ID: 983847856

View in Genome Browser
Species Human (GRCh38)
Location 4:172541842-172541864
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 2, 1: 62, 2: 157, 3: 209, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983847856_983847861 8 Left 983847856 4:172541842-172541864 CCTTTTAGTGCACATGCTTGAGC 0: 2
1: 62
2: 157
3: 209
4: 319
Right 983847861 4:172541873-172541895 CCAAATCCTGAGACCTTATCAGG 0: 1
1: 11
2: 148
3: 316
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983847856 Original CRISPR GCTCAAGCATGTGCACTAAA AGG (reversed) Intronic
900134886 1:1112260-1112282 GCTCAAGCGTGTGCACTGAGAGG + Intronic
900753081 1:4412148-4412170 GCTCAAGCATGCCCAGTAAGAGG - Intergenic
900812980 1:4822007-4822029 GTTCAAGCATGCACACTAAGAGG + Intergenic
900813141 1:4823434-4823456 GTTCAAGCATGCACACTAAGAGG - Intergenic
901729251 1:11266978-11267000 GCTCAAGCATGGGCACTAAGAGG - Intergenic
903309644 1:22444538-22444560 GTTCAAGCATGTGCACTAAGAGG + Intergenic
904967642 1:34390686-34390708 GCTCAAGGAGGTTCTCTAAACGG - Intergenic
905610312 1:39344767-39344789 GCTCAAGCATGCGCACTAAGAGG - Intronic
905690911 1:39941999-39942021 GGTCAAGCATGTGCACTAAGAGG - Intergenic
906782517 1:48585321-48585343 GTTTGAGCTTGTGCACTAAAGGG - Intronic
907079472 1:51608153-51608175 GCTCAAGCATGCACACTAAGAGG - Intronic
907253037 1:53155893-53155915 GCTCAAGCATGCTCACTAAGAGG + Intergenic
907823910 1:57997153-57997175 GCACCAGCATGTTCACTAAGAGG + Intronic
909058204 1:70847210-70847232 CCTCAGGAATGTGCCCTAAAGGG - Intergenic
909084333 1:71153909-71153931 GCTCAAGCACGTACATTAAGAGG + Intergenic
909099823 1:71336594-71336616 GCTCAAGCATGTGCATTAAGAGG - Intergenic
909100543 1:71342979-71343001 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
910024108 1:82628384-82628406 ACTCAAGCATGCGCATTAAGAGG - Intergenic
910365444 1:86460254-86460276 GCTCAAGCATGTGCACTAAGAGG - Intergenic
911485670 1:98501778-98501800 GATCAAGGAGGTGCACTAAGTGG + Intergenic
911694979 1:100880229-100880251 GCTCAGGCATGTGCAAGCAAAGG + Intronic
911747164 1:101452731-101452753 GCTCAAGCCTGTGTACTAAGAGG + Intergenic
911854429 1:102858983-102859005 GCTCAAGCATGTGCACTAAGAGG + Intergenic
912185659 1:107272846-107272868 GCTTAAGCATTTGTACTTAATGG - Intronic
912627019 1:111213813-111213835 GCCCAAGCATGCACGCTAAAAGG - Intronic
912940146 1:114037547-114037569 GCTCAAGCATGTGCACTAAGAGG - Intergenic
913290007 1:117263145-117263167 GCTCAAGCATGCACACTAAGAGG + Intergenic
913367024 1:118049990-118050012 GCTCAAATATGTGCATTAAGAGG + Intronic
914940170 1:152015538-152015560 CCTCAGGCATGTGTCCTAAAGGG - Intergenic
915641706 1:157232578-157232600 GCTTAAGCATGTGCATTAAGAGG - Intergenic
915666974 1:157453960-157453982 GCTCAAGCATATGCAGTAAGAGG + Intergenic
916013256 1:160725732-160725754 GCTCACACATGCGTACTAAAAGG + Intergenic
916816862 1:168362613-168362635 GCTCAAGCATGTGCATTAAGAGG + Intergenic
917103137 1:171465738-171465760 GCTCAAGCATGTTCACTAAGAGG - Intergenic
917216091 1:172679464-172679486 GCTCAAGCACGTGCTCTAAGAGG - Intergenic
917314527 1:173710655-173710677 GCTCCAGCATGTGCATTAAAGGG - Intergenic
917567280 1:176225821-176225843 GCTCATGCATGTGCACTAAAAGG + Intergenic
917671308 1:177276063-177276085 GCCCAAGCATGGGCACCACAGGG - Intronic
917909060 1:179622171-179622193 CCCCAAGCATGTGCAGTTAAAGG - Intronic
918077525 1:181181826-181181848 GCTCTAGCCTGGGCACTAAGAGG + Intergenic
918199424 1:182253401-182253423 GCTCAAGCATGCACACTCAGGGG + Intergenic
918324501 1:183396447-183396469 GCTCAAGCATGTGCACTAAGAGG + Intronic
918967568 1:191371944-191371966 CCTCCAGCATGTGCACTAAGAGG - Intergenic
918974691 1:191468033-191468055 GCTCACGCATGTCCACTAAGAGG + Intergenic
919168892 1:193929012-193929034 TCTCAAGCATGCACACTAAGAGG - Intergenic
919298473 1:195732415-195732437 GATCAAGCATGTGCACTAACAGG + Intergenic
920798107 1:209160188-209160210 GCTCAAGCATGTGCACTAAGAGG - Intergenic
920832031 1:209474145-209474167 GCTCAAGCATGTACAGTAAGAGG + Intergenic
921294933 1:213692723-213692745 GCTCAAGCATGTGCATTAAGAGG - Intergenic
921522007 1:216167415-216167437 GCTCAAGCATGCGCACTAAGAGG + Intronic
922057529 1:222055637-222055659 GCTCAAACTAGTGCAATAAAGGG - Intergenic
922333758 1:224601399-224601421 GCTCAAGCATGTGCACTAAGCGG - Intronic
922334660 1:224608914-224608936 GCTCAAACATGTGCACTAAGAGG - Intronic
922630044 1:227097660-227097682 GCTCAAGCATGCACACTAAGAGG + Intronic
922760200 1:228124310-228124332 GGTCAAGCATGAGCACTAAGAGG + Intergenic
922873939 1:228925293-228925315 ACTCAAGCACATGCACTAAGAGG + Intergenic
922875348 1:228936056-228936078 GCTCAAGCATGCGCACTAAGAGG + Intergenic
923162056 1:231323236-231323258 GCTCAAGCATGCACCCGAAAAGG + Intergenic
923962054 1:239096819-239096841 GCTTAAGCACGTGCACCAGATGG + Intergenic
923965508 1:239134424-239134446 GTTCAAGCATGCACACTAAGAGG + Intergenic
924144300 1:241058160-241058182 GCTCAAACATGTGCATTAAGAGG + Intronic
924466478 1:244303323-244303345 GCTCAAGCTTGTGCACTGAGAGG + Intergenic
924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1062986425 10:1773293-1773315 GCTCAAGCATACGCACTAAGAGG + Intergenic
1062986755 10:1776324-1776346 ACTCAAGCATGTGCACTAAGAGG + Intergenic
1063018865 10:2105741-2105763 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
1063950994 10:11223415-11223437 TCTGAAGCATCTGCACCAAATGG - Intronic
1065209712 10:23390848-23390870 GCTCCAGCATGCCCACTAAGAGG - Intergenic
1065466189 10:26025454-26025476 TCTCAAACATGTGCACTCAGTGG + Intronic
1065506462 10:26434720-26434742 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1065534901 10:26707255-26707277 GCTCAACCATGCACACTAAGAGG - Intronic
1065640397 10:27776454-27776476 GCTCAAGCATGCACACTAAGAGG - Intergenic
1065775004 10:29111416-29111438 GCTCAAGCACTTGCTCTCAATGG - Intergenic
1065849319 10:29773782-29773804 AGTCAAGCATGTGCACTAGAAGG + Intergenic
1065940407 10:30559253-30559275 GCTCAAGCATGAGCACTAACAGG + Intergenic
1066289362 10:33999702-33999724 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1067512239 10:46905737-46905759 GCTCAAGCATGCACATTAACGGG + Intergenic
1067650005 10:48146085-48146107 GCTCAAGCATGCACATTAACGGG - Intergenic
1067893898 10:50159511-50159533 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1067954947 10:50780753-50780775 GCTGAAGCATGTGCATTAAGAGG - Intronic
1068192025 10:53664996-53665018 GCTCAAGCGTGCTCACTAAGAGG - Intergenic
1068427092 10:56880674-56880696 GCTCAAGCATGCACACTAAGAGG + Intergenic
1068497047 10:57795999-57796021 GCTAAAACATGTGCACTAAGAGG + Intergenic
1068518866 10:58057302-58057324 GCTCATGTATGTGCACTAAGAGG - Intergenic
1068758221 10:60679476-60679498 GCTCAAGCATGCACACTAGGAGG + Intronic
1069935529 10:71913148-71913170 GCTCCAGCATGCGCACTAAGAGG - Intergenic
1070847342 10:79534122-79534144 GCTCAAGCATGCACACTAAGAGG - Intergenic
1070926454 10:80226170-80226192 GCTCAAGCATGCACACTAAGAGG + Intergenic
1071155015 10:82678075-82678097 GCTCAAGCATGAGCACTAAGAGG - Intronic
1071409400 10:85374000-85374022 GCTCAAGCATGTGCCCTAAGAGG + Intergenic
1071619204 10:87103640-87103662 GTTAAAGCATGCTCACTAAAAGG - Intronic
1071828977 10:89353260-89353282 GCTCAAGCATGTGCACTAAGAGG + Intronic
1072520026 10:96223070-96223092 GCTCAAGCATGCGCATTAAGAGG + Intronic
1073360064 10:102891098-102891120 GCTCAAGCATGCACATTAAGAGG - Intronic
1073748692 10:106499393-106499415 GCTCAAGCATGCACACTAAGAGG + Intergenic
1073849562 10:107599062-107599084 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1073903667 10:108251692-108251714 GCTAAAGCATGGGGACTAACTGG + Intergenic
1073931989 10:108586792-108586814 CCTCAAGCTTGTGCATTAAGAGG + Intergenic
1075240211 10:120771589-120771611 GCTCAAGCATGTACACTAAGAGG + Intergenic
1075377311 10:121988997-121989019 GCTCAAGCATGGGCCCTAAGGGG + Intergenic
1075491576 10:122875817-122875839 GTTCAAGCATGTGCACTAAGAGG + Intronic
1078291924 11:10020217-10020239 GCTCACGCAGGTGCAGTAAGAGG + Intronic
1078819357 11:14862067-14862089 GCTCAAGCATGTGCACTAAGAGG - Intronic
1079234593 11:18679088-18679110 GCTCAAGCATGCACATTAAGAGG + Intergenic
1079405944 11:20145845-20145867 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1080952341 11:37049507-37049529 TCTCAAGCATGCACACTAAGAGG + Intergenic
1080967878 11:37234691-37234713 GCTCAAGCATGTGCATTGAGAGG - Intergenic
1081160350 11:39741330-39741352 ACTCAAGCATGCACACTAACAGG - Intergenic
1081253918 11:40869538-40869560 GCTCAAGCACGTTCACTAAAAGG + Intronic
1081434369 11:43010894-43010916 ACTCAAGCATGTGCACTAGGAGG - Intergenic
1082942773 11:58725989-58726011 GCTTAAGCATGTGCATTCAGAGG - Intronic
1083056474 11:59825924-59825946 ACTCCAGCCTGTGCAATAAAAGG - Intergenic
1084375464 11:68773849-68773871 GCTGAAGCATGCGCACTGAGAGG + Intronic
1085831505 11:79906077-79906099 ACTCAAGTGTGTGCACTAAAAGG + Intergenic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1086349608 11:85932450-85932472 GCTCAAGCATGTACATTGAGAGG - Intergenic
1086390162 11:86355617-86355639 GCTCAAGTATGTGCACTGAGAGG + Intergenic
1086737066 11:90320058-90320080 GCTCAAGCATGTGCACTGAGAGG + Intergenic
1086974383 11:93115581-93115603 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1087066542 11:94032828-94032850 GCTCAAGCAAGTGCATTGAGGGG + Intronic
1087701873 11:101444102-101444124 GCTCAAGCATGCACATTAAGAGG + Intergenic
1087797931 11:102473863-102473885 GTCCAAGCATGTGAACTAAGAGG - Intronic
1088253575 11:107882357-107882379 GCTCACACATGCGCACTAAGAGG + Intronic
1088555558 11:111057196-111057218 GCTCAAGCGTGCACACTAAGAGG + Intergenic
1090196866 11:124824031-124824053 GCTCAAGCCTGCTCACTAAGAGG + Intergenic
1090980272 11:131714103-131714125 GCTTAAGCATGTGCCCTATGAGG - Intronic
1091196483 11:133735576-133735598 GCTCAAATATGTCCACCAAAAGG - Intergenic
1092575166 12:9774829-9774851 GCTCAAACATGCACACTAAGTGG - Intergenic
1092886321 12:12927396-12927418 ACTCAAGCATGAGCACTAACAGG + Intergenic
1093007588 12:14067458-14067480 GCTCAAGCATGCACACTAAGAGG + Intergenic
1093421986 12:18984169-18984191 GCTGAAGCATGCACACTAAGAGG - Intergenic
1094096103 12:26706589-26706611 TCTCAAGGATGTGCAAGAAATGG - Intronic
1094324407 12:29221160-29221182 GCTTGAGCATGCGCACTAAGAGG - Intronic
1095929700 12:47613235-47613257 GCTCAAGCTTCTGCTCTAGAAGG + Intergenic
1097133403 12:56831121-56831143 GCTCACGCATGAACACTAAGAGG - Intergenic
1097493725 12:60301490-60301512 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1098437768 12:70486186-70486208 GCTGAAGCATGTACATTAAGAGG + Intergenic
1098846150 12:75538246-75538268 GTTCAAGCATGCACACTAAGAGG + Intergenic
1099437474 12:82660969-82660991 GCTCAAGCATGTGCAGTAAGAGG - Intergenic
1099718604 12:86331493-86331515 GCTCAAGAATGCACACTAAGAGG - Intronic
1100027395 12:90147175-90147197 GCTCAAGCAGGTGCACTAAGAGG + Intergenic
1100364010 12:93902673-93902695 GCTCAAGCATGGACACTAAGAGG - Intergenic
1100758364 12:97777281-97777303 GCTCAAGCATGTACACTAAGAGG + Intergenic
1101406951 12:104437085-104437107 GCTCACACATGTGCCCTAAGAGG - Intergenic
1101407205 12:104439086-104439108 GCTCACACATGAGCACTAAGGGG + Intergenic
1101516838 12:105444135-105444157 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1102905274 12:116669854-116669876 GCTCCAGCATGTGCATTAAGAGG - Intergenic
1103093673 12:118116079-118116101 GCTTAAGCATGTGCATGAAGAGG - Intronic
1103554951 12:121760598-121760620 GCTCAAGCACGTGCACTAGGAGG - Intronic
1104059516 12:125255602-125255624 GCTCAAGCAGGTGCGCTAGGTGG - Intronic
1106298604 13:28441102-28441124 GCTCAAGCATGCACACTCAAAGG + Intronic
1106627602 13:31436501-31436523 GCTCCAGCATGTGCATTAAGAGG + Intergenic
1107236705 13:38179064-38179086 GCTCAAGCATGTGCCCTAACAGG - Intergenic
1107311608 13:39084071-39084093 ACTAAATCATGTGAACTAAAAGG - Intergenic
1107334597 13:39340936-39340958 GCACATGCCTGTGCAGTAAATGG - Intergenic
1107684733 13:42885689-42885711 GCTCAAGCATGTACATTAAGGGG - Intergenic
1107763514 13:43708125-43708147 GCTCAAGCATGAGCACTAAAAGG + Intronic
1108483004 13:50894371-50894393 GTTCAAGCATGCACACTAAGAGG + Intergenic
1108718441 13:53105406-53105428 GCTCAAGCATGCACATTAAGAGG - Intergenic
1109661123 13:65462001-65462023 GCTCAAGCATGTGTATTAAGAGG - Intergenic
1109848155 13:68024497-68024519 GCTCGAGCATGCACACTAAGAGG - Intergenic
1109866711 13:68273477-68273499 ACTCAAGCATGAGCACTAAAAGG - Intergenic
1109952175 13:69512874-69512896 GCTCACACATGTGCACTAAGAGG - Intergenic
1110275341 13:73635822-73635844 GCTCAAGCATGCACACTAAGAGG + Intergenic
1110930673 13:81212142-81212164 GCTAAAGCATGTGCATTACAAGG + Intergenic
1110982586 13:81919840-81919862 GCTCGAGCATGCACACTAAGAGG - Intergenic
1111122232 13:83868066-83868088 GCTCAAGCATGTACACTAAGAGG + Intergenic
1111127376 13:83929139-83929161 GCTCAAACATGTACATTAAGAGG + Intergenic
1111476878 13:88761345-88761367 GCTCAAGCATGATCACTAGGAGG - Intergenic
1111934661 13:94546789-94546811 GCTGAAGCATGCGCACTAAGAGG + Intergenic
1113535845 13:111065764-111065786 GCTTAGGCCTGTGCACTAAGAGG + Intergenic
1114234647 14:20813454-20813476 CCTCCAGGATGTGCACTCAAAGG + Intergenic
1114878229 14:26750497-26750519 GCTCAAGCATGTGCACCAAGAGG + Intergenic
1114967467 14:27981038-27981060 GCGCAAGCACATGCACTAAATGG - Intergenic
1115147143 14:30238994-30239016 GCTCAAGCATGTCCACTAAGAGG + Intergenic
1115239386 14:31239954-31239976 GCTCAAGCATGCACACTAAGAGG - Intergenic
1115336818 14:32250432-32250454 GCTCAAGCATTTGCACTAAGAGG - Intergenic
1115959351 14:38817756-38817778 TCTCAAGAATGTGAACAAAATGG + Intergenic
1116064902 14:39970395-39970417 GCTCAAACATGTGCACTAAATGG + Intergenic
1116173272 14:41430232-41430254 GCTCACACATGTGCACTAAGAGG + Intergenic
1116464151 14:45212638-45212660 GCTCAAGCATGTGCATTAAGAGG + Intronic
1116708534 14:48335179-48335201 GCTCAAGCATGCACACTAAAAGG + Intergenic
1116721720 14:48504797-48504819 GCTGCAGCATGTGCCCTGAATGG + Intergenic
1117099762 14:52334267-52334289 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1117528089 14:56631746-56631768 GCTCAAGCATGTGCACTAAGAGG - Intronic
1117727744 14:58691196-58691218 GCTCAAGCATGCAGACTAAGAGG - Intergenic
1117976221 14:61299401-61299423 GCTCAAGCATGTGCATTAGGAGG - Intronic
1119064809 14:71514420-71514442 CCTCAAGCATGTGCATTAAGAGG - Intronic
1119597084 14:75944842-75944864 GCTTGAGCATGTGCACTAAGAGG + Intronic
1119692549 14:76687825-76687847 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1119822559 14:77630397-77630419 ACTCAAGCTTGTGCACTAAGAGG - Intergenic
1120267910 14:82274931-82274953 GCTCAAGCATGCACACTAACAGG - Intergenic
1120296411 14:82647452-82647474 GCTCAAGCATGCTCACTAAGAGG + Intergenic
1120376072 14:83708851-83708873 GCTCAAGCATACACACTAAGAGG + Intergenic
1120652797 14:87154961-87154983 GCCCAAGCATGTGCATTAAGAGG + Intergenic
1120911891 14:89674366-89674388 GCTAATGCATGTACAATAAAGGG + Intergenic
1121044241 14:90776349-90776371 GCTCAAGCATGCGCACTAAGGGG + Intronic
1121261875 14:92572365-92572387 GCTCAAGCATGAGCACTAAGAGG - Intronic
1121721561 14:96112469-96112491 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1121815079 14:96923051-96923073 GCTCAAGCATGTGCACTAACAGG + Intronic
1122144543 14:99681781-99681803 GCTCAAGCATGCACACTAAGAGG + Intergenic
1122633075 14:103116670-103116692 GCTCAAGCATAAGCACTAAGAGG + Intergenic
1122777725 14:104129562-104129584 GATCAAGGATGTCCACTGAACGG - Intergenic
1123126229 14:105948046-105948068 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123406738 15:20024100-20024122 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123516067 15:21030748-21030770 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123825133 15:24073609-24073631 ACTCAACCATGTGCATTAAGAGG - Intergenic
1124821590 15:33051613-33051635 GCTCAAGCATGGGCATGAAGAGG + Intronic
1125115483 15:36086429-36086451 GCTCAAGCATACACACTAAAAGG + Intergenic
1126260452 15:46683337-46683359 GCTCAAGCATGCACACTAAGAGG + Intergenic
1127769370 15:62218728-62218750 GCTCAAACATGCTCACTAAGAGG + Intergenic
1128596649 15:68957829-68957851 GCTCAAGTATGTGCACTAAGAGG + Intronic
1128822330 15:70670166-70670188 GCTCAAGCATGCGCACTAAGAGG + Intronic
1128849884 15:70943698-70943720 GCTCAAGCATGTGCATTAAGAGG - Intronic
1129055830 15:72819594-72819616 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1129746393 15:78024422-78024444 GCTCGAGCTTCTGCACCAAAAGG - Exonic
1130608343 15:85337775-85337797 TCCTAAGCATGAGCACTAAAGGG - Intergenic
1130660211 15:85825512-85825534 GCTCAAGTATGTACACTAAGGGG - Intergenic
1131287173 15:91069930-91069952 GCTCACGCAGGGGCACTAAGAGG - Intergenic
1131547805 15:93330499-93330521 GCTCCAGCATGTGCATTATGAGG - Intergenic
1131661665 15:94523958-94523980 GCACAAGCATGTTCACGAAGGGG - Intergenic
1132166913 15:99602457-99602479 GCTCCAGCATGCGCATTAAGAGG - Intronic
1134077681 16:11303515-11303537 GCTCAAGCATGCATACTAAGAGG + Intronic
1134606815 16:15577871-15577893 GCTCAAGCATGCACATTAAGAGG - Intronic
1134851632 16:17483581-17483603 GTTCAAGCATGCACACTAAGAGG + Intergenic
1135042594 16:19129469-19129491 GCTCAAGCATGAGCTTTAAGAGG + Intronic
1135236558 16:20761787-20761809 GCTCAAGCATGCGTACTAAGAGG + Intronic
1135789026 16:25376470-25376492 GCTCAAGCATGCACACTAAGAGG - Intergenic
1136219569 16:28819949-28819971 GCTCAAGCTTATGCACCAAGAGG + Intergenic
1137386875 16:48050005-48050027 ACTCAAGCATGCGCATTAACAGG + Intergenic
1137746237 16:50822278-50822300 GCTTAAGCATGAGCACTTAGAGG - Intergenic
1137754054 16:50887561-50887583 ACTCAAGCATGCGCGCTAAGAGG - Intergenic
1138262483 16:55635082-55635104 ACTCAAGCATGCACACTAAAAGG + Intergenic
1138711016 16:58970399-58970421 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1138852783 16:60650091-60650113 GCTCAAGCTTTTGCCCTACAGGG - Intergenic
1138988634 16:62362822-62362844 GCCCAAGCATGCGTACTAAGAGG - Intergenic
1139099685 16:63750355-63750377 ACTCAAGCATGGGCATTAAGAGG - Intergenic
1139162804 16:64532306-64532328 GTTCAAGCATGGGCTCAAAAAGG - Intergenic
1140323547 16:73977796-73977818 GCTTAAGCATGCGCACTAAGAGG + Intergenic
1140446818 16:75035888-75035910 GCTCAGGCATGAGCACTAAGAGG - Intronic
1141251553 16:82363561-82363583 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1144408001 17:14971611-14971633 GCTCAAGCATGCTCACTAAGAGG - Intergenic
1145930400 17:28681256-28681278 GCTCAAGGATGTCCAATCAATGG + Exonic
1146823376 17:36002299-36002321 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1149258072 17:54849600-54849622 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1149290797 17:55215831-55215853 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1149304233 17:55333031-55333053 GCTCAAGCATGTGCGCTAAGAGG - Intergenic
1150616565 17:66776962-66776984 GCTCAAGCACGCGCATGAAAAGG - Intronic
1150907027 17:69348726-69348748 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1151051158 17:70979769-70979791 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1151864233 17:76789480-76789502 GTTCAAACATGTGCACTAAGAGG - Intergenic
1152153650 17:78618605-78618627 GCTCAAGCGTGCGCACTAAGAGG - Intergenic
1152682409 17:81675714-81675736 GCTCTGGCATGTGCACTGAGGGG + Intergenic
1153101540 18:1476068-1476090 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1153175503 18:2367735-2367757 GCTCCAGCATGTGTACTAAAAGG + Intergenic
1153227847 18:2911412-2911434 GCTCATGCATGTGCATTAAGAGG - Intronic
1153745761 18:8178034-8178056 GCTCAAGCATGCACACTAAGAGG - Intronic
1153746054 18:8180740-8180762 GCTCAAGCATGTGCACTAAGAGG - Intronic
1153788151 18:8553351-8553373 GCTCATGAATGTGCACTAGGAGG - Intergenic
1154040722 18:10853033-10853055 GCTCAAGCATGTGCAGTAAGAGG + Intronic
1154044720 18:10894141-10894163 GCTCAAGCATGTGCATTAAGAGG + Intronic
1154112920 18:11585784-11585806 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1154276031 18:12961245-12961267 GCTCAAGCATGTGCACTAAGAGG - Intronic
1155749108 18:29398198-29398220 GCTCACATATGTGCACTAAAAGG + Intergenic
1155818880 18:30350207-30350229 CCCCAAGAATGTTCACTAAAAGG - Intergenic
1155939489 18:31789456-31789478 GCTCGAGCATGTGCACGAAGAGG + Intergenic
1156389003 18:36633205-36633227 GCTCAAGCACACGCACTAAGAGG - Intronic
1156644252 18:39140763-39140785 GTTCAGGCATGTTCACTAAGAGG + Intergenic
1156679984 18:39576594-39576616 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1157707256 18:49817938-49817960 GCTCAAACATGCTCACTAAGAGG - Intronic
1158180509 18:54710187-54710209 GCTCAAGCATGCACATTAAGAGG + Intergenic
1158812952 18:61058824-61058846 GCTCACACATGTGAACTAAGAGG - Intergenic
1159054872 18:63453540-63453562 GCTCAAGCATGCACACGAAGAGG - Intergenic
1159670739 18:71217745-71217767 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG + Intergenic
1159892777 18:73968311-73968333 GCTCAAACATGTGCACTAAGGGG - Intergenic
1162005211 19:7773954-7773976 GCTCAAGCATGTGCACCAAGAGG - Intergenic
1164863836 19:31587323-31587345 GCTTAAGCATGCCCACTAAGAGG - Intergenic
1164863940 19:31588240-31588262 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1165692462 19:37874235-37874257 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1166418464 19:42613785-42613807 GCTCAAGCATGTGCATTAAGAGG + Intronic
1166498119 19:43320000-43320022 GCTAAAACATGTGCATTAAGAGG + Intergenic
1167302003 19:48683372-48683394 GCACAAGCATGTGCACTAAGAGG + Intergenic
925052636 2:829069-829091 GCTCAAGCACGCACACTAAAAGG + Intergenic
925553024 2:5096549-5096571 GCTTGAGCATGCGCACTAAGAGG - Intergenic
925751571 2:7094473-7094495 GCTCAAGCATGTGCATTAAGAGG + Intergenic
925792884 2:7510728-7510750 CCTCAGGGATTTGCACTAAATGG - Intergenic
925806340 2:7653557-7653579 GTTCAAGCATGCACACTAAGAGG + Intergenic
926374173 2:12210185-12210207 GCTTGAGCATGAGCACTAAGAGG + Intergenic
926439671 2:12874805-12874827 GCTCAAGCATGCGCACTAAGAGG - Intergenic
926556537 2:14364424-14364446 GCTCAAGCTTGCACACTAAGAGG - Intergenic
926637301 2:15195756-15195778 GCTCAAGCATGTACACTAAGAGG + Intronic
926651619 2:15352762-15352784 GCTCAAGCATGTTCACTAAGAGG - Intronic
926686427 2:15701910-15701932 GCTGAAGCATGTGCACTAAGAGG - Intronic
926828257 2:16931473-16931495 GCTCATGCATGCACACTAAGAGG - Intergenic
927871297 2:26625806-26625828 GCCCATGCATATGCCCTAAACGG + Intronic
928184249 2:29095257-29095279 GCTCCAACATGTGCAATAAGAGG - Intergenic
928827015 2:35435148-35435170 CCTCTAGCATGTGCACTAAGGGG + Intergenic
930591017 2:53326407-53326429 GCTCAAGCATGCACATTAACAGG + Intergenic
930887345 2:56341221-56341243 TCTCAAGCGTGTGTACTAAGAGG - Intronic
931114386 2:59148683-59148705 GTTCAAGCATGTGCATTAAGAGG + Intergenic
931884988 2:66607511-66607533 ACTCAAGCATGCGCATTAAGAGG + Intergenic
932005540 2:67923616-67923638 GCTCAAGCATGCACACTAAGAGG + Intergenic
932827605 2:74956237-74956259 GCTCACGCATGCACACTAAGAGG - Intergenic
932870275 2:75391329-75391351 GCTCAAGCACGTGCATTAAGAGG - Intergenic
932961280 2:76415234-76415256 GCCCGGGCATGTGCATTAAAAGG + Intergenic
933064600 2:77778200-77778222 GCTTAAGCATGCACATTAAAGGG - Intergenic
933064854 2:77780326-77780348 GCTCAAGCATGTGCATTAAGAGG - Intergenic
933515187 2:83291387-83291409 GCTTAAGCATGTACATTAAAAGG - Intergenic
934887701 2:98039320-98039342 GCTCAAGCATGCATACTAAGAGG + Intergenic
935286468 2:101568054-101568076 GCTTAAGCATGTGCATTGAGAGG - Intergenic
935292085 2:101619518-101619540 GCTCAAGCATGCGTATTAACTGG - Intergenic
936035151 2:109105206-109105228 ACTCAAGCATGTGCATTAAGAGG + Intergenic
936710333 2:115123544-115123566 GCTCAAATATGTGCACCAAGAGG - Intronic
936746466 2:115582352-115582374 GCTCAAGCATGTGCAGTAACAGG - Intronic
936765894 2:115848287-115848309 GCTCAAGCATGCGCACCGAGAGG + Intergenic
936837748 2:116728168-116728190 GCTCAAGCATGTACACTAAGAGG + Intergenic
937523187 2:122736281-122736303 GTTCAGACATGTGCACTAAGAGG + Intergenic
937556868 2:123168698-123168720 GCTCAAGCATATGCACTAAGAGG - Intergenic
938117459 2:128611742-128611764 GCTCAGGTTTGTGCTCTAAAAGG - Intergenic
938694137 2:133819931-133819953 GCACAAGCATGTACATTATATGG + Intergenic
939195067 2:138961537-138961559 GCTCAAGCATGTGCACTAAGAGG - Intergenic
939207706 2:139128881-139128903 GCTCAAGCATGCACACTAAGAGG - Intergenic
939446835 2:142321296-142321318 GCTCAAGCATGCACATTAAGAGG + Intergenic
939497643 2:142942998-142943020 GCTCAAGCATGTACATTAAGAGG - Intronic
939577110 2:143909119-143909141 GCTTAAGCATGCACACTAAGAGG + Intergenic
939755612 2:146105525-146105547 GCTCAAGTATGTGCACTAAGAGG - Intergenic
940398402 2:153220380-153220402 GCTGGAGCATGTGCATTAAGAGG + Intergenic
940782930 2:157952530-157952552 GCTCAAACATGCACACTAAGAGG + Intronic
940857639 2:158741974-158741996 GCTCCAGCATGCGCATTAAGAGG + Intergenic
941421478 2:165287435-165287457 GCTCAAGCATGCACATTAAGAGG - Intronic
941718244 2:168786411-168786433 GCTCAAGCATGCGCACTATGAGG + Intergenic
941998398 2:171623138-171623160 GCTCAAGCATGGGCATTAAGAGG - Intergenic
942925350 2:181425703-181425725 GTTAAAGCATGTGCACTAAGAGG + Intergenic
943345410 2:186732851-186732873 GCCCAAGCATGTGCACTAAAAGG - Intronic
943499897 2:188674652-188674674 GCTCGAGCATGCACACTAAGAGG + Intergenic
943548371 2:189309310-189309332 GCTCAAGCATGAGAACTAAGAGG + Intergenic
943903068 2:193465835-193465857 ACTCAAGCATGTCCCTTAAAAGG - Intergenic
944662831 2:201935402-201935424 ACTTGAGCATGTGCACTAAGAGG - Intergenic
945342557 2:208674338-208674360 GCTCAAGCATGTGCATTAAGAGG - Intronic
945392005 2:209275914-209275936 GCTCAAGCATGTGCACTAAGAGG + Intergenic
945555604 2:211271548-211271570 GCTCACACATGTGCATTAAGAGG - Intergenic
945838234 2:214857701-214857723 GCTCAAGCATGTGCACCAAGAGG + Intergenic
946780327 2:223188115-223188137 GCTCAAGGATGTGCATGAAGAGG - Intronic
946952104 2:224887345-224887367 CCTCAAAAATGTGCACCAAAGGG + Intronic
947001996 2:225467242-225467264 GCTCACACATGTGCACTAAGAGG - Intronic
947156939 2:227172113-227172135 GCTCAAGCATGCACATTAAGAGG - Intronic
947186781 2:227462788-227462810 GCTCCAGGATGTGCACTTGAAGG - Intergenic
947219800 2:227781342-227781364 GCTCAAGCATGCGCACTAAGAGG + Intergenic
947282347 2:228469515-228469537 GCTTGAGCATGCGCACTAAGAGG - Intergenic
947401263 2:229733614-229733636 GCTCAAGTATGTTCACTAAGAGG - Intergenic
948230671 2:236346856-236346878 GTTCAACCATGTGCATTAAGAGG + Intronic
1169429314 20:5522344-5522366 GCTCAAGCATGCCTACTAAGAGG + Intergenic
1170734066 20:18998531-18998553 GCTCATGCATGCACACTAAGAGG + Intergenic
1172795702 20:37535730-37535752 GCTCAAGAATGCGCACTATGAGG + Intergenic
1172797811 20:37554787-37554809 GCTCAAGCATACGCACTAAAAGG + Intergenic
1173408018 20:42784034-42784056 GCTGGAGCATGTGCAATAGATGG - Intronic
1174013142 20:47467005-47467027 GCTCAAGCATGGGAATTAAGAGG - Intergenic
1174896190 20:54452330-54452352 GCTCAAGCATGCACGCTAAGTGG + Intergenic
1175587015 20:60149134-60149156 GCCCAAGTATGTGCACTAAATGG + Intergenic
1175682735 20:61002746-61002768 GCTGAAGCAGGAGCACTAAAAGG + Intergenic
1176291287 21:5046272-5046294 GCTCAAGCATGTGTATTAAAAGG - Intergenic
1177568693 21:22857994-22858016 GCTCCAGCATGTGTACTAAGAGG + Intergenic
1177609160 21:23423384-23423406 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1177939057 21:27386226-27386248 GCTCAAGCATGCACATTAAGAGG - Intergenic
1177965530 21:27722114-27722136 GCTTGGGCATGTGCACTAAGAGG - Intergenic
1178837505 21:36111283-36111305 GCTCAATCATGTGCATTAAGAGG + Intergenic
1179010001 21:37549179-37549201 GCTCAGGCATGTGCACTAAGAGG - Intergenic
1179235074 21:39538645-39538667 GCTCAAGCATGCGCACTAGAAGG - Intergenic
1179254865 21:39706895-39706917 GCTCAAGCATGCACAATAAGAGG - Intergenic
1179865968 21:44217369-44217391 GCTCAAGCATGTGTATTAAAAGG + Intergenic
1181424812 22:22827900-22827922 GCTCAAGCAGGCAAACTAAAAGG + Intronic
1182739868 22:32559918-32559940 GCTCAAGCCTGTGCACTAAGAGG + Intronic
949591963 3:5504058-5504080 GCTCAAGCATGTGCACTAAGAGG + Intergenic
950628115 3:14263362-14263384 GCTCAAGCATGTGCATTAAGAGG - Intergenic
950869543 3:16216828-16216850 GCTCAAGCATGTGCACTAAGAGG - Intronic
950907857 3:16555295-16555317 ACTCAAGCATGCACACTAAGAGG + Intergenic
951155011 3:19341254-19341276 GCTCAAGCATGCACACTAAGAGG - Intronic
951756989 3:26101852-26101874 GCTCAAGCATGTGCACTAACGGG - Intergenic
951933898 3:28000791-28000813 GCTCAAGCATCCGCACTAAGAGG + Intergenic
952680014 3:36080895-36080917 GCCCATGCTTGTGCCCTAAATGG + Intergenic
953194497 3:40719840-40719862 GCTCAAGCATGCGCACTAAGAGG + Intergenic
953259239 3:41321686-41321708 GCTCAAGCATGTGCACTAAGAGG + Intronic
953297920 3:41739645-41739667 GCACATGCATGTTCACTAACAGG + Intronic
953716075 3:45318106-45318128 ACTCATGCACGTACACTAAAAGG - Intergenic
953745707 3:45572418-45572440 GCTCAAGCATGTGCACTAATAGG + Intronic
953790035 3:45940371-45940393 GCTCAAGCACGCACACTAAGAGG + Intronic
954098520 3:48351110-48351132 GCTGAACTATGTGCAATAAATGG - Intergenic
955293345 3:57713101-57713123 CCTCAAGCATGTGCACTAAGAGG - Intergenic
955319106 3:57961581-57961603 GGTCAAGCATGCGCACTAAGAGG - Intergenic
955464445 3:59221910-59221932 GCCCATGCCTGTGCCCTAAATGG + Intergenic
955608422 3:60731658-60731680 GATCAAGTATGTGCACTAAGAGG - Intronic
955825287 3:62939694-62939716 GCCCAAGCATGTGCACTAAGAGG + Intergenic
956552468 3:70477037-70477059 GCTCAAGCATGTGCACTAGGAGG + Intergenic
957222554 3:77402567-77402589 GCTCAACTATGTGCACTAAAAGG + Intronic
957315413 3:78570035-78570057 GCTCAAGCATGCGCACTAAGAGG - Intergenic
957315869 3:78575776-78575798 ACTCAAGCATGTGCATTAAGAGG - Intergenic
957610848 3:82463335-82463357 GCTCAAGCATGTGCATTAAGTGG - Intergenic
957674132 3:83345460-83345482 GCTGAAGCACGTGCACTAAGAGG - Intergenic
957738196 3:84228457-84228479 GCTCATGCATGTGAACTAAGAGG - Intergenic
958492711 3:94797770-94797792 GCTCATGCATGTGCATTAAGAGG - Intergenic
958929861 3:100197493-100197515 GCTCAAGCATGGGCACTAAGAGG - Intergenic
959401267 3:105904892-105904914 GCTCAAGCATGTGCACTAAGAGG + Intergenic
959585621 3:108022549-108022571 GCTCAAGCATGTGCACTAAGAGG - Intergenic
960481557 3:118197586-118197608 GCTCAAGCATGTGCACTAAGAGG + Intergenic
961353323 3:126317470-126317492 GCTCAAGCATACACACTAAGAGG + Intergenic
961394048 3:126573782-126573804 GTTCAAGCATGTGCACTAAGAGG - Intronic
961480955 3:127180421-127180443 GCTCAAGCATGTGCACTAAGAGG + Intergenic
962209310 3:133463641-133463663 GCTCAAGCATGCACACTAAAAGG - Intronic
963023643 3:140897500-140897522 GCTCAAGCACGTGCACTAAGAGG - Intergenic
963684876 3:148420617-148420639 CCTCAAGCATGCGCACTAAGAGG - Intergenic
964249753 3:154699346-154699368 GCTCAAGCATGTGTATTAAGAGG + Intergenic
964951716 3:162303171-162303193 GGTCAAGAATGTGTACTAAGAGG + Intergenic
965071966 3:163925695-163925717 GCTCAAGCATGTGGACTGAGAGG - Intergenic
965867678 3:173225356-173225378 GCTCAAGCATGTTCACTAAGAGG - Intergenic
965945427 3:174234517-174234539 GCTCAAGCATGTGCATTAAGAGG - Intronic
966566075 3:181382962-181382984 GCACAAGCATGCTCACTAAGAGG - Intergenic
967120827 3:186381340-186381362 GCTCAAGCATGTACACTAAGAGG + Intergenic
967430803 3:189383132-189383154 GCTCAAGCATGCACCCTAAGAGG - Intergenic
967461933 3:189757938-189757960 GCTCAAGCATGTGTACTAAGGGG + Intronic
967587981 3:191237647-191237669 GCTCAAGCATGCGCTTTAAGAGG - Intronic
967751379 3:193119903-193119925 GCTCAAGCATGCACATTAAGAGG + Intergenic
967827105 3:193885825-193885847 GCTCAAGCATGTGCATTGAGAGG + Intergenic
967961503 3:194928898-194928920 GCTCAAGCATGCGCACTAAGAGG + Intergenic
967994177 3:195154304-195154326 GCTCAAGCATGTGCACTAGGAGG + Intronic
969335715 4:6508674-6508696 GCTCAAACATGCACACTAAGAGG + Intronic
969850822 4:9954961-9954983 GCTCAAGCATATGCACGAAGAGG + Intronic
969946962 4:10793398-10793420 GCTCACACATGTGCCCTAAGAGG + Intergenic
969947455 4:10799105-10799127 GCTCATGCATGTGCACTAAGAGG - Intergenic
970370296 4:15399110-15399132 TCTCAAGCATGTGCATTAAGAGG - Intronic
971477938 4:27089799-27089821 GCCCAGGCATGTGCACTAAGAGG - Intergenic
971671030 4:29558324-29558346 GCTCAAGCATGCGCATTAAGAGG + Intergenic
971764735 4:30815696-30815718 GCTCCCACATGTGCACTAAGAGG - Intronic
972024254 4:34357636-34357658 GCTAGAGCATATGCACTAAGAGG - Intergenic
972329864 4:38055030-38055052 GCTCAAGCATGCGCATTAAGAGG - Intronic
972865073 4:43221916-43221938 GCTCAAGCATGCACATTAAGAGG - Intergenic
972912172 4:43830984-43831006 GCTCAAGCATGGGCACCAAGAGG + Intergenic
972986447 4:44771856-44771878 GCTCGAGCATGAACACTAAGAGG + Intergenic
972987101 4:44778021-44778043 TTTCAAGCATGTGCACTAAGAGG + Intergenic
973702563 4:53551448-53551470 ACTCAAGCATGCGCACTAAGAGG + Intronic
973812659 4:54586898-54586920 GCTTGAGCATGTACACTAAGAGG - Intergenic
973893915 4:55393944-55393966 GCTCAAACATTTGCACTCCAGGG + Intergenic
974039185 4:56843334-56843356 GCTCAAGCGTGTGCACTAAGAGG + Intergenic
974166973 4:58215864-58215886 GCTCAAGCATGTGCACTAAGAGG - Intergenic
974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG + Intergenic
974204426 4:58682128-58682150 GCTCAAGCATGTACACTGAGAGG - Intergenic
974462312 4:62204187-62204209 GCTCAAGCATGCACACTAAGAGG + Intergenic
974882317 4:67774848-67774870 GCTCAAGCATGAGCACTAAGAGG + Intergenic
975222882 4:71833531-71833553 GGTCAAGCATGTACATTAAGGGG - Intergenic
975703554 4:77089713-77089735 GCTCAAGCATGCACATTAAGAGG - Intergenic
975767272 4:77682015-77682037 GTTCAAGCATGCGCACTAAGAGG - Intergenic
975916388 4:79330774-79330796 GCTTAAGCATGTAAACTAAGGGG + Intergenic
976005008 4:80419478-80419500 ACTCAAGCATGTGCATTAGGAGG - Intronic
977283685 4:95074384-95074406 GCCAAAGCATGTGAACTGAAAGG - Intronic
977523059 4:98110350-98110372 GCTCACACATGCACACTAAAAGG + Intronic
977582971 4:98745171-98745193 ACTCAAGCATGTGCCCTAAAAGG - Intergenic
977867722 4:102049811-102049833 GCGCAAGCATGTGCACTAAGAGG + Intronic
978153775 4:105466940-105466962 GCTCAAGCGTTTGCACTAAGAGG - Intronic
978938612 4:114410582-114410604 GCTAAAGCATGCTCACTAAGAGG - Intergenic
978979294 4:114922233-114922255 GCTCAAGCATGCACAGTAAGAGG + Intronic
979038711 4:115759302-115759324 GCTCAAGCATGTGCACTAAGAGG + Intergenic
979065251 4:116123263-116123285 GCTCAAGCATGTGCACTAAGAGG - Intergenic
979072274 4:116223064-116223086 GCTCAGGCATGCGCACTAAGAGG - Intergenic
979154102 4:117360616-117360638 GCTCACACATGCGCACTAAGAGG - Intergenic
979154181 4:117361289-117361311 GCTCACACATGCGCACTAAGAGG + Intergenic
979183170 4:117755896-117755918 GCTCAAGCATGCACACTAAGAGG - Intergenic
979695006 4:123603147-123603169 GCTCAAGCATATGCACTAAGAGG + Intergenic
980072145 4:128254668-128254690 GCGCAAGCATGTGCATTAAGAGG + Intergenic
980252496 4:130335769-130335791 GCTCAAGCATGAGCATTAAGAGG + Intergenic
980259689 4:130432596-130432618 GATCAAGCATGTGCACTAAGAGG + Intergenic
980390931 4:132145626-132145648 GCTCAAGCATGCACACTAAGAGG - Intergenic
980571622 4:134627364-134627386 GCTCAAGCATGTGCATTAAGAGG - Intergenic
980621785 4:135316716-135316738 GCTCAAGCATGATCATTAAGAGG - Intergenic
980798364 4:137714709-137714731 GCTCACACATGTGCACTAAGAGG + Intergenic
980810759 4:137876071-137876093 GCTCAAGCATGCACATTAAGAGG - Intergenic
981450043 4:144886216-144886238 GCTCAAGCATGTGAACTAAGAGG + Intergenic
981928747 4:150167806-150167828 GCTCAAGCATGTGCACTAAGAGG + Intronic
982103797 4:151993997-151994019 TCTCAAGCATGTGCACTAAGAGG - Intergenic
982439894 4:155423044-155423066 GCTCAAGCATGCACATTAAGAGG - Intergenic
982533021 4:156571532-156571554 GCGCATGCATGTGCACTAAGAGG - Intergenic
982922640 4:161294500-161294522 GTTCAAGCATGCACACTAAGAGG + Intergenic
983847856 4:172541842-172541864 GCTCAAGCATGTGCACTAAAAGG - Intronic
983904961 4:173172403-173172425 GCTCCAGCATGTGCACTAATAGG - Intronic
984086947 4:175325255-175325277 GCTCAAGCATGTGCATTCAGAGG + Intergenic
984113029 4:175643797-175643819 GCTCAAGCCTGCACACTAAGAGG + Intronic
984351458 4:178600179-178600201 TCTCAAGTATGTGCATTAAGAGG - Intergenic
985230840 4:187814811-187814833 GCTCAAGCATGCGCATTAAGAGG + Intergenic
985924653 5:3006412-3006434 GCTTGAGCATGTGCACTAAGAGG - Intergenic
986066565 5:4240234-4240256 GCTCAAGCATACACACTAAGAGG + Intergenic
986538033 5:8813146-8813168 GCTCAAGCATGTGCACTAAGAGG + Intergenic
986685034 5:10269066-10269088 GCTCAAGCATGCGCATTAAGAGG - Intergenic
986701713 5:10416749-10416771 GCTCTAGCAACTGGACTAAATGG - Intronic
986884353 5:12215549-12215571 ACTCAAGCATGTACACTAAGAGG - Intergenic
987274295 5:16345783-16345805 GCTCAAGCATGCACACTAAGGGG - Intergenic
987552612 5:19403452-19403474 ACTCAAGCATGAGCACTAAGAGG - Intergenic
987681798 5:21145463-21145485 GCTCAAGCATGTGCATTAAGAGG + Intergenic
987715541 5:21564678-21564700 CCTCAAGAATGTGCACCCAAAGG + Intergenic
987838976 5:23198297-23198319 GCTCAAACATGAGCACTAAGAGG - Intergenic
988098311 5:26645848-26645870 GCTCAAGCATGTACATTAAGAGG - Intergenic
988629629 5:32914923-32914945 GCTTAAGCATGAACATTAAAAGG + Intergenic
988650217 5:33140789-33140811 GCTCAACCATGCTCACTAAAAGG - Intergenic
988737674 5:34039033-34039055 GCTCAAGCATGTGCATTAAGAGG + Intronic
988783588 5:34545555-34545577 GCTCAAACATGTACATTAAGAGG - Intergenic
988882159 5:35515525-35515547 GCTCAAACATGTGCATTAAGAGG + Intergenic
989476768 5:41883258-41883280 GCTCAAGCATGCACAGTAAGAGG - Intergenic
989773991 5:45180918-45180940 GATCAAGCATGCACACTAAGAGG - Intergenic
990018625 5:51098332-51098354 GCTCAAGCATGCACATTAAGAGG - Intergenic
990213171 5:53502454-53502476 GCTCAAGCATGTGCATTCAAAGG - Intergenic
990444516 5:55881673-55881695 GCTCAAGCATGGCCATTAAGAGG - Intronic
990489239 5:56287804-56287826 GCTCAAGCATGTGGACTGAGAGG + Intergenic
990594154 5:57296257-57296279 GCTCAAGCATGTGCACTAAGAGG + Intergenic
991030497 5:62077460-62077482 GCTCAGGCATGCACACTAAGAGG + Intergenic
991145515 5:63298169-63298191 ACTAAAGTATGTGCACTGAAAGG - Intergenic
991164882 5:63554130-63554152 GCTCAAGCATGCTCACAAAGAGG + Intergenic
991267851 5:64744061-64744083 ACACAAGCATGTGCATTAAGAGG + Intronic
991482147 5:67092116-67092138 GCTCAGCAATGTGCACCAAATGG - Intronic
991657665 5:68920288-68920310 GCCCAAGCATGCGCATTAAGAGG - Intergenic
991929936 5:71744317-71744339 GTTCAAGCATGCGCACTAAGAGG + Intergenic
992399077 5:76395152-76395174 GCTCAAGCATGTGCACTCTGAGG + Intergenic
993364828 5:87022443-87022465 GCTTGAGCATGTGCAATAAGAGG + Intergenic
993749503 5:91649567-91649589 GCTCAAGCACGTGGAGTAAGAGG + Intergenic
994196533 5:96928900-96928922 GCTCAAGCATGTGCACTAAGAGG + Intronic
994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG + Intergenic
995331006 5:110945927-110945949 CCTCAAGAATGAGCACTAAAAGG + Intergenic
995582113 5:113613229-113613251 GCTCAAACATATGCATTAAGAGG - Intergenic
995918175 5:117276491-117276513 GCTCAGGCATGTGCACTAAGAGG + Intergenic
995966315 5:117911607-117911629 GCTCAAGCATGCACACTAAGAGG + Intergenic
996280930 5:121728322-121728344 GCTCAAGCATGTGCACTATGAGG + Intergenic
996289450 5:121834769-121834791 GCTCAAGCATATACATTAAGAGG + Intergenic
996906808 5:128610275-128610297 GCTCAAGCATGAGCATTAAGAGG - Intronic
996998243 5:129725499-129725521 GCTCAAGCATAAGCATTAAGAGG - Intronic
997065727 5:130556451-130556473 GCTCAAGCATGTGCACTAAGAGG + Intergenic
998942187 5:147296589-147296611 GCTCAAGCATGCACACTAAGAGG - Intronic
998960994 5:147486887-147486909 GATCAAGAATATGCAGTAAAAGG - Intronic
999518466 5:152324667-152324689 GCTCAAGCATGCACACTAAGAGG - Intergenic
999629301 5:153553703-153553725 GCTCAAGCATGCACACTAAGAGG - Intronic
1000089624 5:157919037-157919059 GCTCAAATATGTGCACTAAGAGG - Intergenic
1000233299 5:159335227-159335249 GCTTAAGCATGAGCACTAGGAGG + Intergenic
1000766620 5:165299529-165299551 GCTCAAGCATGCACACTAAGAGG - Intergenic
1001914270 5:175546719-175546741 GCTCAAGCATGCACACTAAGAGG - Intergenic
1003201994 6:3969850-3969872 GCTCACACATGCACACTAAAAGG - Intergenic
1003204297 6:3993013-3993035 GCTCAAGCATGTGCACTCAAAGG - Intergenic
1003783913 6:9461511-9461533 GCTCAAGCATGTTCACTAAGAGG - Intergenic
1003949266 6:11103201-11103223 GCTCAAGCATGCACCCTAAGAGG - Exonic
1004200675 6:13544786-13544808 ACTCAAGCATTTGCACTAAGAGG + Intergenic
1004271070 6:14195970-14195992 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1004291836 6:14374530-14374552 GCTCAAGCATGCACCCTAAGAGG - Intergenic
1004467706 6:15901363-15901385 GCCCAAGCATGCACACTAAGAGG - Intergenic
1004474279 6:15956720-15956742 GCTTAAGCATGCACACTAAGAGG - Intergenic
1004491787 6:16124631-16124653 GCTCAAGACTGAGCACTAGATGG - Intergenic
1004634657 6:17455202-17455224 ACTCAAGCATGAGCACTAAGAGG + Intronic
1005158270 6:22833509-22833531 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1005621389 6:27623794-27623816 GGTCAAGCATGTGCACTAAGAGG - Intergenic
1005812208 6:29526311-29526333 ACTTAAGCATGTGCACTAACAGG - Intergenic
1006017895 6:31097037-31097059 ACTCAAGCATGCTCACTAAGAGG + Intergenic
1007847225 6:44769367-44769389 GCTCACACATGCGCACTAAGAGG - Intergenic
1008290537 6:49710209-49710231 GCTCAATTATGTGCAAAAAAGGG + Intronic
1009001185 6:57717372-57717394 CCTCAAGAATGTGCACCCAAAGG - Intergenic
1009315018 6:62208250-62208272 ACTCAAGCCTGTGCAACAAAGGG - Intronic
1009746275 6:67820780-67820802 GCTCAAACATGTGAACTAAGAGG - Intergenic
1010868542 6:81010183-81010205 GCTAAAGGATGTACTCTAAACGG - Intergenic
1010913764 6:81590318-81590340 GCTCAAGCATGCACACTAAGAGG + Intronic
1011186478 6:84682220-84682242 GCTCAAGCATGCGCATTCAGAGG - Intergenic
1011478729 6:87773282-87773304 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1011594969 6:89007547-89007569 GCTCAAGCATGCGCACTAAAAGG + Intergenic
1012493696 6:99811236-99811258 GCTCAAGCATGTACGCTAAGAGG - Intergenic
1012779371 6:103537056-103537078 GCTCACACATGCACACTAAAAGG - Intergenic
1013528605 6:110998361-110998383 GCTCAAGCATGCACACTAGGAGG - Intronic
1013796584 6:113895645-113895667 GCTCATGCATGTGCACTGGGGGG + Intergenic
1013922063 6:115417431-115417453 GCTCAAGCATGCACACTCAGAGG - Intergenic
1014524952 6:122491347-122491369 GCTCAAGCATGCACATTAAGAGG - Intronic
1014555123 6:122836498-122836520 GCTCACACATGTGCACTAAGAGG + Intergenic
1014768433 6:125434104-125434126 GCTCAGGCATGTGCACTAAGGGG - Intergenic
1015580116 6:134715045-134715067 GCTCATGCATGCGCACTAGGAGG - Intergenic
1015707077 6:136099845-136099867 GCCCATGCATGTGTCCTAAATGG + Intronic
1016193999 6:141309296-141309318 ACTCAAGCATGTGCACTAAGAGG - Intergenic
1016235405 6:141857786-141857808 GCTCAAGCATGTGCATTAAAAGG - Intergenic
1016712927 6:147194057-147194079 GCTCAAACATGCACACTAAGAGG + Intergenic
1017422776 6:154290152-154290174 GCCCAAGTATGTGTACTAAAGGG + Intronic
1017426926 6:154331658-154331680 GCTCAAGCATGTGCACTAAGAGG + Intronic
1018455906 6:163951983-163952005 GCTCAAGCATGTGTGCTAAGAGG - Intergenic
1018664823 6:166125965-166125987 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1018824400 6:167398340-167398362 GCACAAGGACGTGCAGTAAAGGG + Intergenic
1018845887 6:167555168-167555190 GTTCAAGCATGCACACTAAGAGG - Intergenic
1020601427 7:10279218-10279240 TCTCAGGCATTTTCACTAAATGG - Intergenic
1021506345 7:21389657-21389679 GCTCAAGCGTGTGCGTTAAGAGG + Intergenic
1021512647 7:21451202-21451224 GCTCAAGCATACACACTAAGAGG - Intronic
1021598170 7:22339031-22339053 GCTCAAGCATGCGCACTAAGAGG + Intronic
1021688988 7:23214119-23214141 ACTCAAGCATGCCCACTAAGAGG - Intergenic
1021991069 7:26142219-26142241 GCTCACGCATGTGCCCTAAGAGG - Intergenic
1022321392 7:29291186-29291208 GCCCAAGCATGCGCACTAAGAGG - Intronic
1022818482 7:33935852-33935874 GCTCAAACTTGTCCACTGAATGG - Intronic
1023052188 7:36262754-36262776 GCTCAAGCATGTGTACTTAGAGG - Intronic
1023190018 7:37570364-37570386 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1024016803 7:45324734-45324756 GCTCATGCATGTGCACTAAGAGG + Intergenic
1024193986 7:47040856-47040878 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1024430432 7:49282314-49282336 GCTCAAGCATGCAGACTAAGAGG + Intergenic
1026130494 7:67616703-67616725 GCTCAAGCATGCGCATTAAGAGG + Intergenic
1026156047 7:67826732-67826754 GCTCAAGCATGTGCACTCAGAGG + Intergenic
1026274478 7:68864614-68864636 GTTCAAACATGCGCACTAAGAGG + Intergenic
1026322503 7:69279910-69279932 GCTCAAGCATGCACCCTAAGAGG - Intergenic
1026413143 7:70147823-70147845 GATCAAGCATGATCACTGAATGG + Intronic
1026626847 7:72001331-72001353 GCTCGTGTATGTGCACTAAGTGG + Intronic
1026741100 7:72979110-72979132 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1026800929 7:73399424-73399446 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1027102634 7:75385968-75385990 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1027596837 7:80184552-80184574 GCTCAAGCATGCACATTAAGAGG - Intronic
1027643448 7:80766785-80766807 GCTCAAGCATGTCCATTAACAGG + Intronic
1028077858 7:86536697-86536719 GCTTAAGCATGTACACTAAGAGG - Intergenic
1028832394 7:95342129-95342151 GTCCAAGCATGCGCACTAAGAGG + Intergenic
1029499260 7:100917819-100917841 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1029912997 7:104174740-104174762 GCTCAGGCATGTGCAGTAAGAGG + Intronic
1030193061 7:106829251-106829273 GCTCAAGCATGCACATTAATGGG + Intergenic
1030414842 7:109230073-109230095 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1030515509 7:110533435-110533457 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1030558255 7:111053440-111053462 GCTCAAGCATGTACATTAAGAGG - Intronic
1031347483 7:120686823-120686845 ACTCAAGCATGTGTACTAAGAGG - Intronic
1031637257 7:124116924-124116946 GTTCAAGCATGCACACTAAAAGG - Intergenic
1031639559 7:124145066-124145088 GCTCAAGCATGCACAATAAAAGG - Intergenic
1031779836 7:125947264-125947286 GTTCAAGCATGCGCATTAAGAGG - Intergenic
1033095285 7:138425190-138425212 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1033945553 7:146713328-146713350 GTTCCATCATTTGCACTAAATGG + Intronic
1034075393 7:148226554-148226576 GCCCAAGCATGCACACTAAGAGG + Intronic
1034325071 7:150222295-150222317 GCCCAAGGATGTGCACTAGGAGG - Intergenic
1034685578 7:152967976-152967998 GCTCAAGCATATGCATTAAAAGG + Intergenic
1034731343 7:153390027-153390049 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1034768130 7:153746954-153746976 GCCCAAGGATGTGCACTAGGAGG + Intergenic
1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1035818488 8:2565946-2565968 GCTCAAGCATGCACCCTAAGAGG - Intergenic
1036441193 8:8782405-8782427 GCTGAAGCATGCGCATTAAGAGG + Intergenic
1036626017 8:10472176-10472198 GCCCAAGCATGTGCACGAAGAGG - Intergenic
1037135382 8:15453946-15453968 GCTCAAGCATGTACACTAAGAGG + Intronic
1037586235 8:20278222-20278244 GTTCAAGCATGCGCACTAAGAGG + Intronic
1037941338 8:22953234-22953256 GCTCAAGCATGCGCACCATGGGG - Intronic
1038869845 8:31481965-31481987 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1038874643 8:31534799-31534821 GCTCAAGCATGTACACTAAAAGG - Intergenic
1038958132 8:32489308-32489330 GCTCACACATATGCACTAAGAGG - Intronic
1039096952 8:33896668-33896690 GCTCACACATGTGCATTAAAAGG + Intergenic
1039729149 8:40255816-40255838 GCTCAAGGATGTGCGCTAAGAGG - Intergenic
1039959287 8:42233412-42233434 GCTCAAGCATGCACATTAAGAGG - Intergenic
1041385686 8:57299414-57299436 GTTCACACATGTGCCCTAAAAGG - Intergenic
1041395603 8:57387913-57387935 TCTCAAGCATATGCACTAAGAGG + Intergenic
1041409781 8:57540847-57540869 GCTCAGGCATGCACACTAAAAGG - Intergenic
1041605600 8:59779431-59779453 GCTTGAGCATGTGCATTAAGAGG + Intergenic
1041810499 8:61903140-61903162 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1042230362 8:66548342-66548364 GCTCCAGCATGAGCACTAAGAGG - Intergenic
1042343974 8:67709042-67709064 GCTCAAGCATGCACGCTAAGAGG + Intronic
1042397107 8:68305711-68305733 GCTCAAGCATGCACATTAAGAGG + Intronic
1042397347 8:68307633-68307655 GCTCAAGCATGCGCACTAAGAGG - Intronic
1042536681 8:69865895-69865917 GCCCAAGCATGTGTCCTGAATGG - Intergenic
1042747725 8:72125652-72125674 GCTCAAGCATCCACACTAAGAGG + Intergenic
1042747880 8:72127204-72127226 GCTCATGCATTTGCACTAAGAGG + Intergenic
1042917342 8:73888661-73888683 GCTCAAGCATGCACACTAAGAGG + Intergenic
1043005126 8:74809392-74809414 GCTGAAGCTTGTTCACTAAGAGG + Intronic
1043239851 8:77918901-77918923 GCTCAAGCATGTACACTCTGGGG + Intergenic
1043853408 8:85239521-85239543 TCTCAAGCATGCACACTAAGAGG + Intronic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1044139910 8:88637537-88637559 GCTCAAGCATCTGCACTAAGAGG + Intergenic
1044362869 8:91309184-91309206 GCTCAAGCATGTGTATTAAGAGG - Intronic
1045427814 8:102084716-102084738 GTTCAAGCTTGTGGACTAAGAGG - Intronic
1046386889 8:113517739-113517761 GCTCAAGCATGCACACTAAGAGG + Intergenic
1046416043 8:113915091-113915113 GCTCAAGCATGCACACTACCTGG + Intergenic
1046463564 8:114572527-114572549 GCTCAAGCATGCGCACTAACAGG + Intergenic
1047450667 8:124962574-124962596 GCTCAAGCATACACACTAAGAGG + Intergenic
1047871792 8:129091272-129091294 GCTCAAGCATGCACACTAAGAGG - Intergenic
1048473957 8:134726504-134726526 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1049933126 9:475149-475171 GCTCAAGCATGTGCACTAAGAGG + Intronic
1050042928 9:1514612-1514634 GCTCAAGCATGCACACTAAGAGG - Intergenic
1050204858 9:3185932-3185954 GCTCAAGCATGCGCATTAAGAGG + Intergenic
1050815513 9:9806767-9806789 GCTCAAGCATGCACACTAAGAGG + Intronic
1050914606 9:11116173-11116195 TTTCAAGCATGTGCACTGAAAGG + Intergenic
1051179067 9:14391534-14391556 GCTCAAGCATGTGCACTAAGAGG + Intronic
1051598830 9:18851850-18851872 GCTCAACCATGTACACTAAGAGG - Intronic
1051889990 9:21931548-21931570 GCTCAAACATGGGCACTAAGAGG + Intronic
1051991212 9:23154459-23154481 ACTCAAGCATGCGCATTAAGAGG + Intergenic
1052160716 9:25255328-25255350 ACTCAGGCATGTGCACTAAGAGG + Intergenic
1052240860 9:26271824-26271846 GCTCAAGCATATGCACTGAGAGG - Intergenic
1053410899 9:37915555-37915577 GCTCAAGGAGGTGCATTTAAAGG + Intronic
1053451207 9:38195654-38195676 GCTCAAGCATGTGAACTAAGAGG + Intergenic
1053825801 9:42023023-42023045 CCTCAAGCATGCGCACTAAGAGG + Intronic
1054604762 9:67164370-67164392 CCTCAAGCATGCGCACTAAGAGG - Intergenic
1055464128 9:76547017-76547039 GCTCAAACATGAGCACTAAGCGG - Intergenic
1055998803 9:82192630-82192652 GCTCAAACATGCGCACTAAGAGG - Intergenic
1056303546 9:85267597-85267619 GCTCAAGCATGAGCATTAGGGGG - Intergenic
1056739709 9:89243865-89243887 GCTCAAGCATGTACAATAAGAGG - Intergenic
1057333110 9:94134530-94134552 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1058301020 9:103373156-103373178 GCTCATGCATGCACACTAAGAGG - Intergenic
1059768088 9:117402878-117402900 GCTCTAGCATCTGCTCTAAGGGG - Intronic
1059901393 9:118930349-118930371 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1060142572 9:121223124-121223146 GCTCAAGCATGCGCACTCAGAGG - Intronic
1060768991 9:126317143-126317165 GCTCAAGCATAAGCATTAAGAGG - Intergenic
1061554921 9:131361571-131361593 GCTCGAGCATGTGCATTAAGAGG - Intergenic
1185886697 X:3789614-3789636 GCTCAAGCACGCACACTAAGAGG + Intergenic
1185969659 X:4648399-4648421 GCTCAAGCATGCACATTAAGAGG - Intergenic
1186035785 X:5421979-5422001 GCTCAAGCATGTGCACTAAAAGG - Intergenic
1186321953 X:8437308-8437330 GCTCAAGGATGTGCAGTGCAAGG - Intergenic
1186538505 X:10374463-10374485 GTTCAATAATGTGGACTAAATGG + Intergenic
1186569186 X:10696152-10696174 GCTCAAGCATGCACACTAAGAGG + Intronic
1186570712 X:10712336-10712358 GTTCAAGCATGTACAATAAGAGG + Intronic
1186957795 X:14702184-14702206 GCTAAAGCATGGGGCCTAAAAGG + Intronic
1187187822 X:17003963-17003985 GCTTACGGATGTACACTAAATGG - Intronic
1187387563 X:18862371-18862393 GCTGGAGCATGTGCATTAAGGGG + Intergenic
1187613559 X:20969021-20969043 GATCAAGCATGTGCATTAAGAGG + Intergenic
1188091868 X:25974736-25974758 GCTCAAACATGCACACTAAGAGG + Intergenic
1188171367 X:26931908-26931930 GCTCAAGCAAGAGCACTAAGAGG + Intergenic
1188883391 X:35518442-35518464 GCTCAAGCATGCACATTAAGAGG - Intergenic
1188898655 X:35700558-35700580 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1188905770 X:35789429-35789451 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1188953647 X:36407809-36407831 GCTCAAGCATGCACACTAAGAGG + Intergenic
1188989755 X:36803185-36803207 GCTCAAGCATGCACACTAAGAGG + Intergenic
1189419909 X:40847634-40847656 GCTCAAGCATGCACACAAAATGG + Intergenic
1189683922 X:43544305-43544327 GATCAAGCATGTGCGCTAAGAGG - Intergenic
1189780408 X:44508453-44508475 ACTCAAGCGTGTTCACTAAGAGG - Intergenic
1189986062 X:46554291-46554313 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1190075200 X:47312025-47312047 GCTCAATCATGCGCACTAAGAGG - Intergenic
1190704302 X:53013683-53013705 GCTCAAGCATGCACACTAAGAGG - Intergenic
1191739736 X:64423982-64424004 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1191884602 X:65875501-65875523 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1191967948 X:66781104-66781126 TCTCAAACTTGTGCACTCAAGGG + Intergenic
1192831522 X:74755536-74755558 GCCCAAGCCTGTGAACCAAAGGG - Intronic
1193066636 X:77267415-77267437 GCTGAAGCATGTGCATTAAGAGG + Intergenic
1193330769 X:80233223-80233245 GCTCAGGCATGTGCACCAAGAGG - Intergenic
1193731957 X:85112683-85112705 ACTCAAGCATGCGCATTAAAAGG - Intergenic
1193732415 X:85116910-85116932 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1193870242 X:86788214-86788236 GCTTAAGCATGCACACTAAGAGG - Intronic
1193974699 X:88102871-88102893 GCTCAAGCATGCGCATTAAGAGG - Intergenic
1194111466 X:89839417-89839439 GTTCAAGCATATTCACTAAAAGG + Intergenic
1194302188 X:92202331-92202353 GCTCAAACATGTACAGTAAGAGG - Intronic
1194498864 X:94655260-94655282 GCTCAAGCATGCAAACTAAGAGG + Intergenic
1195325809 X:103757494-103757516 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1196366074 X:114925834-114925856 GCTCAAGCATGCCCATTAAGAGG + Intergenic
1197660744 X:129168687-129168709 GCTCAAGCATGCACATTAAGAGG + Intergenic
1198393620 X:136201495-136201517 GCTCAAGCATGTGCACTAAGAGG - Intronic
1198725944 X:139677058-139677080 GCTCATGCATGCACACTAAGAGG + Intronic
1198823490 X:140674185-140674207 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1199082352 X:143591066-143591088 GCTCAAGCATGCTCATTAAGAGG + Intergenic
1199246531 X:145611654-145611676 GCACAAGCATGTTCACTGATGGG + Intergenic
1199599159 X:149531285-149531307 GCTCCAGCATATGAACTACAAGG + Intronic
1200464136 Y:3494234-3494256 GTTCAAGCATATTCACTAAAAGG + Intergenic
1200492938 Y:3850711-3850733 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1200505742 Y:4009714-4009736 GCTGAAGCATGCGTACTAAGAGG - Intergenic
1201791918 Y:17850473-17850495 GCTGAAGAATCTGCACTACAAGG + Intergenic
1201809636 Y:18055516-18055538 GCTGAAGAATCTGCACTACAAGG - Intergenic
1202085726 Y:21134696-21134718 GCCCAAGCATGTGCAGTAAGAGG + Intergenic
1202274170 Y:23098550-23098572 ACTCAAGCATGCACACTAAGAGG + Intergenic
1202291856 Y:23322127-23322149 ACTCAAGCATGCACACTAAGAGG - Intergenic
1202427166 Y:24732295-24732317 ACTCAAGCATGCACACTAAGAGG + Intergenic
1202443625 Y:24937799-24937821 ACTCAAGCATGCACACTAAGAGG - Intergenic