ID: 983850422

View in Genome Browser
Species Human (GRCh38)
Location 4:172573241-172573263
Sequence CTTCATTGTTGACAATGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983850418_983850422 21 Left 983850418 4:172573197-172573219 CCTTTTCCCTACTCTGCATGAAT 0: 1
1: 0
2: 3
3: 28
4: 236
Right 983850422 4:172573241-172573263 CTTCATTGTTGACAATGTACTGG No data
983850419_983850422 15 Left 983850419 4:172573203-172573225 CCCTACTCTGCATGAATGCACAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 983850422 4:172573241-172573263 CTTCATTGTTGACAATGTACTGG No data
983850420_983850422 14 Left 983850420 4:172573204-172573226 CCTACTCTGCATGAATGCACACC 0: 1
1: 1
2: 0
3: 15
4: 107
Right 983850422 4:172573241-172573263 CTTCATTGTTGACAATGTACTGG No data
983850421_983850422 -7 Left 983850421 4:172573225-172573247 CCATCAAACTATTATGCTTCATT 0: 1
1: 0
2: 4
3: 25
4: 305
Right 983850422 4:172573241-172573263 CTTCATTGTTGACAATGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983850422 Original CRISPR CTTCATTGTTGACAATGTAC TGG Intronic
No off target data available for this crispr