ID: 983853525

View in Genome Browser
Species Human (GRCh38)
Location 4:172613049-172613071
Sequence ATGTGGAAGCTGAATGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983853525_983853531 27 Left 983853525 4:172613049-172613071 CCACATTCATTCAGCTTCCACAT 0: 1
1: 1
2: 1
3: 33
4: 302
Right 983853531 4:172613099-172613121 ATCAACTTAAAAGGTAGATAAGG 0: 1
1: 0
2: 0
3: 13
4: 252
983853525_983853530 18 Left 983853525 4:172613049-172613071 CCACATTCATTCAGCTTCCACAT 0: 1
1: 1
2: 1
3: 33
4: 302
Right 983853530 4:172613090-172613112 GACACTGGAATCAACTTAAAAGG 0: 1
1: 0
2: 5
3: 42
4: 292
983853525_983853529 3 Left 983853525 4:172613049-172613071 CCACATTCATTCAGCTTCCACAT 0: 1
1: 1
2: 1
3: 33
4: 302
Right 983853529 4:172613075-172613097 CCAGGCATTGTGCTAGACACTGG 0: 2
1: 17
2: 146
3: 633
4: 1999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983853525 Original CRISPR ATGTGGAAGCTGAATGAATG TGG (reversed) Intronic
900518725 1:3095567-3095589 ATGTGGAAGCTGAGTCCAGGGGG - Intronic
901457782 1:9373266-9373288 GTGTGGAGGCTGAGTGACTGGGG + Intergenic
902410936 1:16211202-16211224 ATGGGGAAGATGAAGGAGTGAGG + Intronic
902711024 1:18239795-18239817 ATGTGGAAGAAGATTGAAGGGGG - Intronic
903753969 1:25647805-25647827 ATGTGTGAGTTGAATGCATGTGG + Intronic
905327007 1:37160315-37160337 ATGTGGAAGGTCTCTGAATGGGG + Intergenic
906671082 1:47655574-47655596 ATCTGGAAGCTGACTTCATGTGG - Intergenic
906799097 1:48720529-48720551 ATGAGGAAACTGACTTAATGAGG - Intronic
907085270 1:51666685-51666707 ATGTGGAAGCTGAATTCATATGG + Intronic
907270893 1:53290511-53290533 AATTAGAAGCTGAAGGAATGGGG + Intronic
908307892 1:62842734-62842756 ATGTGGCAGGAAAATGAATGAGG + Intronic
908543380 1:65142556-65142578 ATGTGGTAGCTGGAACAATGGGG + Intergenic
908848749 1:68351935-68351957 ATGTGGATGTTGTATGAATTGGG + Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910660933 1:89671709-89671731 ATGTTTACGCTGAATTAATGTGG + Intronic
911907112 1:103584150-103584172 ATGTGGAAGCTGATTGATAATGG - Intergenic
912522208 1:110253407-110253429 CTGTGGCAGATGCATGAATGTGG - Intronic
912745529 1:112242646-112242668 TTGTGCAAGATGGATGAATGGGG + Intergenic
913475152 1:119229981-119230003 ATTTAGAAGCTGCATGAGTGAGG - Intergenic
913599672 1:120411036-120411058 AAGTGGAGGCTGAAGGACTGTGG - Intergenic
913699216 1:121357934-121357956 ATGTGGAAGCTGAAGCATAGAGG + Intronic
914087706 1:144468580-144468602 AAGTGGAGGCTGAAGGACTGTGG + Intergenic
914138329 1:144922111-144922133 ATGTGGAAGCTGAAGCATAGAGG - Intronic
914310905 1:146465625-146465647 AAGTGGAGGCTGAAGGACTGTGG - Intergenic
914314271 1:146495090-146495112 AAGTGGAGGCTGAAGGACTGTGG + Intergenic
914500077 1:148238291-148238313 AAGTGGAGGCTGAAGGACTGTGG - Intergenic
914591199 1:149107521-149107543 AAGTGGAGGCTGAAGGACTGTGG + Intergenic
917295874 1:173518601-173518623 AGGGGGAAGCTGAAAGAATTGGG + Intronic
918326701 1:183417566-183417588 AGGTGGATGCTGAGTGAATAGGG - Intronic
919677384 1:200397106-200397128 TTGTTGAAGCAGAATGACTGTGG - Intergenic
920486627 1:206376646-206376668 ATGTGGAAGCTGAAGCATAGAGG + Intronic
923373811 1:233339946-233339968 AAGTGTTTGCTGAATGAATGAGG - Intronic
924009275 1:239646865-239646887 ATGTGGAAATTGACTGAAGGTGG + Intronic
924083130 1:240420277-240420299 ATGTGGAAGCTGAGAGAAGTAGG - Intronic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
1063252514 10:4288798-4288820 ATGAGGACGCTGAAGGACTGTGG - Intergenic
1063488030 10:6438108-6438130 AAGTGAAAGCTGAATGGAAGTGG + Intronic
1063554906 10:7069123-7069145 ATGGGAATGCTGAATGATTGGGG + Intergenic
1063577853 10:7278240-7278262 CTGTGGAGACTGAAAGAATGGGG + Intronic
1063579644 10:7294082-7294104 ATGGGGAACCTGAATGAATGTGG - Intronic
1064194745 10:13235576-13235598 CTGTGGAAGGTGATTGAATTTGG - Intergenic
1066448400 10:35505290-35505312 ATGTGAAAACAGAATGAATGAGG + Intronic
1067083731 10:43227497-43227519 CTGGGGAAGCTGAAAGAAGGTGG + Intronic
1067477249 10:46575234-46575256 ATGAGGAAACTGAATCAAAGAGG - Intergenic
1067617490 10:47766547-47766569 ATGAGGAAACTGAATCAAAGAGG + Intergenic
1068941579 10:62686161-62686183 ATGAGAAAGCTGATTTAATGAGG - Intergenic
1070943415 10:80367417-80367439 ATGTGGGAGTTGAAAGAAAGTGG + Exonic
1071678955 10:87685084-87685106 ACATGGCAGGTGAATGAATGGGG - Intronic
1072018811 10:91378820-91378842 ATGTGCAAGCTGAACTACTGGGG - Intergenic
1072220007 10:93318873-93318895 AGGAGGAAGCTGACAGAATGTGG + Intronic
1072393323 10:95012605-95012627 ATGTGGCAGTAGAAAGAATGAGG - Intergenic
1073932676 10:108594246-108594268 ATGTGGAAGCATAATGAAGCAGG - Intergenic
1075374538 10:121967843-121967865 ATGTGGAAAATGATTGCATGTGG - Intronic
1075817712 10:125278393-125278415 TTGGGGAAGCAGAAAGAATGGGG - Intergenic
1078328061 11:10396568-10396590 ATGTGGCAGATGAAGGAAAGAGG + Intronic
1078911803 11:15739605-15739627 ATGTGGAGGAAGAATGGATGGGG - Intergenic
1080490293 11:32755174-32755196 ATGTCGAAGCTGACTGGGTGCGG - Intronic
1080720924 11:34847927-34847949 ATGAGGATGCTGGATGAAGGTGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1081193970 11:40138615-40138637 ATGTGGAAGGAAAATGAATCCGG - Intronic
1082864066 11:57882376-57882398 ATGTGTAAGCTGCATTAGTGGGG + Intergenic
1084056651 11:66638324-66638346 ATGTGGAAGCTTAACGAAGTTGG + Intronic
1084650935 11:70488808-70488830 ATGTGGATGTTGAATGTGTGGGG + Intronic
1084761457 11:71274465-71274487 ATGCTGAAGCTGAATGTATTTGG - Intergenic
1085377214 11:76075741-76075763 ATGGGGAACCTGAGGGAATGAGG - Intronic
1086270880 11:85065264-85065286 ATGTGGAAGATGCATTTATGGGG - Intronic
1086954574 11:92922912-92922934 GTTTGACAGCTGAATGAATGAGG + Intergenic
1087297331 11:96391608-96391630 ATCTGAAGGCTGAATCAATGAGG - Exonic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088257571 11:107915735-107915757 ATGTGGGATCTGACTGAATCTGG - Intronic
1088973628 11:114795326-114795348 ATAGGGAAGCTGAATGCAGGAGG - Intergenic
1093224682 12:16467642-16467664 ATGTTGAAGGTGAATGATTATGG - Intronic
1093823408 12:23650710-23650732 ATGCAGAAACGGAATGAATGGGG + Intronic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094248046 12:28325732-28325754 TTGCTGAAGCAGAATGAATGAGG + Intronic
1097042064 12:56161742-56161764 TTGTGTAAGATGGATGAATGGGG - Intronic
1098814679 12:75143440-75143462 GTGTGGCAGCTGAATGAAAGAGG - Intronic
1099010079 12:77281399-77281421 ATCTAGAAGCAGAAAGAATGTGG + Intergenic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099776932 12:87145808-87145830 ATGTGGAAGCTAAAGCTATGAGG - Intergenic
1099896995 12:88660959-88660981 ATATGGAAGCTGATTTTATGTGG - Intergenic
1100207433 12:92365994-92366016 GTGAAGAAGCTGTATGAATGGGG - Intergenic
1101665262 12:106806907-106806929 AATAGGAAGCTGAATGTATGTGG - Intronic
1102190975 12:110988101-110988123 AGCTGGAAGCAGAATGAAAGGGG - Intergenic
1102667364 12:114586662-114586684 AGGTGGATGATGAATAAATGGGG + Intergenic
1106313889 13:28577130-28577152 ATGTGGGAGGTGAATGAGAGGGG + Intergenic
1108028155 13:46200256-46200278 ATGTTGAAGCTGGCTGAAAGGGG + Intronic
1109402208 13:61848307-61848329 ATTTGAAAACTGAAAGAATGAGG - Intergenic
1110240935 13:73265899-73265921 ATATGGAAGCTTAATGATTATGG + Intergenic
1110297532 13:73885908-73885930 ATGTGGAATGTGAAGGAATGAGG + Intronic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1110829786 13:80017889-80017911 ATGTGCTAAATGAATGAATGAGG - Intergenic
1111827083 13:93281076-93281098 ATGCTGAAGCTGAATGACTTTGG - Intronic
1113115129 13:106867180-106867202 AGGGGGACGCTGAAAGAATGAGG + Intergenic
1114257953 14:21018513-21018535 AGCAGGAGGCTGAATGAATGAGG + Intronic
1114702897 14:24696583-24696605 GAGTGGAAGGTGAATGAGTGGGG + Intergenic
1114743094 14:25118305-25118327 ATTTGGAAACAGAGTGAATGGGG + Intergenic
1115997677 14:39211037-39211059 ATTTGGAATATGAAAGAATGTGG + Intergenic
1116508404 14:45714204-45714226 AATTGGAGGCTGAAAGAATGAGG - Intergenic
1117451402 14:55853580-55853602 ATGTGGGAGTTGAAGGAATGGGG - Intergenic
1117802583 14:59460246-59460268 ATGGGGAAGATGGATGACTGGGG + Intronic
1118473628 14:66097663-66097685 TTGGGAAAGCTGAATGAAAGAGG + Intergenic
1121915781 14:97835961-97835983 ATGTGGCTGCTGAATTCATGTGG - Intergenic
1122756811 14:103987376-103987398 ATTTGGAAGATGAATGAACAAGG - Intronic
1123476796 15:20596615-20596637 ATGTGGCAGGAGAAAGAATGGGG - Intergenic
1123641215 15:22403749-22403771 ATGTGGCAGGAGAAAGAATGGGG + Intergenic
1124342399 15:28898422-28898444 ATGTGGCAGCTGTGTGGATGGGG + Intronic
1125324559 15:38523979-38524001 GTGTCGAAGCAGAATTAATGAGG + Intronic
1125973789 15:43933621-43933643 ACGTGGAAGGTTAATGAAAGTGG - Intronic
1127762106 15:62149623-62149645 ATGTGTGAGCTGGAGGAATGAGG + Intergenic
1129081913 15:73048746-73048768 CTTGGGAAGCTGAATGAAGGTGG - Intergenic
1130773359 15:86947711-86947733 GTGTAGCAGCTGAATGACTGAGG + Intronic
1132737222 16:1392949-1392971 CTGGGGATGGTGAATGAATGGGG - Intronic
1133433166 16:5756197-5756219 ATGTGGAAGATGTAAGAAGGGGG - Intergenic
1134319663 16:13151057-13151079 AGGTGGGAGCTCAATGAATGGGG + Intronic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1137738861 16:50745294-50745316 AGGCAGAAGCTGAGTGAATGTGG + Intronic
1137995954 16:53213019-53213041 CTGAGGTAGCTGAATGAGTGTGG - Intronic
1138332162 16:56223905-56223927 AAATGGATGTTGAATGAATGAGG + Intronic
1139489063 16:67276932-67276954 GTGTGCAAGGTGAATGACTGTGG + Intergenic
1146050105 17:29543118-29543140 GTGTGGAAGCTGAGTGCATATGG + Exonic
1146471388 17:33127786-33127808 ATGTGGAAAATGAATGGAGGAGG - Intronic
1148618254 17:49015637-49015659 ATGTGGAAGCACAGAGAATGGGG - Intronic
1153681294 18:7503292-7503314 TTCTGGAAGCAGAATGAATGTGG + Intergenic
1156696281 18:39772332-39772354 ATGTGGATGTAGACTGAATGAGG + Intergenic
1156803693 18:41150049-41150071 AGGTGGAAACTGTATGGATGTGG + Intergenic
1158322787 18:56281724-56281746 ATGTGGATGCTCAGTGAATATGG - Intergenic
1158620273 18:59026908-59026930 ATGTGGAAACTCACGGAATGAGG - Intergenic
1158754044 18:60300698-60300720 AGGTAGAAGATGAATGATTGAGG + Intergenic
1159051638 18:63426013-63426035 ATATAAAAGCTGAATGAATTGGG - Intergenic
1159099011 18:63937730-63937752 AAGAGGAAACTGAATGAATTTGG - Intergenic
1159502717 18:69294671-69294693 ATTTGGAAGCAGTGTGAATGAGG + Intergenic
1159744550 18:72214879-72214901 ATGTGGATGGTGAATGAACGTGG - Intergenic
1159847438 18:73480172-73480194 ATGAGTAAGTTGAAAGAATGAGG + Intergenic
1161241397 19:3225477-3225499 CTGGGGAGGCTGAATGAATGGGG - Intronic
1163467744 19:17478546-17478568 ATGTGAGAGCTGAATTAAGGAGG + Intronic
1164230667 19:23284967-23284989 CTGTGGAAGCAAAATGAAAGTGG + Intergenic
1165523096 19:36329906-36329928 GTGTGAATGGTGAATGAATGGGG - Intergenic
1165798883 19:38535786-38535808 ATGCGCAAGCTGAAATAATGAGG - Intronic
926206196 2:10835671-10835693 ATTTGGCAGCTGAGTGAAGGTGG - Intronic
927423254 2:22954606-22954628 ATGAGGAAAGGGAATGAATGGGG + Intergenic
927770601 2:25857723-25857745 AAGTGAAAGCTGGATGACTGGGG - Intronic
928208020 2:29301094-29301116 ACAAGGAAGCTGAATGAATGCGG + Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
930020470 2:46998837-46998859 ATGTGCGATCAGAATGAATGAGG + Intronic
930051835 2:47222395-47222417 AAGTGTAAGCTGAAAGAAAGTGG + Intergenic
933087272 2:78070828-78070850 TTGTAGAAACTGATTGAATGAGG + Intergenic
934864440 2:97793499-97793521 ATTTGGAAGCTCAAGGAATATGG - Exonic
936590765 2:113801601-113801623 AGGTGGAAGCTGCTTTAATGAGG + Intergenic
936642537 2:114331071-114331093 TAGTGCAAGCTGAAAGAATGTGG + Intergenic
937897012 2:126984947-126984969 ATTTGGAAGCTGGACAAATGTGG - Intergenic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
940382040 2:153026143-153026165 ATGGGGAGGCTGTATGTATGTGG - Intergenic
943256569 2:185601177-185601199 CTGTGGAAAGTGAATGAAGGGGG + Intergenic
943477564 2:188377471-188377493 GTGTGGAAGCTGTATGACTTAGG + Intronic
944145868 2:196506586-196506608 AGGTGGTACCTGAATGACTGAGG - Intronic
945196788 2:207244500-207244522 ATGTACAAAGTGAATGAATGAGG - Intergenic
945200666 2:207277831-207277853 ATGTTGAAACTGAATCAGTGGGG - Intergenic
946202853 2:218080997-218081019 TTGTGAAAACTAAATGAATGGGG + Intronic
946358192 2:219202130-219202152 ATGCGGAAGCTGATTGAAGCTGG - Intronic
947173903 2:227341068-227341090 CTGTGGAAACTGAAAGAATCAGG + Intronic
947311264 2:228806090-228806112 ATGTGGAAGCTGCAGATATGGGG - Intergenic
948481392 2:238252685-238252707 TCGTGGAATCTGAATGAAGGAGG - Intronic
948550223 2:238765997-238766019 ATGTGGAAGCTCCATGGATTTGG + Intergenic
948785838 2:240352330-240352352 AGTTGGAAGCTCACTGAATGAGG - Intergenic
1170421706 20:16199904-16199926 ATGTGGTAGCTGACTGAATCAGG - Intergenic
1171814000 20:29767287-29767309 CTGTAGAAGCTGAATGGATAAGG - Intergenic
1173433834 20:43015275-43015297 ATGTGGAAGGTGAAGCAAGGAGG - Intronic
1174075343 20:47931548-47931570 ATGTGGAAACTGAAGCAAAGGGG + Intergenic
1174574629 20:51527609-51527631 ATGTGTTGGCTGAATGAATGAGG + Intronic
1174602437 20:51735699-51735721 AGGTGAAGACTGAATGAATGTGG - Intronic
1175346190 20:58278195-58278217 CAAGGGAAGCTGAATGAATGTGG - Intergenic
1175990891 20:62788484-62788506 CTTTAGAAGCTGAATGAATGGGG + Intergenic
1176997910 21:15578374-15578396 ATATTGAAGTTGAATGACTGTGG - Intergenic
1177014690 21:15771543-15771565 TTGTTGAAGCTGAATGAGCGAGG + Intronic
1177513219 21:22117040-22117062 ATGTTGAAGTTGAGTGAGTGGGG + Intergenic
1178671178 21:34592922-34592944 ATGTGGGAACTGAAGGAAAGAGG + Intronic
1183450819 22:37893973-37893995 ATGTGGCAGCTGAGTGGATGTGG + Intergenic
1184198100 22:42945637-42945659 TCTTGGAAGCTGATTGAATGTGG - Intronic
1184410671 22:44324377-44324399 CTGTGGTTGTTGAATGAATGAGG - Intergenic
949234670 3:1793747-1793769 ATGTGGAAGCCCAATAAAGGAGG - Intergenic
949777782 3:7651782-7651804 AGGAGGAAGCTTAATGGATGTGG + Intronic
950119923 3:10474948-10474970 ATGGGGACACTGAATGCATGAGG - Intronic
950625965 3:14247033-14247055 ATATGTTTGCTGAATGAATGAGG - Intergenic
950644995 3:14371800-14371822 CTGTGGAGGCAGAATGAATGGGG - Intergenic
951181525 3:19664725-19664747 ATGAGGAAGGAGAATGAAAGTGG - Intergenic
951698726 3:25472751-25472773 ATGTCAAAGCTGAATGAACTAGG - Intronic
952247776 3:31614244-31614266 ATGTGTAATCTGTATAAATGGGG + Intronic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
954033488 3:47837204-47837226 ATGGGGAATGAGAATGAATGTGG + Intronic
954429285 3:50461230-50461252 ATCGGGAATCTGAATGACTGGGG + Intronic
955070463 3:55568517-55568539 ATGTGGAACATGAAGGAAAGAGG - Intronic
955527954 3:59840185-59840207 ATGGGGAATCTGCAAGAATGGGG - Intronic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
958825415 3:99024136-99024158 ATGTGGTAGCTGAGTGAATTAGG + Intergenic
960186454 3:114646497-114646519 TTGTGGAAGTTGACAGAATGTGG + Intronic
961774086 3:129271730-129271752 ATCGAGAAGCTGAGTGAATGTGG + Intronic
962784948 3:138759678-138759700 ATGTTGAATTTGAATCAATGTGG - Intronic
963284821 3:143424118-143424140 ATGTGAAACCTGAATGATTCTGG + Intronic
964172778 3:153790479-153790501 ATCAGGCAGCTGAATGTATGAGG - Intergenic
967245228 3:187479919-187479941 ACTTGCAAGCTGACTGAATGTGG + Intergenic
968582346 4:1400938-1400960 ATGTGGAAGCTGGAGGGACGGGG + Intergenic
968611491 4:1559154-1559176 ATGGGGAAGCAGCGTGAATGTGG + Intergenic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
972201530 4:36719001-36719023 ATTTTGTAGCTGAATGATTGTGG + Intergenic
972796966 4:42430789-42430811 TGGTGGAAGCTGAATGAGGGAGG - Intronic
973619039 4:52709519-52709541 ACAGGGAAGCTGAATGAAGGTGG + Intergenic
974117915 4:57603368-57603390 CTGTTGTAGTTGAATGAATGTGG + Intergenic
978387343 4:108189275-108189297 ATGTGGAAACACAATGAAGGAGG - Intergenic
978481836 4:109201112-109201134 ATTTGGGAACTGATTGAATGTGG - Intronic
979723810 4:123935869-123935891 ATTTTGGACCTGAATGAATGTGG + Intergenic
979867645 4:125776477-125776499 ATGTGGAAGCTCAAGGCTTGGGG - Intergenic
981579712 4:146239249-146239271 AACTGGAACCTGAATGAATTGGG + Intergenic
981717772 4:147768652-147768674 TTGTAGAAGCTGAATAAATTTGG + Intronic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
982652313 4:158101544-158101566 ATGTGGAAGATGCAGGAGTGCGG + Intergenic
983457949 4:167987281-167987303 TTGTGGAAGCAGAATGATTCAGG + Intergenic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
984165876 4:176302794-176302816 AATAGGAAGCTGAATGAATGAGG - Intergenic
985517233 5:353319-353341 CTAAGGATGCTGAATGAATGTGG + Intronic
985992319 5:3573777-3573799 ACGGGAAAGCAGAATGAATGAGG + Intergenic
986404846 5:7415664-7415686 AGGTGCAAAATGAATGAATGTGG - Intronic
986491793 5:8299887-8299909 ATGAGGTAGCTGAAGGAATTAGG - Intergenic
986771143 5:10974990-10975012 TAGTGGTAGCTGAATGAATGAGG + Intronic
986994655 5:13593168-13593190 ATGTGAAAACTGAGTGGATGGGG + Intergenic
988248759 5:28726234-28726256 ATGTGCAAGCTGAATGAATGAGG + Intergenic
988876451 5:35452458-35452480 ATGTTGAAACTTAATCAATGAGG + Intergenic
991096627 5:62746652-62746674 ATCTCCAAACTGAATGAATGGGG - Intergenic
991573688 5:68080991-68081013 TGGAGGAAGCTGAATGAATGGGG - Intergenic
992662679 5:78976897-78976919 AGATGGTAGCTGAGTGAATGAGG - Intronic
993996974 5:94734875-94734897 ATGATGAAGCTGGAAGAATGAGG - Intronic
995267391 5:110178931-110178953 TGGTGGAAACTGAATGATTGGGG + Intergenic
998299769 5:141006593-141006615 AAGTGGAAGCAGACTGAATAAGG + Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999031886 5:148302718-148302740 TTGTGGAAGCTGAATTCAAGCGG + Intergenic
999250971 5:150182120-150182142 AGGTGGAAGCAGAAAGAATCTGG - Intronic
999875420 5:155800263-155800285 ATATGGAAGATGAATAAAAGAGG - Intergenic
1000725478 5:164764547-164764569 ATTTGGAAGCTGAAAAACTGAGG + Intergenic
1001380644 5:171304371-171304393 CTGTGGCAGGTGAATGAATGAGG - Intergenic
1003611365 6:7617577-7617599 ATTTGTCAGATGAATGAATGAGG + Intergenic
1003779711 6:9410925-9410947 ATTTGGAGACTGAATTAATGTGG + Intergenic
1004368153 6:15029416-15029438 ATGTGGAAGTTGGAGGCATGTGG - Intergenic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1005493763 6:26370641-26370663 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005498317 6:26407990-26408012 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1006025749 6:31145590-31145612 AGGAGGAAGGTGAATGGATGTGG + Intronic
1006096586 6:31660180-31660202 GTGTGGATGGTGAATGAATTTGG - Exonic
1007201423 6:40112898-40112920 ATGTGGAAGCTTGATGCATTGGG - Intergenic
1007871439 6:45043776-45043798 TAGTGAAAGCTGAATTAATGTGG - Intronic
1008593368 6:53016358-53016380 ATGTGGGTGGTTAATGAATGTGG - Intronic
1009470129 6:64022537-64022559 CTGTGAAAGCTGAAAGAATTTGG + Intronic
1009652169 6:66490014-66490036 ATGTGGTATCTGAGTGGATGTGG - Intergenic
1009975185 6:70664464-70664486 ATTTGGCAGCTGACTGTATGTGG - Intergenic
1010250764 6:73704743-73704765 ATGTGAAACATGAATGAATGGGG + Intronic
1010280176 6:74014175-74014197 CTCTGGGAGCTGAGTGAATGTGG + Intergenic
1011033996 6:82953723-82953745 ATGTGTTGACTGAATGAATGGGG - Intronic
1011118019 6:83916670-83916692 AAATGGAAGCTGAATGAGTAAGG + Intronic
1012339793 6:98105753-98105775 TTGTGTAAGCTGAATCAATTAGG + Intergenic
1012610689 6:101215440-101215462 ATGTAGAATATGAATTAATGAGG - Intergenic
1012978963 6:105810180-105810202 ATGTGGAGGCTGATGGAGTGTGG + Intergenic
1013594502 6:111648516-111648538 GTGTGGAAGTTGAAAGAAAGAGG + Intergenic
1013838080 6:114356629-114356651 CTGTGGAAGCAGAAAGAATGAGG + Intergenic
1015023628 6:128507049-128507071 ATGTGGAAACTGAAGGAAAGTGG + Intronic
1015455896 6:133425762-133425784 ATGTGGAGGCTGAATTAGAGAGG - Intronic
1016429869 6:143972177-143972199 AAATGCGAGCTGAATGAATGGGG - Intronic
1018229225 6:161659834-161659856 ATGTAGAACCTGAATAAGTGTGG - Intronic
1018504999 6:164456501-164456523 AAATAGCAGCTGAATGAATGAGG - Intergenic
1019702925 7:2482771-2482793 CTGTGGAAGCTGAGAAAATGAGG - Intergenic
1020750741 7:12138358-12138380 TTGTAGAAACTGATTGAATGTGG - Intergenic
1020791009 7:12628180-12628202 ATGAGGAGGCAGAATGAAAGTGG + Intronic
1021038935 7:15837226-15837248 ATTGCAAAGCTGAATGAATGAGG - Intergenic
1021934964 7:25621220-25621242 AGGAGGAAACTGAAGGAATGAGG - Intergenic
1024740907 7:52353368-52353390 ATGTGGCATCAGAATAAATGTGG + Intergenic
1024902526 7:54336680-54336702 ATGTGTAAGTGAAATGAATGAGG - Intergenic
1025017793 7:55453997-55454019 ATGTGGGTGATGAATAAATGAGG - Intronic
1026288061 7:68981074-68981096 CTTTGGAAGCTGAATGAACCAGG + Intergenic
1026392417 7:69914914-69914936 ATGTGGAAAATGAATTAATTGGG - Intronic
1027492606 7:78848296-78848318 ATGTGGAGGGTGAAGGAATGAGG - Intronic
1027720223 7:81731683-81731705 ATGAGGAAACTGAATGTATGGGG + Intronic
1027737258 7:81949302-81949324 ATGTAAATGCTGAATGATTGGGG - Exonic
1028738584 7:94246756-94246778 AGGTGGCAGGTGAATGAATGAGG + Intergenic
1031262052 7:119533417-119533439 ATGTCGAAGTTGAATGCCTGTGG - Intergenic
1032358111 7:131229099-131229121 ATCTGGAAGCAGAATGTAGGGGG + Intronic
1033226761 7:139568818-139568840 ATGTGGCAGCTCCATGCATGGGG + Exonic
1033732440 7:144193191-144193213 ATGTGGATGCAGAATGTCTGTGG - Intronic
1033750610 7:144357824-144357846 ATGTGGATGCAGAATGTCTGTGG + Intronic
1033890381 7:146006106-146006128 AACTGGAAGCTTAATGAGTGAGG - Intergenic
1034018741 7:147616660-147616682 AAGTGGAAGGAGAATGATTGAGG - Intronic
1035566852 8:646981-647003 ATGAGGACCCTGTATGAATGTGG - Intronic
1036601830 8:10267960-10267982 ATATGCAAGGGGAATGAATGTGG - Intronic
1037240417 8:16771052-16771074 ATGTGAAAGCTGGATAATTGAGG + Intergenic
1038569327 8:28646917-28646939 TAGTGTATGCTGAATGAATGGGG - Intronic
1038837279 8:31140354-31140376 ATGTGTAGGATGAATGAAAGAGG + Intronic
1039053619 8:33516126-33516148 AAGGGAAAGCTGAATGAAAGAGG - Intergenic
1039348282 8:36732342-36732364 ATATGGAAGATGAATGGAAGAGG - Intergenic
1039408049 8:37329452-37329474 ATGTTGTAGCTGAATTAATTGGG + Intergenic
1039444191 8:37617830-37617852 ATGTGGGAGCTCAAAAAATGTGG + Intergenic
1041343804 8:56874182-56874204 ATGTGGAAGCTGAAGTGATGAGG - Intergenic
1041539741 8:58970156-58970178 ACGTGGAAACTGACTGACTGTGG - Intronic
1042148467 8:65757045-65757067 ATGTGGAGGCTCCCTGAATGCGG + Intronic
1043157308 8:76799874-76799896 AAGTGAAAGCTGAATGAACACGG - Intronic
1043260210 8:78186009-78186031 ATGTTGTAGTTGAATGACTGTGG + Intergenic
1043663400 8:82776117-82776139 ATCTGGAAGCTGAAGGAGTAAGG - Intergenic
1047163743 8:122412362-122412384 ATGTGGAGGCTGAAGGAAAGAGG - Intergenic
1047191758 8:122684787-122684809 ATTTGGAAGGTTTATGAATGAGG - Intergenic
1048579562 8:135719838-135719860 ATGTGGCAGCTGCATGAAGCTGG - Intergenic
1049915475 9:313366-313388 ATGTGGCAACTTAATGATTGGGG + Intronic
1052405258 9:28051686-28051708 CTGTGGAACTTGAATGACTGTGG - Intronic
1052567567 9:30176032-30176054 ATGTGGGAGTTGAAAAAATGGGG + Intergenic
1052755792 9:32539343-32539365 ATTTGGCAGCTGAATGAGGGGGG + Intergenic
1053345718 9:37376875-37376897 AGATGAAAGCAGAATGAATGGGG + Intergenic
1055915691 9:81397810-81397832 ATGTTGAAGAGAAATGAATGAGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1058872460 9:109214404-109214426 ATCTGGGAGCTGAAAGAAAGAGG + Intronic
1059333014 9:113548422-113548444 TTGTTGGAGCAGAATGAATGGGG + Intronic
1059925853 9:119208523-119208545 ATGTGGAATCTGAAACAATGTGG + Intronic
1061693291 9:132353184-132353206 ATGTGGAAGCTGGATCATCGCGG - Intronic
1187496468 X:19799932-19799954 GTGTGGAACCTGTATGACTGAGG + Intronic
1187827337 X:23345168-23345190 ATGTGGAGCCTGAATAATTGTGG - Intronic
1188677372 X:32958780-32958802 ATGTAGAAGTTAAGTGAATGAGG - Intronic
1189176024 X:38958036-38958058 ACATGGATGCTCAATGAATGGGG + Intergenic
1189344775 X:40232654-40232676 CTGAGGAAGCTGACTCAATGTGG - Intergenic
1190196453 X:48323408-48323430 TTGAGGAAGCTGAATAAGTGTGG + Intergenic
1191190540 X:57662068-57662090 ATCTGGAAGATGAAGGAAAGGGG - Intergenic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1193174491 X:78376440-78376462 AATTGGAAGCTGAATGAATAAGG - Intergenic
1193530116 X:82645940-82645962 ATGGGCAAGGTGAATGAATTGGG + Intergenic
1193892474 X:87067368-87067390 ATGTAGCAGCTAAAAGAATGAGG + Intergenic
1194242976 X:91474437-91474459 TGGTGGAAGGTGAATGAAGGGGG + Intergenic
1194560630 X:95415166-95415188 ATGTTGAAATTCAATGAATGGGG - Intergenic
1194853107 X:98892973-98892995 ATGTTGAAGCTTACTGAATACGG + Intergenic
1195282629 X:103350639-103350661 ATGAGGAAGCTGAAGCCATGAGG + Intergenic
1197005032 X:121485925-121485947 ATGTGGAAGCTGAAAATAAGTGG - Intergenic
1198116402 X:133549195-133549217 GTGGGGAAGCTGAAGGAAAGAGG - Intronic
1199091141 X:143693630-143693652 ATGTGGGATATGAATGAATTAGG + Intergenic
1199477812 X:148265128-148265150 AGATGGAAGCTGTTTGAATGTGG + Intergenic