAGAGATGGG - Intergenic
1003543274 6:7036942-7036964 TTTTTTTAATTTTTAGAGATGGG + Intergenic
1003629754 6:7775877-7775899 TCTTCTTAGAAGGTAGAGAATGG - Intronic
1003639922 6:7868137-7868159 TTCTTTTAGAATCAAGACAAAGG + Intronic
1003710355 6:8582812-8582834 TTTTTTTAGAAGATTGAGTAGGG - Intergenic
1003755903 6:9119793-9119815 TATTTTTAGAATATACTGAAAGG + Intergenic
1003781857 6:9437528-9437550 TTTTTTTAGTATATAAAGTAAGG - Intergenic
1003823472 6:9926518-9926540 TTTTTTTTTACTTTAGAGATGGG + Intronic
1003878270 6:10457342-10457364 TTTATTTAAATTTTAGAGATAGG - Intergenic
1003909159 6:10727648-10727670 TTTTTTTTTAAATTAGAGACCGG - Intronic
1004188595 6:13444518-13444540 TTTTTTTAAACTCTAGAGAAAGG - Intronic
1004431907 6:15552616-15552638 TTTTTCAAGAAAATAGAGAAAGG - Intronic
1004543268 6:16571961-16571983 TTTTTGTAGAATTTAGAAAGAGG - Intronic
1004558333 6:16721811-16721833 TTTATTTAGAATTGAAAGATAGG - Intronic
1004617649 6:17305503-17305525 TTTTTTTAAAATACAGATAAAGG - Intergenic
1004648748 6:17588309-17588331 TTTTTTTTTAAATTAGAGATGGG + Intergenic
1004786653 6:18975158-18975180 TTTCTTTGGAATTTAAAGAAAGG + Intergenic
1005036248 6:21557692-21557714 TCTTTTCAGAATTAAAAGAATGG - Intergenic
1005053907 6:21711760-21711782 ATTTTTTAAAATATAGGGAAGGG - Intergenic
1006201622 6:32297885-32297907 TTTTTTTAAAAAATAGAGATGGG - Intronic
1006390044 6:33752947-33752969 TTTTTTTATATTTTAGAGACAGG + Intergenic
1006491252 6:34390540-34390562 TTTTTTTTATATTTAGAGATGGG + Intronic
1006878340 6:37317658-37317680 TTTTTTTAAAAAGTAGAGCAGGG + Intronic
1006919486 6:37618113-37618135 TTTTTTTAGATTTTAGCGATGGG + Intergenic
1007804271 6:44427593-44427615 GATTTTTAGAAAATAGAGAAAGG + Intronic
1007866821 6:44980237-44980259 TTTTTTTTTTTTTTAGAGAAAGG - Intronic
1008189276 6:48434421-48434443 GTCTTTGAGAAGTTAGAGAATGG + Intergenic
1008196432 6:48528034-48528056 TTTTTTTTTAATTTAAAAAAAGG + Intergenic
1008275317 6:49537289-49537311 TTCTTTTATAATTTGGAGACGGG + Intergenic
1008360542 6:50612526-50612548 TTGTTTTATAATTTGGAGCAAGG - Intergenic
1008401394 6:51067655-51067677 TTTTGTTACTGTTTAGAGAAGGG + Intergenic
1008479970 6:51975951-51975973 TTTTTTTTTTAATTAGAGAAAGG - Intronic
1008490458 6:52081547-52081569 TTTTTTTGTAATTTACACAAAGG - Intronic
1008546040 6:52584475-52584497 TTTTTTTAGTTTTTTGAGACAGG - Intergenic
1008605433 6:53134794-53134816 TATTTTGAGTTTTTAGAGAAGGG - Intronic
1009019190 6:57933910-57933932 TTTTTTTTAAATTAAGAGACAGG + Intergenic
1009266225 6:61558388-61558410 TTTTTGTAGTTTTTAGAGACAGG - Intergenic
1009530606 6:64808798-64808820 TTATTTTAGAACTAAGACAATGG - Intronic
1009557064 6:65184436-65184458 TTTTTATAGTATTGGGAGAAGGG - Intronic
1009571482 6:65390876-65390898 TTTTTTTATTTTTTAGAGACGGG - Intronic
1009581501 6:65540613-65540635 TTCTTTTAAAACTTAGAGAAAGG + Intronic
1009583864 6:65570904-65570926 TTCTTTTAGAATATAAACAAAGG - Intronic
1009840334 6:69063969-69063991 TTTTTTTTCAATGTAAAGAAAGG - Intronic
1009902745 6:69828785-69828807 TTTTCTGAGAATTGAGAGTATGG + Intergenic
1010177781 6:73049874-73049896 TTCTTTTAGACTTTAGACAATGG - Intronic
1010193561 6:73217820-73217842 TTTGTTTTGAGTTTAGAGACAGG + Intronic
1010266313 6:73872147-73872169 TGTTTTTGAAATTTAGACAATGG - Intergenic
1010305611 6:74318088-74318110 TCTTTTTGGAATTGAGAGAGTGG + Intergenic
1010519443 6:76814834-76814856 TTATTTTAAATTTTGGAGAATGG + Intergenic
1010605491 6:77885189-77885211 TTTTTTTTTAATTTTGAGACAGG + Intronic
1010924486 6:81727362-81727384 TTTTGTTAAAATTTAGAGAATGG + Intronic
1011035659 6:82971593-82971615 TTTTTTTAAAATATTGAGACAGG + Intronic
1011266138 6:85521237-85521259 TTTCTTTTGTTTTTAGAGAAAGG + Intronic
1011493770 6:87919084-87919106 TTTTTTTTAAATTTCCAGAAAGG + Intergenic
1011591518 6:88974729-88974751 TTTTTTTTGAATTTTGAGACAGG - Intergenic
1011605231 6:89097523-89097545 TTTTTTTAAATTTTAGAGACAGG + Exonic
1011625177 6:89277632-89277654 TTTTTTTAGATTTTAGATTCAGG - Intronic
1011635768 6:89371795-89371817 TTTGTTTAGATATTATAGAAGGG + Intronic
1011677581 6:89750079-89750101 TTTTCTAGGAATTCAGAGAATGG - Intronic
1011930978 6:92712328-92712350 ATTTTTAATATTTTAGAGAAAGG - Intergenic
1012008752 6:93753122-93753144 TTTTTTAAGAAATGAGATAAAGG + Intergenic
1012252692 6:96996339-96996361 AATTTTTAGAATTGAGAAAAGGG + Intronic
1012582404 6:100884470-100884492 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
1012752138 6:103177614-103177636 TTGTTATAGAATTTAGAGGAAGG - Intergenic
1012894397 6:104932297-104932319 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
1012955325 6:105563749-105563771 TTCTTTTAAACTTTAGAGGATGG + Intergenic
1012969190 6:105708397-105708419 ATTTATAAGAATGTAGAGAATGG - Intergenic
1013228148 6:108135925-108135947 TTGTTTTTCAATTTAGAGATAGG + Intronic
1013278932 6:108616332-108616354 TTTTTTTATTTTTTAGAGACGGG + Intronic
1013460057 6:110366121-110366143 TTTTTTTGTAATTGAGAGAGGGG - Intergenic
1013525894 6:110973709-110973731 TATTTTTAAAAAATAGAGAAGGG + Intergenic
1013779307 6:113712586-113712608 TTATTTTATTATTTAGAGATAGG + Intergenic
1013828419 6:114243370-114243392 TTATTTAAGAAGTCAGAGAAAGG - Intronic
1013866534 6:114704499-114704521 CTTTAGTAGAATTCAGAGAATGG + Intergenic
1014192576 6:118514808-118514830 TTTTTTTCTATTTTAGAGACAGG + Intronic
1014241373 6:119021672-119021694 TTTATTTAGTTTTTAGAGATGGG - Intronic
1014430064 6:121359433-121359455 TTTTTTGAAAAATGAGAGAATGG - Intergenic
1014444346 6:121509913-121509935 TATTTTTTAAATTTAGAGACAGG + Intergenic
1014541491 6:122681387-122681409 ACTTTTTAGAATTCAGAAAAAGG + Intronic
1014610282 6:123535131-123535153 TTCTATTTGAATTTTGAGAAGGG + Intronic
1014797583 6:125744811-125744833 TTCTTTTAGAATTCAGTGACTGG + Intergenic
1014894025 6:126878173-126878195 TTTTTTTAGAACTTACAGCAGGG - Intergenic
1014973105 6:127843583-127843605 TTTCTTTAAAAATTAAAGAAAGG - Intronic
1015299398 6:131635362-131635384 TTTTTTTATACTTTTGAGACAGG + Intronic
1015453188 6:133394338-133394360 TTTTTCTAGAATTTTAAGAGTGG - Intronic
1015511618 6:134043385-134043407 TTATTTTAAAATTAAAAGAATGG + Intronic
1015521025 6:134131276-134131298 TTTTTATAGCAGTGAGAGAATGG + Intergenic
1015647534 6:135410362-135410384 TTTTGTTTTAATTTAGAGACAGG - Intronic
1015711322 6:136143984-136144006 TTCTTTTAGTATTTTGAGATGGG + Intronic
1015780321 6:136858741-136858763 TTTTTTAAAAATCTACAGAATGG + Intronic
1015828826 6:137345479-137345501 TTTTATTCCAATTTATAGAAAGG + Intergenic
1015975981 6:138791250-138791272 TTTTTTTTGTTTTTAGATAACGG + Intronic
1016037406 6:139397244-139397266 TTTTTTTAAATTTTAGAGACAGG + Intergenic
1016129666 6:140451377-140451399 TTTTTCTAAAATATACAGAAAGG - Intergenic
1016504103 6:144758292-144758314 TTTTTTTACTTTTTAGAGACTGG - Intronic
1016851290 6:148621760-148621782 GTTGATAAGAATTTAGAGAAAGG + Intergenic
1017093714 6:150785019-150785041 TTTTTTTTAATTTTAGAGACAGG - Intronic
1017185983 6:151600956-151600978 TTTATATACAATTTACAGAATGG - Intronic
1017194600 6:151686079-151686101 TTTTTTTTTTATTTAGAGACGGG + Intronic
1017303899 6:152893986-152894008 TTTTTTATGACTCTAGAGAAAGG + Intergenic
1017307516 6:152936177-152936199 TGTTTCTAAAATTTAGAGCAAGG - Intergenic
1017419070 6:154253875-154253897 TTTTTTAAAAATTTAAAGAAAGG - Intronic
1017591447 6:155982226-155982248 TTTTTCTAGAACTAAGAGACAGG + Intergenic
1017595689 6:156026396-156026418 TTTTTTTAAAAGTGAGGGAATGG + Intergenic
1017643292 6:156515007-156515029 TTTTTGTAGAATTTAGAGCACGG + Intergenic
1017807316 6:157956744-157956766 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1017817027 6:158023250-158023272 TTTTTTTTAAATTTAGAGACAGG - Intronic
1017931610 6:158960228-158960250 TTTTTTTCTAATTTATAAAAAGG + Intergenic
1017950575 6:159131813-159131835 TTTCTTTAGTATTTAGGGGAAGG - Intergenic
1018218684 6:161557314-161557336 TATTTTAAGAATTTAAATAATGG + Intronic
1018226562 6:161634836-161634858 CTTTTTCACAATTGAGAGAAAGG + Intronic
1018245443 6:161818338-161818360 TTTTTTTAATTTTTAGAGATGGG + Intronic
1018253189 6:161892731-161892753 TTTTTTTATTGTTTAGAGATAGG - Intronic
1018375496 6:163207248-163207270 TTTATTTATAATTTAGAGTATGG + Intronic
1018404531 6:163464779-163464801 GTTTTTTGGAAGTTTGAGAAGGG - Intronic
1018470911 6:164097079-164097101 TTGTTTTAGATTTTAGAAAGTGG + Intergenic
1018493558 6:164323657-164323679 TCTTTTTAGATTTTAGAGATAGG + Intergenic
1018547692 6:164956245-164956267 TTTTTAAAGTATTTAGAGAAAGG + Intergenic
1018597436 6:165497488-165497510 TTCTTTTAGATATGAGAGAAAGG - Intronic
1018948160 6:168360877-168360899 TTTTTTTAAAATATAGTGCATGG - Intergenic
1018997486 6:168721101-168721123 TCTTTTTGCAACTTAGAGAAAGG - Intergenic
1019415598 7:925347-925369 TTTTTTTTAAATATAGAGACGGG - Intronic
1019532835 7:1512135-1512157 CTTTTTTTAAATTTAGAGACAGG + Intergenic
1019585722 7:1801955-1801977 CTTTTTTAAATTTTAGAGACAGG - Intergenic
1019966322 7:4501616-4501638 TTTTTTTACATTTTATGGAAGGG + Intergenic
1020031409 7:4935463-4935485 TTTTTTTAGCATTTAAAAAATGG + Intronic
1020051008 7:5081674-5081696 TTTTTTAAGACTTTAGAAAATGG + Intergenic
1020216151 7:6192390-6192412 TTTTTTTTAAATTTAAAGACAGG + Intronic
1020259450 7:6522504-6522526 TTTTTTTTAATTTTAGAGACAGG + Intronic
1020288977 7:6707897-6707919 TTTTTTTTTAATTTTGAGACAGG + Intergenic
1020397913 7:7738095-7738117 TTTTTTTTGAATTGATAAAAGGG + Intronic
1020537638 7:9421821-9421843 TTTTTTTAAATTTTAGAGACAGG + Intergenic
1020592885 7:10165890-10165912 AGTTTATAGAATTTACAGAAAGG - Intergenic
1020704588 7:11528160-11528182 TTTTATTTTATTTTAGAGAATGG - Intronic
1020723434 7:11778271-11778293 TTTTTTTATCATTTAGAAATAGG - Intronic
1020804248 7:12768898-12768920 TTTTTTTTTTTTTTAGAGAAGGG - Intergenic
1020924430 7:14307249-14307271 TTGTTTTAGAAATTAGAAAGAGG - Intronic
1020968939 7:14908711-14908733 TCTTTATAGAAGTTACAGAAAGG - Intronic
1020976528 7:15013599-15013621 TTTTTTAATATTTTAGAGATTGG + Intergenic
1021010689 7:15461318-15461340 TTTTTTTTGAAAATAGAAAAGGG - Intronic
1021013948 7:15508746-15508768 TTTTTTTAACATTTAGAGAGGGG + Intronic
1021154937 7:17198366-17198388 TGTATTTAGCATTTAGAAAACGG - Intergenic
1021179697 7:17491604-17491626 ATTTTTTAAATTTTAGAGACAGG + Intergenic
1021413197 7:20351885-20351907 TTTTTTTTTAAGTTGGAGAAAGG + Intronic
1021549204 7:21851823-21851845 TTTTTTTCCTATTTTGAGAACGG + Intronic
1021562236 7:21979983-21980005 TTTTTGTTTGATTTAGAGAAAGG - Intergenic
1021729695 7:23584539-23584561 TTTTTTTAAATTTTTGAGACAGG + Intergenic
1021747969 7:23762616-23762638 TTTATTTTTAATTAAGAGAAAGG + Intronic
1021788698 7:24178412-24178434 TTTTTTTATTTTTTAGAGATAGG - Intergenic
1021812936 7:24421270-24421292 TTTTTTTTGTTTTTTGAGAAAGG - Intergenic
1022379452 7:29846251-29846273 TTTTTTAAAAATTCACAGAAAGG + Intronic
1022584734 7:31596765-31596787 TTATATTGGAATATAGAGAATGG + Intronic
1022589201 7:31644918-31644940 TATTTGTGGAATTAAGAGAATGG - Intronic
1022686516 7:32602344-32602366 TTTTTTTTCATTTTAGAGATAGG - Intergenic
1022748745 7:33201719-33201741 TTTTTTTTTATTTGAGAGAAGGG + Intronic
1022946314 7:35288173-35288195 TATTTTAAGAAGTTAGAAAAAGG + Intergenic
1023002650 7:35827417-35827439 TGATTTTAGAATTTAGGGTATGG + Intronic
1023175440 7:37431329-37431351 TTTTTTTTTATTTTAGAGACAGG - Intronic
1023230513 7:38023016-38023038 TTGTTTTATAATTTTGAGATAGG + Intronic
1023318506 7:38967616-38967638 TTTTTTTATAAGTTACAAAATGG - Intergenic
1023389256 7:39692600-39692622 TTTTTTTAGAGTTAATAGATTGG - Intronic
1023408911 7:39867665-39867687 GTTTTTTGAAATTCAGAGAAAGG + Intergenic
1023518303 7:41025786-41025808 TCTTTTTAGAATGGAAAGAAGGG + Intergenic
1023783940 7:43686603-43686625 TCTTTTAATAAATTAGAGAAAGG + Intronic
1023920511 7:44625965-44625987 TTCTTTTAAATTTTAGAGACAGG - Intronic
1023941755 7:44772856-44772878 TTTTTTTATTTTTTAGAGATGGG + Intergenic
1023974861 7:45021249-45021271 TTTTTTTATTTTTTAGAGACAGG - Intronic
1024022373 7:45383955-45383977 TTTTTTTTTAATTTTGAGACAGG + Intergenic
1024077197 7:45827592-45827614 TTTTTTTATTTTTTAGAGACAGG - Intergenic
1024093669 7:45967903-45967925 TTTTTTTATCTGTTAGAGAAAGG - Intergenic
1024213930 7:47230429-47230451 TTTTTTAAGAAAATAGAGATCGG - Intergenic
1024421599 7:49173600-49173622 TTTTTTTTGAATTTAGAGATGGG - Intergenic
1024456429 7:49613584-49613606 TTTCTTTTTAATGTAGAGAAGGG + Intergenic
1024881723 7:54093992-54094014 TTGTTTCAGAATGTAGAAAAAGG - Intergenic
1025044027 7:55676371-55676393 GTTTTTTGTAATTCAGAGAAAGG - Intergenic
1025127220 7:56353828-56353850 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1025136951 7:56424896-56424918 GTTTTTTGTAATTCAGAGAAAGG - Intergenic
1025192566 7:56907218-56907240 TTTTTTTTCAATTTAGAGACAGG + Intergenic
1025533845 7:61923634-61923656 TTTTTTTAGAATCTGCAAAAGGG + Intergenic
1025545690 7:62164310-62164332 TTTTTTTAGAATCTGCAAAAGGG - Intergenic
1025578467 7:62678987-62679009 TTTTTTTTCCATTTAGTGAATGG + Intergenic
1025595729 7:62922949-62922971 TTTTGGTAGAATTTTGAGAAGGG + Intergenic
1025679380 7:63669702-63669724 TTTTTTTCCAATTTAGAGACAGG - Intergenic
1026189104 7:68108466-68108488 TTTTTTTTCTATTTAGAGACAGG - Intergenic
1026334163 7:69379437-69379459 TTTTTTTAAATTTTCTAGAACGG - Intergenic
1026504749 7:70972658-70972680 TTTTTTTAAATTTTAGAGACTGG - Intergenic
1026640912 7:72124644-72124666 TATTATTACTATTTAGAGAAAGG - Intronic
1026782298 7:73276864-73276886 TTTTTTTTGTATTTTGAGATAGG - Intergenic
1027023060 7:74829706-74829728 TTTTTTTTGTATTTTGAGATAGG - Intronic
1027064865 7:75115604-75115626 TTTTTTTTGTATTTTGAGATAGG + Intronic
1027476116 7:78633403-78633425 TTTTTTTTAAAGTGAGAGAATGG + Intronic
1027631439 7:80610876-80610898 TTTTTTTATTTTTTAGAGACAGG + Intronic
1028069094 7:86428133-86428155 TATTTATATAATATAGAGAAAGG + Intergenic
1028286401 7:89008225-89008247 TTTTTTTTAACTTTAGAGACTGG - Intronic
1028347606 7:89801591-89801613 TTTTTTTTTTTTTTAGAGAAAGG + Intergenic
1028356998 7:89922489-89922511 TTTTTTTTAAATTTAGAAACAGG - Intergenic
1028450099 7:90972412-90972434 TTCTTTTAGAATACAGAAAAAGG + Intronic
1028496240 7:91463955-91463977 TTTTCTTAGAGTTTAAAAAAAGG + Intergenic
1028662992 7:93303826-93303848 TTTGTTTTGAATTCAGAAAAGGG + Intronic
1028717568 7:93989414-93989436 GTTTTTTAAAGTTTAGAGAGAGG + Intronic
1028975254 7:96905623-96905645 TTTTTTTTAATTTTAGAGACAGG + Intergenic
1029054823 7:97731407-97731429 TTATTTTACATTTTGGAGAAAGG - Intergenic
1029247926 7:99215963-99215985 TTTTTTTTTTAATTAGAGAAGGG - Intergenic
1029363530 7:100103075-100103097 TTTTTTTTGCTTTTAGAGACAGG + Intronic
1029431009 7:100530348-100530370 TTTTTTTTTAATTTAGAGACGGG + Intergenic
1029564302 7:101325309-101325331 TTTTTTTTTAATTTAAAAAAAGG + Intergenic
1029572250 7:101377909-101377931 TTTTTTTACATTTTAGAGACAGG + Intronic
1029929137 7:104352201-104352223 TCTTTTTGCAATTTACAGAAGGG - Intronic
1030054428 7:105570579-105570601 TTTTTTTTTAAGTTAGAGACAGG + Intronic
1030125008 7:106145188-106145210 TTTTTTTAAACTTTGGAGTAGGG + Intergenic
1030154136 7:106435722-106435744 TTTTTTTTAATTTTAGAGATGGG - Intergenic
1030310570 7:108064902-108064924 TTTTTTTTTAATTTAGAGACAGG + Intronic
1030336360 7:108331393-108331415 TTTTTTTTAAGTTTAGAGACAGG - Intronic
1030659245 7:112202751-112202773 TTTTTTTTTAATTTAGAGACAGG - Intronic
1030824395 7:114137932-114137954 TTTTTTTTCAAATTAGAGAATGG - Intronic
1030981702 7:116193085-116193107 TTTTACTAGAATTTAATGAAAGG + Intergenic
1031020168 7:116619422-116619444 TTGTTTTAGAGTTTGAAGAAAGG - Intergenic
1031023005 7:116648836-116648858 TTTATTTATATTTTAGAGACGGG - Intergenic
1031382815 7:121109436-121109458 AGTCTTTAAAATTTAGAGAAAGG + Intronic
1031564705 7:123281270-123281292 TTTTTATAGAATTAAGAACAGGG + Intergenic
1031800569 7:126238936-126238958 TTTTCTTAAAATTAAGATAACGG + Intergenic
1031845261 7:126798395-126798417 TTTTCTTTACATTTAGAGAAGGG + Intronic
1032002868 7:128276614-128276636 TTTTTTTATTATTTTGAGACAGG - Intergenic
1032054680 7:128674921-128674943 TTTTTTTAGAAAATAGAGATGGG - Intronic
1032070074 7:128799159-128799181 TTTTTTTTTAATGTAGAGATGGG - Intronic
1032095463 7:128936197-128936219 TATTTTTAAAATTTAAAGTATGG - Intergenic
1032174879 7:129614485-129614507 TTTTTTTTTAAGTTAGAGATGGG + Intronic
1032213627 7:129939172-129939194 TTTTTTTAATTTTTAGAGACAGG + Intronic
1032576797 7:133063132-133063154 TTATTTTAAAATTGAGAGGAGGG - Intronic
1032679859 7:134171157-134171179 TTGTTTTACAATTTTAAGAAGGG - Intronic
1032679962 7:134172023-134172045 TTTTTTGAGAATTAAATGAAAGG - Intronic
1032837337 7:135686374-135686396 TTTTTTTTTAATTAAGAGGAGGG + Intronic
1033073285 7:138224293-138224315 TTTTTTAAAATTTTAGAGACAGG - Intergenic
1033136851 7:138792601-138792623 TGTTTTTAAATTTTAGAGACAGG + Intronic
1033170920 7:139083555-139083577 TTTTTGTATAAATTAGAGACGGG - Intronic
1033517753 7:142126416-142126438 TATTTTCAGAATATAGAAAAAGG - Intronic
1033771478 7:144557482-144557504 TTTTTTTTTAATTTTGAGATGGG + Intronic
1033817721 7:145095128-145095150 TTTTTTTTTAAATTAGAGATAGG + Intergenic
1034050018 7:147973146-147973168 TTTTTTTTAATTTTAGAGACAGG - Intronic
1034290374 7:149926379-149926401 TACTTTTAGCATTTAGGGAATGG - Intergenic
1034454362 7:151158465-151158487 TTTTTTTTTAATGGAGAGAAAGG + Intronic
1034605467 7:152308818-152308840 TTTTCTTAAAATGTAGAGATGGG - Intronic
1034660699 7:152766462-152766484 TACTTTTAGCATTTAGGGAATGG + Intronic
1034761441 7:153675531-153675553 TTTCATTAGAATTGAGAAAATGG + Intergenic
1035166221 7:156991708-156991730 TTTTTTTAGAATAAAGACACAGG - Intergenic
1035438498 7:158877704-158877726 TTTTTTTATTTTTTAGAGACAGG + Intronic
1035558034 8:580899-580921 TTTTTTTAAAATTTGGAGATGGG + Intergenic
1035619495 8:1027081-1027103 TATTTCTAGTATTTAGGGAAGGG + Intergenic
1036478702 8:9118603-9118625 TTTTTTTAAATTTTTGAGACAGG + Intergenic
1036496559 8:9275543-9275565 TTTTTTTTAATTTTAGAGATGGG + Intergenic
1036506639 8:9363072-9363094 TTTTTTTACTTTTTAGAGACAGG + Intergenic
1036521351 8:9494408-9494430 TTGTTTTAGAAATTAGGGACAGG - Intergenic
1037099440 8:15025296-15025318 TTTTTTTCTAATTGAGACAAGGG + Intronic
1037419608 8:18688082-18688104 TTTATTTATATTTTAGAGATAGG + Intronic
1037461463 8:19114869-19114891 TTTTTTTTTAATATAGAGACAGG + Intergenic
1037514937 8:19620733-19620755 ATTTTTTAAAATTTAAAAAAGGG - Intronic
1037548704 8:19948922-19948944 TTTTTTTTTAATTTCCAGAAAGG - Intronic
1037873666 8:22525142-22525164 TTTTTTTATTTTTTAGAGACAGG - Intronic
1038042961 8:23741952-23741974 TTTTTTTTGTATTTTGAGATGGG + Intergenic
1038189816 8:25309566-25309588 ATTTTTTAAAATTGAGAGGAAGG + Intronic
1038290644 8:26247036-26247058 TTTTATTATATTTTAGAGACAGG + Intergenic
1038352769 8:26795018-26795040 TTTTTTTAGAATTCAAAGTTAGG - Intronic
1038609510 8:29046974-29046996 TTTTTTTATTTTTTTGAGAAAGG - Intronic
1038716504 8:29996019-29996041 TTTTTTTTAAATTCAGAGACAGG + Intergenic
1038775270 8:30524574-30524596 TTTTTTGAAAAATTATAGAAAGG + Intronic
1038802368 8:30761069-30761091 CTTTTTTAGAACATAGAGACAGG + Intronic
1038908695 8:31937481-31937503 TTTTATTTGAATTTAAAAAATGG + Intronic
1039105030 8:33980998-33981020 TTACTATAGAATTTATAGAAGGG + Intergenic
1039646874 8:39295097-39295119 TTTTTCCAGAACTTAGATAAAGG + Intergenic
1039661886 8:39477092-39477114 TCTTTATAGCATTGAGAGAATGG + Intergenic
1039904513 8:41776252-41776274 TTTTTTCTGAATAGAGAGAATGG - Intronic
1039959603 8:42236170-42236192 TTTTTTTAATATTTAGAGATGGG + Intergenic
1039960625 8:42244553-42244575 TTTTTTTAATTTTTAGAGATGGG + Intergenic
1040404883 8:47090056-47090078 TTTTTTTGTAATTCAGAGAAAGG - Intergenic
1040417050 8:47204809-47204831 TTTTTTTTTAAATTAGAGACGGG - Intergenic
1040705306 8:50119178-50119200 ATTTTTTACCATATAGAGAAAGG - Intronic
1040930563 8:52730566-52730588 TTTTATTATATTTTAGAGACAGG - Intronic
1041058017 8:54007730-54007752 TTAATTCAGAATTTAGGGAAAGG - Intronic
1041234478 8:55785571-55785593 TTTTTTTATTTTTTAGAGATGGG - Intronic
1041342582 8:56861654-56861676 TTTTATTATAATTTAAGGAAAGG + Intergenic
1041539815 8:58971034-58971056 TTTTTTCAGAGTTTAGATAATGG + Intronic
1041810829 8:61907894-61907916 TATTTTTAGCATGTGGAGAAAGG + Intergenic
1041944042 8:63422054-63422076 TGTTTTAAGAATTAAGAGAAAGG + Intergenic
1041996044 8:64059624-64059646 TTTTTTCAAAATTTAGTAAAAGG - Intergenic
1042060026 8:64806560-64806582 TTTTTCTAGTCTTTAAAGAAGGG - Intergenic
1042101741 8:65281671-65281693 TTTTTTTAGTATAAAAAGAACGG - Intergenic
1042443892 8:68861373-68861395 TTTTTCTAGATTATAGAGCAAGG + Intergenic
1042528450 8:69790643-69790665 TTTTTTTTTATTTTAGAGATAGG - Intronic
1042535088 8:69850813-69850835 TTTTTTCAAAATTAAGAGACAGG + Intergenic
1042672219 8:71277142-71277164 TTTTTTTAGTTTTTAGAGACAGG + Intronic
1042691364 8:71503133-71503155 TTTATTAAGTATTTAGTGAAAGG - Intronic
1042911583 8:73833013-73833035 TTTTTTTAGTATTTTTAGTAGGG - Intronic
1043178917 8:77058866-77058888 TTTTTTAAAAATTTAAAAAATGG - Intergenic
1043205171 8:77428740-77428762 TTTTGTAGAAATTTAGAGAATGG - Intergenic
1043328637 8:79085298-79085320 TTTTTTTTTAATTTATAGAAAGG + Intergenic
1043376042 8:79650931-79650953 TTTTTTTTAAATTTAGAGACAGG - Intronic
1043429586 8:80182088-80182110 TATTTTTAAAATATAGAGATGGG - Intronic
1043441063 8:80277535-80277557 TTTTTTTTAAATTTTGAGATGGG + Intergenic
1043702578 8:83309269-83309291 TTTTCTTAGAAATTACATAATGG - Intergenic
1043998535 8:86849054-86849076 TTTTTTTTCATTTTAGAGACAGG + Intergenic
1044231276 8:89781370-89781392 TTTTTTTAGTTTTTAAAGACAGG + Intronic
1044311481 8:90697981-90698003 TTTTTTCAGAATTGTTAGAAAGG - Intronic
1044357913 8:91246252-91246274 CTTTTTTAGAATTTAGCAGAAGG - Intronic
1044497607 8:92906623-92906645 TGTTTTTAAAATTTTGATAATGG - Intronic
1044709412 8:95041206-95041228 TTTTTTTAAATTGTAGAGACAGG - Intronic
1044715944 8:95099572-95099594 TTTTTTTTTAATTTTGAGATAGG - Intronic
1044749781 8:95405185-95405207 TTTTTTTTGTATTTATAGTAGGG + Intergenic
1044834147 8:96279442-96279464 TTTTTTTTAAATTTAGAAGATGG - Intronic
1044975590 8:97662201-97662223 TTTTTTTTTAATATAGAGACAGG + Intronic
1044976148 8:97667818-97667840 TTTTTTTTTAATATAGAGACAGG - Intronic
1044998534 8:97859903-97859925 TTTTTTTTTAATTCAGAGACAGG + Intergenic
1045133490 8:99185790-99185812 TTTATTTAAAATTTAGAAGAAGG + Intronic
1045186384 8:99842606-99842628 TTTTTTTAAAAAATAGAGACGGG - Intronic
1045335657 8:101202109-101202131 TTTTTATAGTATTTATACAACGG + Intronic
1045351702 8:101346939-101346961 TGGTCTTAGAATTTTGAGAATGG - Intergenic
1045415438 8:101961820-101961842 TTTCTTTGGAAATTAGAGTAGGG - Intronic
1045692767 8:104776516-104776538 TTTTTTTTTAAATTAGAGACAGG + Intronic
1045778272 8:105832653-105832675 TTTTTTTAGATATGAGAGAGAGG - Intergenic
1045918216 8:107498991-107499013 TAATTGTAGAATTTAGGGAACGG + Intergenic
1045978484 8:108156489-108156511 TTTCTTTAGAACTCAGAAAACGG + Intergenic
1046307037 8:112382276-112382298 TTTTTTTGCATTTTAGAGACAGG - Intronic
1046380280 8:113440864-113440886 TTTTTTTTTAATTTATATAATGG + Intergenic
1046417019 8:113930372-113930394 TTTTTTCACACTTCAGAGAAAGG - Intergenic
1046426599 8:114060421-114060443 CTTTTGTAGAATAAAGAGAAAGG + Intergenic
1046787294 8:118281790-118281812 TTAGTTTAGAAATTGGAGAAGGG - Intronic
1046811666 8:118539686-118539708 CTTTTTCAGAATTTAGAGTTGGG + Intronic
1047033607 8:120911287-120911309 TTTTTTTATAAATGAGAAAATGG + Intergenic
1047334294 8:123921368-123921390 TTTTTTAAGTTTTTAGAGACAGG + Intronic
1047415543 8:124662003-124662025 TCTTTTTAGATTAAAGAGAAAGG + Intronic
1047432982 8:124808702-124808724 TTTTTTTTGAATTCACACAAAGG + Intergenic
1047661394 8:127040770-127040792 TGTTTTTAGAATTAACAGGAGGG - Intergenic
1048039790 8:130716028-130716050 TTTTTTTAATTTTTAGAGATGGG - Intergenic
1048247526 8:132824353-132824375 ATTGTTGAGACTTTAGAGAATGG + Intronic
1048656047 8:136537155-136537177 TATTTTTAAAAATTAGAGAAAGG - Intergenic
1048755277 8:137731576-137731598 TTTCTTTAGTATTTAGATTATGG + Intergenic
1049112745 8:140658504-140658526 TTTTTTCAAAATTAACAGAATGG + Exonic
1049172873 8:141172903-141172925 TTTTTTTTAAATTTAGAGACAGG - Intronic
1049817691 8:144615313-144615335 TTTTTCTAATTTTTAGAGAAGGG - Intergenic
1049901069 9:165757-165779 TTTTATTAGATTTTGAAGAAGGG - Intronic
1050001740 9:1084528-1084550 TTTTTTTTTTATTTAGAGACAGG - Intergenic
1050110293 9:2208264-2208286 TTTTTGTATTTTTTAGAGAATGG + Intergenic
1050236591 9:3587612-3587634 TTTTTTTAGCAATGTGAGAAAGG + Intergenic
1050360490 9:4826056-4826078 TTTTTCTTTATTTTAGAGAAAGG - Intronic
1050705868 9:8396408-8396430 TGTTTTTAGAATATAGATACAGG - Intronic
1050720557 9:8584146-8584168 TTTTTTAAAAATTTTGAGACAGG - Intronic
1050944247 9:11498267-11498289 TTTTTTTTTAATTTTGAGATGGG + Intergenic
1051104556 9:13564446-13564468 ACTTTTTAGAGCTTAGAGAATGG + Intergenic
1051253734 9:15190345-15190367 GTTTTTTTTAATTTAGAGACAGG + Intronic
1051274436 9:15385448-15385470 TTTTTTTAAATAATAGAGAAAGG - Intergenic
1051438143 9:17054419-17054441 TTTTTTTTTAATGTAGAGACAGG + Intergenic
1051521112 9:17989833-17989855 TTTTTTTAGCATGCAAAGAAAGG + Intergenic
1051563234 9:18466485-18466507 TATTTTTAAAATTTCCAGAAAGG - Intergenic
1051688366 9:19682458-19682480 TTTAGTTAAAATTTACAGAAGGG - Intronic
1051741281 9:20254748-20254770 CTTTATTAGAATTGTGAGAATGG - Intergenic
1051757841 9:20423639-20423661 TTTTTTTTTAATGTAGAGATAGG - Intronic
1051815671 9:21102824-21102846 TTGTTCTAGACCTTAGAGAAAGG - Intergenic
1052189596 9:25643581-25643603 TTTTTCTATAATTTATAGTAGGG - Intergenic
1052377244 9:27731163-27731185 TTTTTATAGCAGTTCGAGAATGG + Intergenic
1052452552 9:28650705-28650727 TTTGTTGAGAATGTAGAGAAGGG - Intronic
1052476061 9:28960889-28960911 TTTTGTTAAAATTTAAATAAAGG - Intergenic
1052544831 9:29863470-29863492 TTGTCTTAGAATATAGAAAAAGG + Intergenic
1052805336 9:33008410-33008432 TTTTTTTTTAAATTAGAGACAGG + Intronic
1052895934 9:33748495-33748517 TTTTCTTTGACTTTATAGAAAGG + Intergenic
1052912280 9:33894259-33894281 TTTTTTTTAAATATAGAGATGGG - Intronic
1052921978 9:33978362-33978384 TTTTTTTTTAAGGTAGAGAAGGG - Intronic
1052983758 9:34469436-34469458 TTTTTTTAATATATAGAGACAGG + Intronic
1053095398 9:35322921-35322943 TTTTTTTAGAAATGTTAGAATGG - Intronic
1053226180 9:36359914-36359936 TTTTTTTTTAAATTAGAGACAGG + Intronic
1053416528 9:37950269-37950291 TTTTTTTGGTTTTTAGAGACAGG + Intronic
1053617711 9:39785922-39785944 TTGTTCTAGATCTTAGAGAAAGG + Intergenic
1053744103 9:41176072-41176094 TTTTATTAGATTTTGAAGAAGGG - Intronic
1054266449 9:62921510-62921532 TTGTTCTAGATCTTAGAGAAAGG - Intergenic
1054349379 9:64005875-64005897 TTTTATTAGATTTTGAAGAAGGG - Intergenic
1054483170 9:65689225-65689247 TTTTATTAGATTTTGAAGAAGGG + Intronic
1054684240 9:68255181-68255203 TTTTATTAGATTTTGAAGAAGGG + Intronic
1054909055 9:70437392-70437414 TTTCTTTATATTTTAGAGACAGG + Intergenic
1055259481 9:74416073-74416095 TTTTTATAGAAGTGTGAGAATGG + Intergenic
1055322137 9:75092581-75092603 TTTTTAGAAAATTTAGAAAAAGG + Intronic
1055327066 9:75141916-75141938 TTTTTTTTTAATGTAGAGATAGG + Intronic
1055462176 9:76529416-76529438 TTTTTTTTAAATATAGAGACAGG - Intergenic
1055540139 9:77295123-77295145 TTTTTTTGGAATTTGGAAATTGG + Intronic
1055637384 9:78292363-78292385 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
1055670926 9:78605509-78605531 TTTCTTTAGAAGCTGGAGAAGGG + Intergenic
1055950617 9:81726391-81726413 TTTTTTTTAATTTTAGAGACGGG + Intergenic
1056039107 9:82642452-82642474 TTTTTTTAAAATTTTGAGACAGG - Intergenic
1056097980 9:83273594-83273616 TTTTTTTAGTATTTATTGATCGG - Intronic
1056175179 9:84027687-84027709 TTTTTTTTTATTTTAGAGACAGG - Intergenic
1056347854 9:85717330-85717352 TTTTTTTATTTTTTAGAGAAGGG - Intronic
1056370988 9:85954084-85954106 TTTTTTTTGTGTTTAGAGACAGG + Intronic
1056401994 9:86236927-86236949 TTTTTTTTTTATTTAGAGACGGG - Intronic
1056410566 9:86322068-86322090 TTTTTTTTAAATTTTGAGACAGG - Intronic
1056626217 9:88255725-88255747 ATTTTTAAAAATTTAGAGATGGG - Intergenic
1056627798 9:88268234-88268256 TTTTTTTATTATTTTGAGACAGG + Intergenic
1056642721 9:88385268-88385290 TTTTTTTAGAGTGTAGTGCAGGG + Intergenic
1056651605 9:88469702-88469724 TTGTTTTATATTTTAGAGATGGG + Intronic
1057026706 9:91739499-91739521 TTTTTTTTAAATTTAAAGACAGG - Intronic
1057099651 9:92346196-92346218 TTTTTTTTTAAATTAGAGATGGG + Intronic
1057129940 9:92647883-92647905 TATTTTTTAAATTTAGAGACAGG - Intronic
1057374703 9:94510058-94510080 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1057788085 9:98103490-98103512 ATTTTTTAAAATTTAAACAATGG - Intronic
1057848317 9:98543369-98543391 TTTATTTATTATTTAGAGACAGG + Intronic
1057898286 9:98927046-98927068 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1057942268 9:99295754-99295776 TTTTCTTTTAATTTAGAGATGGG + Intergenic
1058001595 9:99871396-99871418 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1058018162 9:100059688-100059710 TTATTTTTTATTTTAGAGAAAGG - Intronic
1058410011 9:104721326-104721348 TTTTTTTAAATTTTAGGGCAAGG - Intergenic
1058538314 9:105986190-105986212 TTATTTTAGAGATTAAAGAAAGG - Intergenic
1058672831 9:107375001-107375023 TTTTTTTTTAATTTTGAGACAGG - Intergenic
1058681479 9:107444026-107444048 GTTTTTTAAAATTAAGAGATGGG - Intergenic
1058725326 9:107797736-107797758 TTTTTTTAGAAAATATGGAATGG + Intergenic
1058758942 9:108110709-108110731 TTTTTTTATAATGTGGAGAATGG - Intergenic
1058831229 9:108818618-108818640 TTTTTTTTAAATTTTGAGACAGG - Intergenic
1058878387 9:109264868-109264890 CTTTTTTTGAATTTTGAAAAGGG + Intronic
1058907428 9:109493228-109493250 TGTTTTTTAAATATAGAGAAAGG - Intronic
1059040107 9:110804262-110804284 TTTTATGAAAATTCAGAGAAAGG + Intergenic
1059042844 9:110832581-110832603 TTTATTTAGAATATATTGAATGG - Intergenic
1059126493 9:111691992-111692014 TTTTCTGAGAATTTATAAAACGG + Exonic
1059238959 9:112786673-112786695 TTTTTTTAAACTTTTGAGATGGG + Intronic
1059397157 9:114042821-114042843 TATTTTTATATTTTAGAGATAGG - Intronic
1059758881 9:117319602-117319624 TTTTTTTTTAATGTAGAGATTGG + Intronic
1059891020 9:118804277-118804299 TTTTTTTAGCTTTTAGAGGTAGG - Intergenic
1060095626 9:120786528-120786550 TTTTTTTAGCAGTCTGAGAATGG + Intronic
1060570279 9:124632582-124632604 TTCTTTTAGATTTAGGAGAAAGG + Intronic
1060622351 9:125078896-125078918 TTTTCTTACATTTTAGAGACAGG - Intronic
1061198790 9:129124213-129124235 TTTTTTTTAAATATAGAGACAGG + Intronic
1061362600 9:130153196-130153218 TTTTTTTAACATATAGAGACAGG - Intergenic
1061651305 9:132052563-132052585 TTTTTTTAAAAGAGAGAGAATGG - Intronic
1062283185 9:135761031-135761053 TTTTTTTTTAAATTAGAGATAGG + Intronic
1203528132 Un_GL000213v1:108496-108518 GTTTTTTGTAATTCAGAGAAAGG - Intergenic
1203655790 Un_KI270752v1:23215-23237 TTTTTTTAGTATTTGAAGATTGG + Intergenic
1185997150 X:4964503-4964525 TTTTTTTGGAGTTTATAGACTGG + Intergenic
1186003480 X:5041401-5041423 ATTTTTTAAAATTCAGAGATAGG + Intergenic
1186117816 X:6323458-6323480 TTGTTTTATTATTTAGAGACAGG - Intergenic
1186236577 X:7517388-7517410 TTTATTTTTAATTTAGAGACAGG - Intergenic
1186797829 X:13063790-13063812 TTTTTTTAAATTGTAGAGACAGG + Intergenic
1186827390 X:13354096-13354118 TTATTTTAGAATTTATATTATGG + Intergenic
1186976485 X:14912013-14912035 CTCTTTTAAAAATTAGAGAAAGG - Intronic
1187011246 X:15282313-15282335 TTTTTTGTGAATTTAGAACATGG - Intronic
1187164291 X:16790370-16790392 TTTTTTTAAATTTTAGAGTTGGG + Intronic
1187178454 X:16918412-16918434 TTTATTTATTTTTTAGAGAAAGG - Intergenic
1187436083 X:19271133-19271155 TTTTTTAAAATTTAAGAGAAGGG + Intergenic
1187440082 X:19310420-19310442 TTTTTTTAAATTTTTGAGACAGG - Intergenic
1187810721 X:23173755-23173777 TCTTTTTAGTATATAGATAAAGG + Intergenic
1187986959 X:24824296-24824318 TTTTTTTTTAATTTTGAGACAGG + Intronic
1188013791 X:25085629-25085651 TTTTTATAGGATATAGAGAAAGG - Intergenic
1188097142 X:26037495-26037517 TTTTTTGAGAAATTAGACAATGG - Intergenic
1188447557 X:30272003-30272025 TTTTTTGAGAACATATAGAAGGG - Intergenic
1188990568 X:36814199-36814221 TTTTTGTAGGATTTAGATTAAGG - Intergenic
1188994938 X:36872574-36872596 TTTTTTTTTCTTTTAGAGAAAGG - Intergenic
1189102071 X:38201172-38201194 AGTTATTACAATTTAGAGAAAGG - Intronic
1189147655 X:38671871-38671893 TTTTTTTATTTTTTAGAGATGGG - Intronic
1189275377 X:39781486-39781508 TTTTTTTTTAATATAGAGATGGG + Intergenic
1189390541 X:40572728-40572750 TTTTTTTTTAAATTAGAGATGGG - Intergenic
1189790512 X:44599247-44599269 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1190079003 X:47340484-47340506 ATTTTTTGGAATTTTGAGATGGG - Intergenic
1190094332 X:47466889-47466911 TTTCTTTGGAACTTAGAGACTGG - Intronic
1190129102 X:47730524-47730546 TTTCTTTGGAACTTAGAGACTGG + Intergenic
1190426775 X:50340709-50340731 TTTTTTTCTAATTTGCAGAAAGG + Intronic
1190460314 X:50666804-50666826 TTTTTTTATGACTGAGAGAAGGG + Intronic
1190617307 X:52248067-52248089 TTTTTTTAGCTTTTTGAGATGGG + Intergenic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1190806214 X:53839702-53839724 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1191239253 X:58168309-58168331 TTTTTGTAGAATCTACAAAAGGG + Intergenic
1191867080 X:65712556-65712578 TTTTTTTTTAGTTTAAAGAAAGG + Intronic
1191927366 X:66328085-66328107 TTATTTTACAAATTAGGGAACGG - Intergenic
1192057898 X:67791721-67791743 TTTTTTTTAAATGTAGAGATGGG - Intergenic
1192272502 X:69595358-69595380 TTGTTTTTGTTTTTAGAGAAAGG - Intergenic
1192319778 X:70080831-70080853 TTTTTTTCTTATTTACAGAAAGG - Intergenic
1192607365 X:72532484-72532506 TTTTTTTTTAAATTAGAGACAGG + Intronic
1192892117 X:75401157-75401179 TTTTTTTACAAATTGGAGCACGG + Intronic
1193127711 X:77887097-77887119 TTTTGTTTCAATTTAGAGACAGG + Intronic
1193332532 X:80251018-80251040 TTTTTTTAAAAATGAGAGAGAGG - Intergenic
1193363780 X:80606484-80606506 TTTTTTTAGTTTTTAGGGGAAGG + Intergenic
1193386216 X:80874581-80874603 ATGTTGTAGAATTGAGAGAAGGG - Intergenic
1193634495 X:83931390-83931412 TTTTTATAGCATTGTGAGAATGG + Intergenic
1193667524 X:84340249-84340271 TTTTTTTAAAATTCAGTAAAAGG - Intronic
1193679989 X:84506758-84506780 TTTTTTTAATTTTTAGAGACAGG + Intergenic
1193797529 X:85894563-85894585 GTATTTTGGAATTTAGATAATGG - Intronic
1193900575 X:87171492-87171514 TTTTTTTATAGTTTGGAGATAGG - Intergenic
1193967191 X:88003358-88003380 TGTTTTTGTAATTTAAAGAAAGG - Intergenic
1194041160 X:88943562-88943584 TTTTTTAAAAATTTAGAGACAGG - Intergenic
1194360186 X:92940987-92941009 TTTTTATAGCAATGAGAGAATGG - Intergenic
1194362203 X:92965628-92965650 ATTTTGTAGGACTTAGAGAAAGG + Intergenic
1194391329 X:93321505-93321527 TTTTTATAGCAGTAAGAGAACGG + Intergenic
1194454104 X:94080832-94080854 TTTTTATAGCAGTGAGAGAATGG + Intergenic
1194527736 X:94998758-94998780 TTTTTTTATTTTTTAGAGACTGG + Intergenic
1194539078 X:95148060-95148082 TTTTTTTAGATTTTCTATAACGG + Intergenic
1195169014 X:102247595-102247617 TTTATATAAAATTTATAGAAGGG - Intergenic
1195189843 X:102439494-102439516 TTTATATAAAATTTATAGAAGGG + Intronic
1195390288 X:104354842-104354864 TTTTTTTTTAAATTAGAGACAGG + Intergenic
1195447099 X:104964808-104964830 TTTTTTTTTAAATCAGAGAAAGG + Intronic
1196024692 X:111028959-111028981 TTTTTTTAAATTGTAGAGACAGG - Intronic
1196042612 X:111221620-111221642 TTTTTTAAAGATCTAGAGAAAGG + Intronic
1196203361 X:112911187-112911209 TTTTTTTTTCATTTAGAGACTGG + Intergenic
1196437552 X:115688602-115688624 TTTTTTTATTTTTTAGAGACAGG + Intergenic
1196538344 X:116874608-116874630 TTTTTTTTTAATTTATAAAAAGG - Intergenic
1196679518 X:118456374-118456396 TTTTTTTTGAAGGTAGAGACTGG - Intergenic
1196812275 X:119638199-119638221 TTTCTTTAGAAGGTAGATAATGG + Intronic
1196850522 X:119933688-119933710 TTTTTTTTAAATATAGAGACAGG + Intronic
1196928905 X:120661570-120661592 TTTTTTTTTATTTTAGAGACAGG - Intergenic
1197033171 X:121843608-121843630 TTTTTTAAAAATTAAGAAAATGG - Intergenic
1197097660 X:122614441-122614463 CTGTTTCAGAATTTTGAGAAAGG - Intergenic
1197259559 X:124303710-124303732 TTTTTTTTTAAATTAGAGATGGG + Intronic
1197299876 X:124765008-124765030 TTTCTTTAGATTTCAAAGAATGG - Intronic
1197383321 X:125772178-125772200 TTTTCTTATAATTTACAGAAAGG - Intergenic
1197937176 X:131751957-131751979 TTTTTTTAAATTTTAGATATGGG + Intergenic
1198241212 X:134787801-134787823 TTTTTTTTTAATGTAGAGATGGG + Intronic
1198554958 X:137782979-137783001 TTTTTTTTTTTTTTAGAGAAAGG - Intergenic
1198834865 X:140794479-140794501 TTATTTTAAAATCTAGAAAAAGG - Intergenic
1198840898 X:140856792-140856814 TTTTATAGAAATTTAGAGAAGGG - Intergenic
1199194690 X:145014227-145014249 TTTCTTTAAAAATTAGAGACAGG - Intergenic
1199386414 X:147228465-147228487 TTTTTTAAGAGGTCAGAGAAGGG + Intergenic
1199516333 X:148680527-148680549 TTTTTTTTTAATTTAGTGACTGG - Intronic
1199585745 X:149414023-149414045 TTTTTATAGCATTTCAAGAATGG + Intergenic
1199803352 X:151272885-151272907 TTTTTTGAGAAGTTTGTGAAAGG - Intergenic
1199834584 X:151576032-151576054 TTTTTTTTGTATTTTTAGAAGGG + Intronic
1200668390 Y:6056804-6056826 TTTTTATAGCAATGAGAGAACGG - Intergenic
1200670453 Y:6081851-6081873 ATTTTGTAGGACTTAGAGAAAGG + Intergenic
1200905096 Y:8473660-8473682 TTTTTGTAGTTTTTAGAGAAGGG - Intergenic
1201144839 Y:11058619-11058641 TTTTTTTTTTTTTTAGAGAAGGG + Intergenic
1201407902 Y:13666777-13666799 TTTTTTTAGTAAGTAGAGACAGG + Intergenic
1201627789 Y:16034181-16034203 TTTTTTTAGAATTTTAAGTCAGG - Intergenic
1201635968 Y:16123554-16123576 TTTTATTGTATTTTAGAGAATGG + Intergenic
1201669677 Y:16504911-16504933 TTTTTTTTTAATTTTCAGAATGG + Intergenic
1201917142 Y:19194419-19194441 TTTTTTAAGAATTTAGATACAGG - Intergenic
1201950296 Y:19556178-19556200 TTTTTTTTCAGTTTAGAAAAAGG - Intergenic
1202098827 Y:21283742-21283764 TTTTTTTTTAATTGAGAAAATGG - Intergenic
1202371480 Y:24199765-24199787 TTTTTTTAAATTTTTGAGATAGG - Intergenic
1202499305 Y:25470350-25470372 TTTTTTTAAATTTTTGAGATAGG + Intergenic