ID: 983851393

View in Genome Browser
Species Human (GRCh38)
Location 4:172585118-172585140
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983851391_983851393 12 Left 983851391 4:172585083-172585105 CCAATACGGAAATATTTCATGAA 0: 1
1: 0
2: 2
3: 20
4: 244
Right 983851393 4:172585118-172585140 AACAGTCTAATGAAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr