ID: 983859273

View in Genome Browser
Species Human (GRCh38)
Location 4:172685050-172685072
Sequence TAGAATGCTTAATATGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 6, 3: 103, 4: 749}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983859273_983859274 13 Left 983859273 4:172685050-172685072 CCTTGCACATATTAAGCATTCTA 0: 1
1: 0
2: 6
3: 103
4: 749
Right 983859274 4:172685086-172685108 CAAAAATTTCAGATATGTAGAGG 0: 1
1: 0
2: 0
3: 26
4: 295
983859273_983859275 25 Left 983859273 4:172685050-172685072 CCTTGCACATATTAAGCATTCTA 0: 1
1: 0
2: 6
3: 103
4: 749
Right 983859275 4:172685098-172685120 ATATGTAGAGGAAAATACTATGG 0: 1
1: 0
2: 3
3: 22
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983859273 Original CRISPR TAGAATGCTTAATATGTGCA AGG (reversed) Intronic
902207702 1:14881535-14881557 TAGAATACTGATTATGTGCTAGG + Intronic
903475074 1:23613849-23613871 TAGAATGCTTTAAAAGTGCCTGG - Intronic
904040353 1:27580717-27580739 TTAAATGCTTATTATGTGCCAGG - Intronic
904083489 1:27887023-27887045 TTGAATGTTTACTATGTGCTAGG - Intergenic
904553116 1:31337871-31337893 TTAAGTGCTTAATATGTGCTAGG + Intronic
904681118 1:32229974-32229996 TAGAGTGCCTACTATGTGCTGGG - Intronic
904874751 1:33645661-33645683 CAGAATGCATGATATGTGCCAGG + Intronic
904947109 1:34207437-34207459 TTGAGTCCTTACTATGTGCAGGG + Intronic
904947559 1:34210615-34210637 TTGACTGCTTAAAATGTGCCCGG - Intronic
905245305 1:36609110-36609132 TTGAATGCTTTCTATGTGCCAGG + Intergenic
905833754 1:41098393-41098415 TTGAATGCTTAATATGTGCCAGG + Intronic
906730807 1:48079502-48079524 TCTAATGCTTATTATGTGCCAGG + Intergenic
906777367 1:48541817-48541839 TATAATGTTTAATACGTGCTAGG + Intronic
906822327 1:48942649-48942671 TTGAATGTTTACTATGTCCAGGG - Intronic
907034349 1:51202968-51202990 TAGAGTGCTTGATATGTGCTGGG - Intergenic
907715849 1:56925323-56925345 TGGAATGCTTACTAGGTTCAGGG + Intergenic
907835134 1:58101593-58101615 GTTAATGCTTAATATGTGCCAGG - Intronic
908178944 1:61585104-61585126 TCGAATGCTTACTCTGTGCCAGG - Intergenic
908312491 1:62899086-62899108 TTGAATGCTTACTCTGTGCCAGG - Intergenic
908335068 1:63114173-63114195 TAGACTGCTTACCATGTGCCAGG + Intergenic
908508861 1:64834381-64834403 TGTAGTGCTTAATATGTGTAAGG - Exonic
908636458 1:66171789-66171811 TTGAGTGCTTCATATGTGCCAGG - Intronic
908897521 1:68917164-68917186 TTGACTGCTTACTATGTGCAAGG + Intergenic
909046627 1:70718449-70718471 AAGAATGCTTAGTGTGTGCCAGG + Intergenic
909124348 1:71646886-71646908 TAGAAATATTAATATATGCAGGG - Intronic
909857320 1:80552861-80552883 TTCAATGCTTAATAAGTGCCAGG + Intergenic
910255757 1:85245733-85245755 TTGAATGCTTGCTATGTGCCAGG - Intergenic
910356000 1:86355930-86355952 TTGAGTGCTTACTATGTGCTAGG + Intronic
910497495 1:87848536-87848558 TAAAATGCTTAGTTTGTGCTAGG + Intergenic
912183958 1:107252140-107252162 TAGAATGCTTATTATAAGCCAGG - Intronic
912691007 1:111804653-111804675 ATGAATGCTTACTATGTGCCAGG + Intronic
913123777 1:115766445-115766467 TTAAATGCTTACTAAGTGCAGGG - Intronic
913145924 1:115989835-115989857 TATAATGCTAACTATGTGCGAGG - Intronic
913183517 1:116345421-116345443 TTGAGTGCTTACTATGTGCCAGG + Intergenic
913381932 1:118221007-118221029 TAGAATGTATAATCTGTGGAAGG + Intergenic
914213040 1:145599185-145599207 TGGAGTGCTTATTATGTGCCAGG - Intergenic
914464975 1:147919524-147919546 TGGAATGCTTACCATGTGCCAGG - Intergenic
914992196 1:152508465-152508487 TTGAATGCTTACTATATGCCGGG + Intergenic
915459913 1:156063907-156063929 CTGAATGCTTACTATGTGCCAGG - Intronic
915785973 1:158612511-158612533 TTGAATGCTTACTATGTTCCAGG - Intronic
915989607 1:160500726-160500748 TGGGATGCTTACTATGTGCCAGG - Intronic
916018141 1:160768535-160768557 AAAATTGCTGAATATGTGCATGG - Intergenic
916425702 1:164677702-164677724 TAGAAATCTTAGTGTGTGCAGGG + Intronic
916512791 1:165487758-165487780 TTGAACGCTTACTATATGCAAGG - Intergenic
916742336 1:167657136-167657158 TTGAGTGCTTACTATGTGCAAGG - Intronic
916946722 1:169736600-169736622 TTGAGTGCTTACTATGTGCCAGG + Intronic
917018846 1:170564048-170564070 TTGAATGCCTATTGTGTGCAGGG - Intergenic
917046259 1:170864012-170864034 TAGAATTTTTAATAATTGCAAGG - Intergenic
917332269 1:173893681-173893703 TTGAATGCTTACTATGTGCCAGG + Exonic
918488299 1:185052909-185052931 TACAGTGCTTAATATGAGCCAGG + Intronic
918518211 1:185385840-185385862 TTGAATGCTTATTATGGGCCAGG + Intergenic
919113632 1:193252826-193252848 CTGAATGCCTACTATGTGCAAGG - Exonic
919275499 1:195410108-195410130 TTACAAGCTTAATATGTGCAAGG - Intergenic
919404231 1:197156840-197156862 ATGAATGCTTACTATGTGCCAGG - Exonic
919419208 1:197350366-197350388 TTGAGTGCTTAATATGTGCAAGG - Intronic
919722614 1:200855522-200855544 TAGAATGCTTACTATGTTCTAGG + Intronic
919784626 1:201251422-201251444 TGGAGTGCTTACTATGTGCCAGG + Intergenic
920026395 1:203000866-203000888 TTGAGTGCTTATTATGTGCCAGG + Intergenic
920115924 1:203621402-203621424 CTGAATGCTTACTATGTGCTAGG - Intergenic
920601918 1:207334981-207335003 TTGAAGGGTTAATATTTGCATGG - Intronic
920624558 1:207584420-207584442 TAGGATGCTTAATTTGGGAAAGG + Intronic
920700446 1:208214249-208214271 TTGAATGCTTATTATGTTCCAGG + Intronic
920723568 1:208412709-208412731 TATAATGCTTAGTATGTGCCAGG - Intergenic
920825793 1:209423289-209423311 TTGAGTGCTTATTATGTGCCAGG - Intergenic
921347749 1:214204228-214204250 TTGAATACTTCCTATGTGCAAGG - Intergenic
921898527 1:220425861-220425883 TTGATTGCTTACTATGTGCCAGG + Intergenic
921961224 1:221036512-221036534 TGGAGTGCTTACTATGTGCTTGG + Intergenic
922126543 1:222731289-222731311 TTGAGTGCCTAATATGTTCAAGG - Intronic
922253826 1:223874340-223874362 TGGAATGCTTACTATGGGCCAGG - Intergenic
922581230 1:226699605-226699627 TTGAATGCTTAATATGCTCCAGG - Intronic
923117433 1:230956014-230956036 TTGCATTCTTAATATGTGCCAGG + Intronic
923864517 1:237925306-237925328 CTGAATGCTTGCTATGTGCAAGG + Intergenic
924574097 1:245263528-245263550 TGGAATACTTAGTATGTGCTAGG + Intronic
1063177443 10:3564585-3564607 TAGAACACTTCAAATGTGCATGG - Intergenic
1063497756 10:6526081-6526103 TAGAAGGCTTACTATGTGCTGGG - Intronic
1063578466 10:7283173-7283195 TTGAATGTTTACTATGTGCCAGG - Intronic
1063722637 10:8599646-8599668 TTAAATGCTTACTATGTGCCAGG + Intergenic
1064264301 10:13812493-13812515 TTGAATGCCTACTATGTACAGGG + Intronic
1064628852 10:17288498-17288520 TTGAATCCTTAAAAGGTGCAGGG - Intergenic
1064828436 10:19433041-19433063 TTGAACACTTACTATGTGCAGGG + Intronic
1065107229 10:22402188-22402210 TTGCGTGCTTAATATGTGCCTGG - Intronic
1065502507 10:26395928-26395950 TATTATGCTTCCTATGTGCAGGG + Intergenic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1067656247 10:48194127-48194149 CTGAATGCTTACTATGTGCCAGG + Intronic
1067918246 10:50424033-50424055 AAGAATGCTATATATGTCCAAGG + Intronic
1068224894 10:54095027-54095049 TAGAGTGCATTTTATGTGCAAGG + Intronic
1068892570 10:62162886-62162908 TTGAATGCTTACTTTGTGCCAGG + Intergenic
1069164232 10:65130532-65130554 CAGCATGCTTAATTTGTGAAGGG - Intergenic
1069272931 10:66553106-66553128 TAATATGCTTAATATTTGCATGG + Intronic
1070664777 10:78335366-78335388 TAGAATGCCTCCCATGTGCATGG - Intergenic
1070667403 10:78355045-78355067 TTGAGTGCTTCATATGTGCTGGG + Intergenic
1070920899 10:80185611-80185633 TTAAATGCTTACTATGTGCCAGG + Intronic
1071487151 10:86109927-86109949 TTGAATGCTTACTTTGTGCTAGG - Intronic
1071731293 10:88251455-88251477 TAGTATGCTTAGCATGTGCTGGG - Intergenic
1072301135 10:94063443-94063465 TAGAATGCCTACTATGTGCCAGG - Intronic
1072301767 10:94068631-94068653 TGGAATGCTTACTATATGCCTGG + Intronic
1072326050 10:94299873-94299895 TAGAATGCTTTCTATGTGCCAGG - Intronic
1072489465 10:95889469-95889491 TAGAATGCTTTATCTTTGCATGG - Intronic
1072713717 10:97735571-97735593 CAGAATGCCTACTATGTGCCAGG + Intergenic
1072758530 10:98037111-98037133 TGGAATGCTCACTATGTGCCAGG - Intergenic
1072769993 10:98129887-98129909 TAGTATACCTACTATGTGCAAGG + Intergenic
1072816654 10:98516145-98516167 TAGAGTACTTAAGATGTGCTCGG + Intronic
1072880579 10:99223294-99223316 TTGAATGCTTATTATGTGCCAGG - Intronic
1072910704 10:99498252-99498274 TTGAATGCTGAACATGTGCCAGG + Intergenic
1073351040 10:102820025-102820047 TTGAGTGCTTACTATGTGCCTGG + Intergenic
1073444433 10:103572157-103572179 TAGAACACTTACTATGTGCAAGG + Intronic
1073637887 10:105218388-105218410 TTGAAGTCTTAAAATGTGCAAGG + Intronic
1073652259 10:105373965-105373987 TGGAATGCCTACTATGTGCTAGG + Intergenic
1074127959 10:110544928-110544950 TAGAGTGCTTACTATGTGCCAGG + Intergenic
1074638444 10:115348651-115348673 TTGAATGCCTAATAAATGCAAGG + Intronic
1074737731 10:116453387-116453409 TAGAATGATTAATATGTTGGGGG + Intronic
1075318405 10:121470195-121470217 TGGAAAGCTTAATGCGTGCAAGG + Intergenic
1075458402 10:122599781-122599803 AAGAATGCCTAAGACGTGCAAGG + Intronic
1076125110 10:127967922-127967944 TTGAATACCTACTATGTGCAAGG + Intronic
1076556109 10:131322494-131322516 TACAATGTTTAAAAAGTGCAAGG + Intergenic
1077621993 11:3733888-3733910 TAGGTAGCTGAATATGTGCAAGG - Intronic
1078008643 11:7552289-7552311 TATAGTGCTTACTATGTGCCAGG - Intronic
1078272197 11:9806287-9806309 TCGACTGCTTACTATGTGCCAGG - Intronic
1078707545 11:13759610-13759632 TTGCATGCTTAATGTGTGCCAGG + Intergenic
1078709643 11:13778627-13778649 TAACATGTTTATTATGTGCAAGG - Intergenic
1078944685 11:16051199-16051221 GAAAATGCTTAGTATGTGCTTGG - Intronic
1079337067 11:19579315-19579337 GAGAATCCTTAATATTTGCCAGG - Intronic
1079815253 11:25048416-25048438 TATAAAGCTTATTAAGTGCAGGG - Intronic
1079848913 11:25504598-25504620 TTGAATGCTTAATCCGTGGAGGG + Intergenic
1079918704 11:26403816-26403838 TAAAATGCTTGAAATGTTCAAGG - Intronic
1080548429 11:33346178-33346200 TATAAGACTTAATATTTGCAAGG + Intronic
1080648922 11:34207584-34207606 TTGAAGGCTTACTATGTGCCAGG + Intronic
1080727241 11:34910677-34910699 TAGAGTGCTTATTTTGTGCCAGG + Intronic
1081211152 11:40336014-40336036 TACAATGCTTAGTATGTGTCAGG - Intronic
1081214218 11:40374495-40374517 TTGAATACTTAATATGTACCAGG + Intronic
1081796843 11:45826300-45826322 TTGAGTGCCTAATATGTGCTGGG + Intergenic
1082027005 11:47579636-47579658 TTGAGTGCTTAATGTGTGCCTGG + Intronic
1082130707 11:48485720-48485742 TAGAATGCATTTTGTGTGCAAGG - Intergenic
1082246080 11:49924376-49924398 TAGAATGCATTGTGTGTGCAAGG + Intergenic
1082564217 11:54656592-54656614 TAGAATGCATTTTGTGTGCAAGG - Intergenic
1082944844 11:58747389-58747411 TGGAATGTTTAACATGTGCCAGG + Intergenic
1084081993 11:66833491-66833513 TAGAAAGCTGAAGATGTGGATGG - Intronic
1084114560 11:67034527-67034549 TTGAATGCCTACTATGTGCTAGG - Intronic
1085419977 11:76348585-76348607 TTGAATGCTTACTGTGTGCCAGG - Intergenic
1085541232 11:77271902-77271924 TTGGATGCTTACTATGTGCCAGG - Intronic
1085727038 11:78963055-78963077 TACAATGCCTACTATGTGCCAGG - Intronic
1085769538 11:79312371-79312393 TATAATGCTTACTATGTACCAGG + Intronic
1085884276 11:80504455-80504477 TGGAATGCTTAAGATCAGCATGG + Intergenic
1086048884 11:82565785-82565807 TAGAAAGCTTAATTTGCCCAAGG + Intergenic
1086101399 11:83103636-83103658 TTGAGTGCCTAATATGTGCCAGG + Intergenic
1086147890 11:83574052-83574074 TAACATGCTTATTATGTGCCAGG - Intronic
1086539934 11:87896843-87896865 TTGAGTGCCTAATATGTGCTGGG - Intergenic
1087139795 11:94754126-94754148 TAGAGTGCCAAATATGTGCTGGG - Intronic
1088155232 11:106794841-106794863 TTGAATGCCTAATATGTGCTAGG - Intronic
1088212063 11:107467338-107467360 TATAGGGCTTAATATGTGCCAGG + Intergenic
1088762341 11:112943915-112943937 TTGAACACTTAATATGTGTAAGG - Intergenic
1089130145 11:116205843-116205865 TCGAGTGCTCATTATGTGCACGG + Intergenic
1089263169 11:117236830-117236852 TTGAATGTTTACTATGTGCCAGG + Intronic
1089327978 11:117670388-117670410 TCGAATACTTATTATGTGCAAGG + Intronic
1089889631 11:121868067-121868089 TAGAATGCTTTCTATCTGCATGG + Intergenic
1090044582 11:123319890-123319912 TAGAATGCCTACTAAATGCAAGG - Intergenic
1090483738 11:127092601-127092623 GAGAATCTTTAATATGTCCATGG - Intergenic
1090964668 11:131587998-131588020 TGGAATGCTTGCTATGTGCCAGG + Intronic
1091061990 11:132472293-132472315 TGGAGTGCTTACTATGTGCTAGG - Intronic
1091294335 11:134462360-134462382 TTGAATACTTACTATGTGCCAGG + Intergenic
1091538434 12:1435933-1435955 TAGAGTGCTTAATAAGAACATGG - Intronic
1091956820 12:4651590-4651612 TAGAATGCTTAATGTGCTCTAGG + Intronic
1092698783 12:11203807-11203829 CAGAACGATTAATATGTGTAAGG + Intergenic
1093511440 12:19934240-19934262 TAGAGTGCTTACTATGTCCCAGG + Intergenic
1093533814 12:20199695-20199717 TTGAAAGCTTAACATGTACAGGG - Intergenic
1093666716 12:21823038-21823060 TAGATTGCTTAGGATGTGTAAGG - Intronic
1094235444 12:28160569-28160591 TAGAATGGAGAATATGTGGAAGG + Intronic
1094277397 12:28693495-28693517 TTTAGTGCTTAATATGTGCCAGG + Intergenic
1095194647 12:39298964-39298986 TATAGTGCTTACTATGTGCGAGG - Intronic
1095669106 12:44837066-44837088 TAAAATGCTCACTATGTGCCAGG - Intronic
1096023835 12:48344278-48344300 TTGAGTGCTTATTATGTGCTTGG + Intronic
1097294478 12:57947748-57947770 TTGAATGCTTACTATGGGCCAGG - Intronic
1097630668 12:62058429-62058451 TAGAGTGCTCACTATGTGCTGGG + Intronic
1097657983 12:62392918-62392940 TAGTATGCCTAATATGTACCAGG - Intronic
1097722439 12:63037615-63037637 TTGAGTGCCTAATATGTGCCAGG - Intergenic
1097816865 12:64084105-64084127 TAAAATACTTAAAATGTGTATGG - Intronic
1098143948 12:67479651-67479673 TTGAATGCTTTCTATGTGCCAGG + Intergenic
1098917177 12:76269612-76269634 TTGAGTGCTTACTATGTGCTAGG - Intergenic
1099237880 12:80103671-80103693 TTGAATGCCAACTATGTGCAAGG - Intergenic
1099853479 12:88134756-88134778 TAGAGTCCTTACTATGTGCCAGG - Intronic
1100271946 12:93034323-93034345 TTGAATGCTTACTATGGGCCAGG + Intergenic
1100959685 12:99948550-99948572 TTGAATTCCCAATATGTGCAAGG - Intronic
1100982622 12:100173286-100173308 TAGAATGCATAATAGGGGTATGG + Intergenic
1101140608 12:101791887-101791909 TTGAGCGCTTAATATGTGCTAGG + Intronic
1101229742 12:102728016-102728038 TAGTATACTTACTATGTGCCAGG - Intergenic
1101587862 12:106100631-106100653 TAAAGTGCTTACTATGTGCCAGG - Intronic
1101670247 12:106864408-106864430 TTGAGTGCTTAATATGTGCCAGG + Intronic
1102255452 12:111412194-111412216 TTGAGTGCTTACTATGTGCCAGG - Intronic
1102293104 12:111716985-111717007 TCGAATGGTTAATATGTGCCAGG + Intronic
1102556127 12:113727808-113727830 TGGAATGGTCACTATGTGCAAGG + Intergenic
1102748810 12:115274024-115274046 TTGAGTGCTTACTATGTGCCAGG + Intergenic
1102847245 12:116198764-116198786 TTGCATGCTTACTATGTGGAGGG - Intronic
1103217378 12:119212384-119212406 TTGAGTGCTTACTATGTGCCAGG + Intronic
1104035782 12:125096309-125096331 CTGAATGCTTACTATGTGCCAGG - Intronic
1104582097 12:130018528-130018550 TACAATGCTTACTTTGTGCTGGG + Intergenic
1105784107 13:23731061-23731083 TTGAATTCTTAATATATGCTAGG - Intronic
1106187002 13:27418453-27418475 TTGATTGCTTACTATGTGCTGGG + Intergenic
1106300914 13:28464531-28464553 TGGATTTCCTAATATGTGCAAGG + Intronic
1106310030 13:28545870-28545892 TAGCATGCTTACTATGTTCCAGG - Intergenic
1106437622 13:29737665-29737687 TAGAATACTTAGAATGTACAAGG - Intergenic
1106834136 13:33615431-33615453 TTGAGTGCTTACTATGTGCTTGG + Intergenic
1106891301 13:34248761-34248783 TGTAGTGCTTAATATGTGCTAGG - Intergenic
1107092548 13:36497900-36497922 TTGAATGCTTACTAAGTGCCAGG - Intergenic
1107111868 13:36706962-36706984 GAGAATGCTTAGGATGTGCAAGG + Intergenic
1107144313 13:37041723-37041745 TACAATGCCTACTATGTGCTAGG + Intronic
1107379776 13:39844549-39844571 TTGAATGCTTAGTATGTGTGAGG - Intergenic
1107590777 13:41902558-41902580 TTGAATGATTGATATGTGCAAGG - Intronic
1107845224 13:44505758-44505780 TTGAATGCTTACTATGTATAAGG + Intronic
1108020783 13:46125818-46125840 TCGAGTGCCTAGTATGTGCAAGG - Intergenic
1108092841 13:46867275-46867297 TAAAATGCCTACTATGTGCTAGG + Intronic
1108095771 13:46898909-46898931 TTGAGTGCTTAAAATGTGCCAGG - Intergenic
1108232673 13:48365741-48365763 TTGAATGCTTAATATATGTCAGG + Intronic
1108439916 13:50440869-50440891 TTGAGTGTTTATTATGTGCAGGG - Intronic
1108563714 13:51673104-51673126 TAGAATCCTTACTATGTTCAAGG - Intronic
1109755215 13:66749408-66749430 TGAAATGCTTAACATGTGCCAGG + Intronic
1110315143 13:74097907-74097929 TTGAATTCTGAATATCTGCATGG - Intronic
1110674628 13:78226318-78226340 TTGAATGCTTACTATGAGCCAGG + Intergenic
1110844681 13:80180660-80180682 TTGAGTGCTTACCATGTGCAAGG - Intergenic
1111028444 13:82565714-82565736 TAGAATGCTTTATATTTCCTTGG + Intergenic
1111267748 13:85840711-85840733 TATAATGCTTAATATGTTTTGGG - Intergenic
1111330968 13:86761793-86761815 GAGAACGCTTAATATTTGGAAGG + Intergenic
1111413059 13:87901992-87902014 TTGAATACTTAATATATGCCAGG - Intergenic
1112186784 13:97135440-97135462 TTGAATGCTTACTATGTGCCAGG - Intergenic
1112286170 13:98106340-98106362 TTGAATGCTGACTATGTGCCAGG - Intergenic
1112364861 13:98747966-98747988 TGGAATGCTAAATGTTTGCATGG - Intronic
1112585827 13:100717856-100717878 TTGAATGCCTACTATGTGCGGGG + Intergenic
1113038424 13:106077136-106077158 AAGAATGCTCAATATTTCCATGG - Intergenic
1113230211 13:108205505-108205527 TAGAGTCCTTAGTATGTGCGGGG + Intergenic
1113817632 13:113185317-113185339 TTGAATGCCTACTAGGTGCAAGG - Intronic
1114402816 14:22425428-22425450 TTGAGTGCTTACTATGTGCCAGG + Intergenic
1114467635 14:22935467-22935489 TTGAAGGTTTACTATGTGCAGGG - Intergenic
1114711399 14:24781816-24781838 TTGAGTGCTTAAAATGAGCATGG - Intergenic
1114885512 14:26844869-26844891 TAGAATTTTTAACATGAGCAAGG - Intergenic
1115038690 14:28893079-28893101 TGGAATACTTAATATGTGCCAGG + Intergenic
1115594732 14:34898356-34898378 TTGATTGCTTAGTATGTGCTAGG + Intergenic
1115878966 14:37893280-37893302 AAGAATTCTTTATATGTTCAGGG - Intronic
1116387631 14:44351016-44351038 TAGAGGGCTTTATATGTCCATGG - Intergenic
1116818858 14:49608600-49608622 TTGAGTGCTTAATATATGCTAGG - Intronic
1116882561 14:50186019-50186041 TGGAAGGCCTAATATGTGCCAGG - Intronic
1117035548 14:51724588-51724610 TTGAATACTTAATATGTTTATGG + Intronic
1117398714 14:55338492-55338514 TACAATGTTTACTATGTGCCAGG - Intronic
1117471807 14:56053976-56053998 TACAAGGCTTTATATGTGGAAGG - Intergenic
1117613302 14:57506200-57506222 TAGAATCCATAATATGTGCTGGG + Intergenic
1117718716 14:58607038-58607060 TAGAGTGCTTAACATGTGCCTGG + Intergenic
1117870158 14:60192238-60192260 AAGAAGGCTTAATAAATGCAAGG - Intergenic
1118002139 14:61533196-61533218 CAGAATGCTTATTATGTGCCCGG - Intronic
1118247990 14:64130382-64130404 TAGAATGCTTAATGTGTACCAGG + Intronic
1118276484 14:64390235-64390257 TCGAATACTTATTATGTGCCAGG - Intronic
1118349344 14:64962359-64962381 TTGAATGCTTACAATGTGCCAGG + Intronic
1118602097 14:67477991-67478013 TTGAATGCTTACTATGTGCTGGG - Intronic
1118661540 14:68019004-68019026 TTGAATGCTTACTATATGCAAGG - Intronic
1119381134 14:74229216-74229238 TTGAGTGCTTACTATGTGCCAGG - Intergenic
1119579042 14:75757921-75757943 TATTATGCTTAGTCTGTGCATGG - Intronic
1120067080 14:80055317-80055339 TGGAATCCTTATTCTGTGCAAGG + Intergenic
1120775042 14:88425203-88425225 TGGTGTGCTTACTATGTGCAAGG - Intronic
1120851416 14:89175536-89175558 CAGAATGCTGACTATGTGCTGGG + Intronic
1120885226 14:89446731-89446753 TTGAATGCCTACTATGTGCCAGG - Intronic
1121230774 14:92356169-92356191 GAGCATGCTTAAGATGGGCAAGG + Intronic
1124782465 15:32649184-32649206 CTGAATGCTTACTATGTGCCTGG - Intronic
1125070480 15:35547581-35547603 TTGAATGCTTACTATGTACCTGG - Intergenic
1125133576 15:36313558-36313580 TTGAATGCTTATTATATACAAGG + Intergenic
1125151356 15:36536075-36536097 TTGAATGCTTAAGATGTACCCGG - Intergenic
1125932307 15:43609206-43609228 TTGAGTGCTTACTATGTGCCAGG - Intronic
1125945403 15:43708678-43708700 TTGAGTGCTTACTATGTGCCAGG - Intergenic
1126133531 15:45367968-45367990 TAAAATGCATAATATATACAAGG + Intronic
1126349121 15:47726320-47726342 TTGAGTGCTTACTATGTGCCTGG + Intronic
1126456110 15:48864007-48864029 TTGCATGCTTACTATGTGCCAGG - Intronic
1126858710 15:52863301-52863323 TTGAATGCCTACTATGTGCTAGG + Intergenic
1127703617 15:61526065-61526087 TAGCATGCTCAGTATGTGCCAGG - Intergenic
1127765727 15:62184171-62184193 TTGCATGCCTAATATATGCAGGG - Intergenic
1128581005 15:68809815-68809837 TAGAATGCTTACCATGTGCCAGG + Intronic
1128643954 15:69361269-69361291 TTGACTGCCTACTATGTGCAAGG + Intronic
1128951138 15:71883230-71883252 TTGAATGCTTACTACATGCAAGG - Intronic
1129004526 15:72361110-72361132 CTGAATGCTTACTATGTGCCAGG + Intronic
1129935454 15:79445213-79445235 TAGAGTGCTTATTGTATGCAAGG + Intronic
1130624787 15:85503170-85503192 TCAAATGCTTACTATGTGCCAGG - Intronic
1131074788 15:89488422-89488444 TAGACTGCTTATTAGTTGCAGGG + Intronic
1131148311 15:90030523-90030545 TTGAATGCTTATCATGTGCCAGG + Intronic
1131692483 15:94842298-94842320 TAAAATGCTAAATCTGTACATGG - Intergenic
1131870790 15:96762289-96762311 TCAAATGCTTAATATGTTCCGGG + Intergenic
1131960748 15:97788001-97788023 TAAAATGCCTACTATGAGCAAGG + Intergenic
1133525345 16:6599883-6599905 CAGAATATTTACTATGTGCAGGG - Intronic
1135042683 16:19130054-19130076 TTGAATGCTAACTATGTGCCAGG + Intronic
1135176684 16:20236113-20236135 TTGAGTGCCTAATATGTGCTGGG - Intergenic
1135390231 16:22086695-22086717 TTGAATGCTTACTATGTGCTTGG - Intronic
1135461398 16:22646570-22646592 ATGAATGCTTAATATGTCCCAGG - Intergenic
1135545026 16:23359872-23359894 TATAATGTTTACTATGTGCCAGG - Intronic
1135656249 16:24252930-24252952 TCGAGTGCCTACTATGTGCAAGG - Intergenic
1135712846 16:24732412-24732434 TTGATTGCTTACTATGTGCCTGG + Intronic
1137350237 16:47707257-47707279 AAGAATTCTTAAAATATGCAAGG + Intergenic
1138043952 16:53702108-53702130 TTGAACGCTTACTATGTGCCAGG + Intronic
1138251679 16:55506584-55506606 TAGAGTGCTTTCTATGTGCAAGG + Exonic
1138339192 16:56277575-56277597 TAAAGTGCTTAGTATGTGCCTGG - Intronic
1138772634 16:59684011-59684033 TTGAATGCTTACTTTGTGGATGG + Intergenic
1139101996 16:63778869-63778891 TTGAATGTTTCATATGTGCCAGG - Intergenic
1139174076 16:64666057-64666079 TAGAAAGCTGAATTTGTGGAAGG + Intergenic
1139238618 16:65367337-65367359 TATAATGCTTATAATGTGCCAGG + Intergenic
1139274062 16:65711060-65711082 CAGAGTGCTTACTATGTGCCAGG + Intergenic
1140144448 16:72292408-72292430 TTGAATTCCTACTATGTGCAAGG - Intergenic
1140167225 16:72565008-72565030 AAGCATGCTTAACATGTTCAAGG + Intergenic
1140673850 16:77306708-77306730 TTGAGTGCTTATTATGTGCCAGG + Intronic
1140835467 16:78790066-78790088 TTAAATGCTTCCTATGTGCAAGG - Intronic
1140873088 16:79124627-79124649 TGGAATGATGAATATGTTCAGGG + Intronic
1141429375 16:83963398-83963420 CCGAATGCTTATTATGTGCCAGG + Intronic
1143726480 17:8850339-8850361 TATAGTGCTTACTATGTGCCAGG + Intronic
1144170248 17:12652918-12652940 GAGAATGCTTACTATATGCTAGG - Intergenic
1144441287 17:15284914-15284936 CTGAATGCTTATTATGTGCAGGG + Intergenic
1145032312 17:19513773-19513795 TAGAATTATTAATATTTCCAAGG + Intronic
1145857043 17:28169799-28169821 CAGAGTGCTTACTATGTGCCAGG - Intronic
1145878455 17:28336905-28336927 TTAAATACTTAAAATGTGCATGG + Intronic
1146009808 17:29184839-29184861 TAGAATGCTTACCATGTACTGGG - Intergenic
1146313936 17:31792590-31792612 TTGAGTGCTTACTATGTGCTAGG - Intergenic
1146437032 17:32859733-32859755 AAGAATGCTCAATATGTTGAGGG - Intronic
1146712275 17:35052691-35052713 TTGAATGCCCACTATGTGCAGGG + Intronic
1146989475 17:37255203-37255225 CTGAATGCTTACTATGTTCAGGG + Intronic
1147449772 17:40496768-40496790 CATAATGCTTATTATGTGCCAGG - Intronic
1147699503 17:42384055-42384077 TAGAGTGCTTACTATGTGTTAGG - Intronic
1148405910 17:47415553-47415575 TAAAAAGATTAATATGTGCAAGG + Intronic
1148430901 17:47642710-47642732 AAAAATGCTTACTATGTGCTAGG + Intergenic
1148952162 17:51322814-51322836 TTGAATGCTTGCTATGTGCCAGG - Intergenic
1149003604 17:51781795-51781817 TTGAATTCTTACTATGTGCTAGG + Intronic
1149394508 17:56225580-56225602 TTGAGTGCCTACTATGTGCAAGG - Intronic
1149578323 17:57729390-57729412 TGGAGTGCTTAATATGTACCAGG + Intergenic
1149605204 17:57919622-57919644 TTGAAAACTTACTATGTGCATGG - Intronic
1150199723 17:63342382-63342404 TAAAATGCCTACTATGTTCAAGG - Intronic
1150471514 17:65441425-65441447 TATAATGCTTACTATGTACCAGG + Intergenic
1150616400 17:66775769-66775791 CTGAATGCTTACAATGTGCATGG + Intronic
1153918063 18:9763373-9763395 ATGAATGTTTAATATGTTCAAGG + Intronic
1154999668 18:21674150-21674172 TATCATGCTTAATATGTGTCAGG - Intronic
1155236426 18:23824109-23824131 TTGAATACTTACTATATGCAAGG + Intronic
1155241204 18:23865430-23865452 AAAAATGCTTAATATGTGGCTGG - Intronic
1155603092 18:27571959-27571981 CAGAATGCTTACTATGTGTTAGG + Intergenic
1155877964 18:31110687-31110709 TTGAATGCTTACTATGTTCTAGG - Intergenic
1156242773 18:35269492-35269514 TAGAAAGAATAATATCTGCAGGG + Intronic
1156496385 18:37528144-37528166 GAAAATGCTTAATATTTGCCAGG - Intronic
1156748240 18:40418632-40418654 TATTATGCTTAGTATGTGCTGGG - Intergenic
1157017658 18:43736961-43736983 TAGAATGCTTATTATGTGTCAGG - Intergenic
1157399508 18:47375725-47375747 TCGATTGCCTACTATGTGCATGG + Intergenic
1158055215 18:53270880-53270902 TAGAGTCCTTACTATGTGCCAGG + Intronic
1158259853 18:55594443-55594465 TTGAATACTTTATATGTGCCAGG - Intronic
1158365485 18:56729866-56729888 GAGAATGCTGAATATCTGTACGG + Intronic
1159907288 18:74106498-74106520 AAGAATGCTTCACATGTGCTTGG - Intronic
1161054247 19:2181930-2181952 AAGAATGCTCAAGCTGTGCACGG + Intronic
1162901633 19:13798578-13798600 TAGAATGCTAACTATGGGCCAGG + Intronic
1163223177 19:15936477-15936499 AAGAATGCCTACTGTGTGCAAGG + Intergenic
1164660632 19:29963514-29963536 CATAATGATTAATATGTTCAAGG - Intronic
1166841833 19:45702136-45702158 TGGAATGCTTGCTATGTGCTGGG - Intronic
1167062534 19:47158686-47158708 CAGAATGCCTACTGTGTGCAAGG + Intronic
925161758 2:1689233-1689255 AACAATGGTTAATGTGTGCAGGG - Intronic
925569578 2:5294769-5294791 TTGAATGCTTAATATTTCCAGGG - Intergenic
925720841 2:6825294-6825316 TAGAATGTTTACTATTTCCAAGG + Intergenic
926592061 2:14750662-14750684 TAAAGTGCTTACTCTGTGCAGGG + Intergenic
927320303 2:21736378-21736400 TATAGTGCTTAATTTGTTCAAGG - Intergenic
928417397 2:31107430-31107452 TGGAATGTGTAATGTGTGCAAGG - Intronic
929249779 2:39740027-39740049 TTGAGTACTTAATATGTGCCAGG + Intronic
929297795 2:40268235-40268257 TAGAATGCTTGATAATGGCAGGG + Intronic
929417692 2:41760627-41760649 TTGAATGCCCATTATGTGCATGG - Intergenic
929629626 2:43446068-43446090 TTGAATTCTTCATGTGTGCAAGG + Intronic
930178105 2:48320833-48320855 TAGAATGCTTACTCTGTGGCAGG + Intronic
930410637 2:51022210-51022232 CAAAATGCTTACTATGTGCCAGG + Intronic
930430791 2:51273331-51273353 TTGAATGTCTAATATGTGCTAGG + Intergenic
931256647 2:60580018-60580040 TTGAATGCCTACTATGGGCAAGG + Intergenic
933278656 2:80308542-80308564 CAGAATGCTCAAAAGGTGCATGG + Intronic
933507318 2:83194378-83194400 TGAAATGCTTAATATGTGCCAGG - Intergenic
933668941 2:84988343-84988365 TTGAATACTTACTATGTGCCAGG + Intronic
933709814 2:85316589-85316611 AAGAGTGGTTTATATGTGCAAGG - Intergenic
933713244 2:85343135-85343157 TAGAGTGCTTTATACGTGCAAGG + Exonic
933728962 2:85442985-85443007 TTGAGTGCTTACTATGTGCCAGG + Intergenic
934085601 2:88506550-88506572 TTGAATTCTTAATAGGTGCCAGG + Intergenic
934732940 2:96670807-96670829 TAAAATGCCTAATCTGTGCCGGG + Intergenic
935220943 2:101011871-101011893 TAGAGTACTTTATGTGTGCATGG - Intronic
935579909 2:104747591-104747613 TTGAGTGCTTATTATGTGCCAGG + Intergenic
936452204 2:112642274-112642296 TTGAATGCTTACTGTGTGCCAGG - Intergenic
936784911 2:116083100-116083122 TAGAATTCCTAATACATGCAAGG + Intergenic
937185366 2:120035482-120035504 TAGAGCGCTTACTATGTGCCAGG - Intronic
938921193 2:135996674-135996696 TTGAATGCTTATGATGTGCCAGG + Intergenic
938989472 2:136613021-136613043 TGGAGTGCTTAATATGTGACAGG + Intergenic
939027188 2:137027975-137027997 CTGAATGCTTATTATGTGCAGGG - Intronic
939286272 2:140134768-140134790 TAGATTGCTTCATATGTGTCTGG - Intergenic
939587035 2:144018741-144018763 TAGAGTGCCTATTATGTGCCAGG + Intronic
939763320 2:146212266-146212288 TATAATTCTCAATATGTGTATGG + Intergenic
940282911 2:152005935-152005957 TTGAATGCTGACTATGTGCCAGG - Intronic
940321334 2:152380202-152380224 TTGAATGCTTTCTATGTGCCAGG - Intronic
940677707 2:156745457-156745479 TTAAATGCTTATTATGTGCCAGG + Intergenic
940739331 2:157489262-157489284 TTGAATGCCTACTATGTGCTGGG + Intergenic
941231896 2:162919902-162919924 TAGATTGATTAATATAGGCAGGG - Intergenic
941323579 2:164085392-164085414 TGGAATGCCTACTACGTGCAGGG + Intergenic
941713551 2:168740455-168740477 TAGAAAGCTTCATAAGGGCAAGG - Intronic
941953283 2:171178106-171178128 TTGAATGCTTACTATATGCTAGG + Intronic
942503788 2:176620126-176620148 TGGAATGCTTATGATGTGAAAGG + Intergenic
942539336 2:176999097-176999119 TAGAATGCTTTATATATCCAAGG - Intergenic
942670660 2:178372741-178372763 GTGAATGCTTACTATGTGCTAGG + Intronic
942697817 2:178665650-178665672 TAGAGTGCTTAGCATGTACAGGG - Intronic
944132278 2:196359480-196359502 GAGCAGGCTTAATATATGCATGG - Intronic
944132633 2:196363228-196363250 CAGAATGGTTACTATGTGCCAGG + Intronic
944298620 2:198096058-198096080 TTGGATGCCTACTATGTGCAAGG + Intronic
944885908 2:204062508-204062530 TAGAGTGCTTACTATGAGCTAGG - Intergenic
944896578 2:204171545-204171567 TAGAAAACATAGTATGTGCAAGG - Intergenic
944910461 2:204305680-204305702 TAGAATGCTTAATGCATCCAAGG - Intergenic
945009135 2:205443092-205443114 GTGAATGCTTACTATGTGCCAGG - Intronic
945613172 2:212031402-212031424 TATAATGATTAACATGTGCCAGG - Intronic
946793478 2:223324750-223324772 TTGAATGCTTATTACGTGCCAGG - Intergenic
946993508 2:225363501-225363523 TGGCATGCTTAATATGTCCTTGG - Intergenic
947699847 2:232223789-232223811 TAGAAAGATTAAAATTTGCATGG + Intronic
948303382 2:236926714-236926736 TTGAATGCTTAATATGTTCCTGG + Intergenic
1168913095 20:1466044-1466066 CCGAATGCTTATTATGTGCCAGG + Intronic
1169036029 20:2452820-2452842 TAAAATGCGTACTATGTGCTAGG - Intergenic
1169391500 20:5194867-5194889 TATAGTGCTTAATATGTGCCAGG + Exonic
1169391538 20:5195175-5195197 TTGAGTGCTTACTATGTGCCAGG - Exonic
1169570158 20:6897574-6897596 CTGAATGCTTACTATGTGCCAGG - Intergenic
1169778195 20:9279237-9279259 TTGAATGCTTCCTATGTGCAAGG + Intronic
1170208623 20:13825657-13825679 TATCATGCTTATTATGTGCCAGG - Intergenic
1170298827 20:14859260-14859282 TAGAATGCTTTCTATTTGCTTGG - Intronic
1170708410 20:18766983-18767005 TAATATGCTTAATATTTGTAGGG + Intergenic
1172594189 20:36138588-36138610 TTGCATGCTTAATATGTGCCAGG + Intronic
1172852413 20:37976236-37976258 TTGAATGCCTAGTATGTGCCAGG - Intergenic
1173240325 20:41290176-41290198 TTGAATGCTGATTATGTGCCAGG + Intronic
1174257174 20:49265629-49265651 TTGAGTGCCTAATATGTGCCAGG + Intronic
1174726141 20:52864175-52864197 TGAAATCCTTAATATGTGCCAGG + Intergenic
1174769286 20:53283324-53283346 TTGAATGCTTACTATGTCCGAGG + Intronic
1174922673 20:54721640-54721662 TAAAATGCTTAATAGGTGAGAGG - Intergenic
1174923351 20:54729113-54729135 TTAAATGCTTACTATGTGCTAGG + Intergenic
1179224492 21:39441925-39441947 TTGAGTGCTTACTATGTGCCAGG + Intronic
1180237099 21:46469196-46469218 TAAAATGCCTAAAATGTGCAAGG - Intronic
1181155140 22:20915600-20915622 TATGATGCTTACTATGTGCCAGG + Intergenic
1182374358 22:29835695-29835717 TTGAGTGCTTATTATGTGCCAGG - Intronic
1182772771 22:32807492-32807514 TAGAGTGATTACTATGTGCCAGG + Intronic
1182997915 22:34831357-34831379 AATAAGGCTTATTATGTGCATGG - Intergenic
1183263202 22:36809673-36809695 TAGAGCGCTCAATATGTGCCAGG - Intronic
1183513289 22:38248431-38248453 AAGCAGGCTTAATATGTTCAAGG - Intronic
1184185284 22:42860695-42860717 TTGAATGCATACTATGTGCCAGG - Intronic
1184315237 22:43682776-43682798 TTGAGTGCTTACTATGTGCCAGG - Intronic
949121586 3:391204-391226 AAGAATGTTTAATATGGCCATGG - Intronic
949193583 3:1279389-1279411 TAGAAAGCTTAATAACAGCAAGG + Intronic
949247814 3:1946085-1946107 TTGAGTGCTTAAAATGTGCCAGG + Intergenic
949369654 3:3320429-3320451 TCGTATGCTTACTATGTGCCAGG - Intergenic
949403236 3:3687565-3687587 TAGAATGCTTATTATATACCAGG - Intergenic
949599579 3:5583392-5583414 TAGAGTGCATATTATGTGCAAGG + Intergenic
949639521 3:6019615-6019637 TTGAATGCTTCATATGTGACAGG + Intergenic
949945065 3:9183432-9183454 TTGAATGCTTACTATATGCCAGG - Intronic
950198140 3:11023837-11023859 TTGAGTGCTTACTATGTGTAAGG - Intronic
950386985 3:12667785-12667807 TACAATGCTTAATATGAGGAAGG - Intergenic
950397826 3:12747479-12747501 TTGAATGCTTACTCTGTGCTGGG - Intronic
950934157 3:16821772-16821794 TTGAGTGCTTACTATGTGCCAGG - Intronic
950934801 3:16827923-16827945 TATAATGCTTACTATGTGCCAGG - Intronic
951063373 3:18236300-18236322 TTGAATGCTTAATAAGTACCAGG + Intronic
951090689 3:18570263-18570285 GTGAATGCCTTATATGTGCAAGG - Intergenic
952333129 3:32382999-32383021 TAGAAGACTTAGTATGTGCCAGG + Intergenic
952470158 3:33639386-33639408 TATAGAGCTTACTATGTGCAAGG - Intronic
952557280 3:34547115-34547137 TAGAGTGTGTACTATGTGCAGGG + Intergenic
953486093 3:43298062-43298084 CAGAATGCTTACTCTGTGCCAGG + Intronic
953621607 3:44537594-44537616 AAGAATACTTACTATGTGCTGGG - Intergenic
953771001 3:45778659-45778681 TATAATGCTTACAATGTGTATGG + Intronic
954817944 3:53298467-53298489 CAGAATGCTTACTATGTGGGAGG + Intronic
955039121 3:55297886-55297908 GAGAGTGCTTAATATGTTCTGGG + Intergenic
955594999 3:60579529-60579551 TATAATGCTTAACATGAGTATGG + Intronic
955618218 3:60832097-60832119 TATAATGCTCATTATGTGCTGGG + Intronic
955728913 3:61962730-61962752 TTGAATGCTTAGTATGTGTCAGG + Intronic
956320883 3:67995099-67995121 TTGAATGCTTACTATGTGCTTGG - Intergenic
956494067 3:69805594-69805616 TCTAATATTTAATATGTGCATGG + Intronic
956701278 3:71961183-71961205 ATGAATGCTTCATATGTACATGG + Intergenic
956763769 3:72466576-72466598 TTGATTGCTTACTATGTGCCAGG + Intergenic
956893873 3:73640111-73640133 TAAAATGCTTACTATGTGCAAGG - Intergenic
956987753 3:74722765-74722787 TATGATGATTAATATGTGAAAGG - Intergenic
957246407 3:77722092-77722114 TTGAATGCCTACTATGTGCTGGG - Intergenic
957693953 3:83609097-83609119 TAAAATACTTTATATGTCCATGG - Intergenic
957698152 3:83671297-83671319 CAGAATGATTAATTTGTTCACGG + Intergenic
957767488 3:84644831-84644853 TAGCATGCTTAATTTGTGCCAGG - Intergenic
957805648 3:85145315-85145337 TATGTTGCTTAATCTGTGCATGG - Intronic
958510490 3:95040855-95040877 CACAATGTTTACTATGTGCAAGG - Intergenic
958900830 3:99884615-99884637 CAGAATGCTCACTTTGTGCAGGG - Intronic
958921572 3:100112030-100112052 TAGAATGCCTACTCTGTGCCAGG - Intronic
959350197 3:105252049-105252071 TTGAGTGCTTAATATGTTCCAGG + Intergenic
959530916 3:107432719-107432741 TTGAATGATTAATATGTGACAGG + Intergenic
959600413 3:108176868-108176890 TGGAATGCTTAGTATGTGTTAGG + Intronic
960221724 3:115119632-115119654 TTGAATGCTTTCTATGTGCCAGG - Intronic
960874891 3:122286453-122286475 TTGAATGCTTATTGTGTGCTAGG - Exonic
960888630 3:122421970-122421992 TTGAATGTCTACTATGTGCAAGG + Exonic
960906555 3:122607509-122607531 TTGAGTCCTTATTATGTGCAAGG - Intronic
960915831 3:122694008-122694030 TTGAATGCTTAATATGTGCCAGG + Intronic
961411407 3:126723891-126723913 TTAAGTGCCTAATATGTGCAAGG - Intronic
962025100 3:131539580-131539602 CAGAATGCTTGTTCTGTGCAAGG - Intronic
962150556 3:132888767-132888789 CAGAATGGTTAATTTGTCCAAGG + Intergenic
962336792 3:134540173-134540195 TAGAATGCTTACTAAGTGACAGG + Intronic
962954271 3:140249686-140249708 TAGACTGTTTAATATATGCAAGG + Intronic
963069443 3:141290862-141290884 TAGAGTGCTTACTGTGTGCCAGG - Intronic
963156678 3:142105934-142105956 TTGAATGCTTAACTTGTGCTAGG - Intronic
963322994 3:143829676-143829698 TTGAATGCTTAATATATGCCAGG - Intronic
963500805 3:146122851-146122873 TAGAATGTTTCTTATGTGCAAGG - Intronic
963620780 3:147602850-147602872 TAGAAAGCTGAATATTTTCAAGG + Intergenic
964376611 3:156054410-156054432 TTGAATGTTTACTATGTGCCAGG - Intronic
964440095 3:156699673-156699695 TAGAATGCTCAATATCTACTAGG + Intronic
964622133 3:158729025-158729047 TTGAATGCTTACTCTGTGCCAGG - Intronic
964713288 3:159695113-159695135 TAGAGTGCCTACCATGTGCAGGG + Intronic
964997828 3:162908199-162908221 TAAAATTGTTCATATGTGCAAGG - Intergenic
965573098 3:170191317-170191339 TAGAATGCTTATTCTGGGCTGGG - Intergenic
965724318 3:171697923-171697945 TTGAATGTTTTCTATGTGCAGGG - Intronic
965807853 3:172560284-172560306 TTGATTGCCTAATATGTGCTAGG - Intergenic
966465122 3:180223141-180223163 TTTAATGCTTACTATGTGCTAGG + Intergenic
967276458 3:187780170-187780192 TTGGTAGCTTAATATGTGCAAGG - Intergenic
967286488 3:187875880-187875902 ATGAATGTTTAATAAGTGCACGG - Intergenic
967537242 3:190620592-190620614 CTGAATGCTTACGATGTGCATGG - Intronic
967711552 3:192714068-192714090 TTGAATGCTTATTATATGCCAGG + Intronic
967713212 3:192733352-192733374 TTGATTGCTTACTATGTGCAAGG + Intronic
967800831 3:193657643-193657665 TTGAATGCTTACTATGTGCCAGG + Intronic
969218340 4:5741431-5741453 TTGAGTGCTTACTCTGTGCAAGG - Intronic
970331931 4:14995479-14995501 TTGAAAGCCTACTATGTGCAAGG + Intergenic
970877588 4:20890137-20890159 TTGAATGCTAACTATGTGCTAGG + Intronic
971144402 4:23961469-23961491 TAGAAAGGATAAGATGTGCAGGG - Intergenic
971218791 4:24686342-24686364 TTGAATGCTTGCTCTGTGCAAGG + Intergenic
971273223 4:25171021-25171043 GTGAATGCTTACTATGTGCCAGG - Intronic
971341244 4:25771048-25771070 TAGAAGGCTAAATATGGTCAGGG - Intronic
971585771 4:28403818-28403840 TAGAGTGCTTACTAGGTGAAAGG + Intergenic
971587218 4:28419471-28419493 TTGAATGATTACTATGTGCCAGG + Intergenic
971732616 4:30405585-30405607 TGGAATGCTTATTATGTGTCAGG - Intergenic
971942482 4:33233831-33233853 TAGAATCCTTTATAAGTTCATGG - Intergenic
972116417 4:35640567-35640589 TGTAATGCCTAATATGTTCAAGG + Intergenic
972165509 4:36279242-36279264 TTCAATACTTAAAATGTGCATGG + Intergenic
972327829 4:38034541-38034563 TTGAATGCTTATTATGTGCAGGG + Intronic
972367185 4:38387159-38387181 TATAATGCTTACTATGTGATAGG + Intergenic
972653238 4:41040410-41040432 TTGAATGCTTATTATGTGCCAGG + Intronic
972946195 4:44258957-44258979 ATGAATGCTTACTATGTGCCAGG - Intronic
973109685 4:46382008-46382030 TTGAGTGCTTACTATGTGCCAGG + Intronic
973158141 4:46983425-46983447 TTCAACGCCTAATATGTGCAAGG - Intronic
973323614 4:48834847-48834869 ATGTATGCTTAAAATGTGCAAGG + Intronic
975157073 4:71083879-71083901 CAGAATGCTTACCATGTGCCAGG - Intergenic
975371065 4:73588721-73588743 TTGAATGCTTACTATTTTCAGGG - Intronic
975784481 4:77873153-77873175 TAGAATGCTTCCTTTGTGCTAGG + Intronic
975824934 4:78309417-78309439 TAGAATGCTTACTATGTCCCAGG - Intronic
975906465 4:79219175-79219197 TTGAATGCTAAAGATGTGGAAGG - Intergenic
975988110 4:80225126-80225148 TAGAATGCTCATTTTGTGCCAGG + Intergenic
976331438 4:83835449-83835471 TAGAGTGCTTATTATGTGCTAGG + Intergenic
976778600 4:88733928-88733950 TTGAGTGCTCACTATGTGCAAGG - Intronic
976964271 4:91016391-91016413 TAGCATATTTAAAATGTGCAAGG - Intronic
976995460 4:91426829-91426851 TAGAATGCTTACTATATGCTGGG + Intronic
977008067 4:91597351-91597373 TTAAATGGTTAATATGTGCCAGG + Intronic
977365761 4:96066446-96066468 TTGAATGCTTAATATGTGTCAGG + Intergenic
978103628 4:104874476-104874498 TAGCATGCTTAATCAGTGCTAGG - Intergenic
978152626 4:105455149-105455171 TTGAATGCTTATTATGAGCCAGG - Intronic
978532849 4:109731502-109731524 TTGAGTGCTTACTATGTGCCAGG + Intergenic
978644272 4:110910601-110910623 TTGAATGCTTACTATGTGCCAGG + Intergenic
978962831 4:114704737-114704759 TTGAGTGCTTATTATGTGCCAGG - Intergenic
979291878 4:118987371-118987393 TAAAATGCCTAATATGGGCCAGG + Intronic
979505550 4:121491548-121491570 TAAGATGCTTCAGATGTGCATGG - Intergenic
979630238 4:122893035-122893057 AAGAATGCTTAAGATGTGAGTGG - Exonic
979681738 4:123467463-123467485 TTGATTGCTTATTATGTGCCAGG - Intergenic
979930874 4:126628740-126628762 TAGAATGTCTAATATTTGCCTGG + Intergenic
979940373 4:126754619-126754641 TAGAATGCTTAATACATATAAGG + Intergenic
981054047 4:140341520-140341542 TAAAATGCCTACTATGTGCTAGG - Intronic
981134367 4:141193224-141193246 TTGAATGCTTATTATGTGCTAGG - Intronic
981244331 4:142516367-142516389 TATAATGCTTACTATGGGCCAGG + Intronic
981353516 4:143760343-143760365 TAGAATTCTTATGATATGCAAGG + Intergenic
981841831 4:149121981-149122003 TTGAATGTTTATTATGTGCCAGG + Intergenic
982289065 4:153761481-153761503 TAGAATGCTTACCGTGTGCCAGG + Intergenic
982465991 4:155733125-155733147 TTGAATGCCTACTATGTGCCAGG + Intergenic
982557343 4:156884236-156884258 TAGAATGATAAAAATGTGTAAGG + Intronic
982600248 4:157440813-157440835 TTGAATACTTAATATATGCATGG + Intergenic
982813629 4:159857757-159857779 TAAAATTCTTAATATGTGCCCGG + Intergenic
983490772 4:168386448-168386470 TTCAATGCTTAATATGTGCTGGG + Intronic
983823611 4:172229196-172229218 TTGAATGCTCACTATGTGCCAGG - Intronic
983857690 4:172665634-172665656 TATAATGATTATTATGTGAAAGG - Intronic
983859273 4:172685050-172685072 TAGAATGCTTAATATGTGCAAGG - Intronic
984048864 4:174838712-174838734 AAGAATGCTTATTATGGGCTGGG - Intronic
984199900 4:176705653-176705675 TTGAATGCTTAATATGTTTTAGG + Intronic
984569939 4:181380247-181380269 TTGAGTGCTTAATATGTCCTGGG + Intergenic
984595181 4:181658664-181658686 TGGAATGCTTACCATGTGCCAGG + Intergenic
985139783 4:186828191-186828213 TTGAATGCTTACTGTATGCAAGG + Intergenic
985298882 4:188465816-188465838 TTGAATGCTTAATATATTCATGG - Intergenic
986009606 5:3700344-3700366 GATAATGCTTAATGGGTGCAGGG + Intergenic
986506803 5:8459965-8459987 TACTATGCTTACTATGTCCATGG - Intergenic
987168407 5:15225429-15225451 TTGAATGCATAATATGAGCCAGG - Intergenic
987233071 5:15915187-15915209 TTGAATGCTTACTATATGCCAGG - Intronic
987798872 5:22667045-22667067 TAGAAGGACTAATGTGTGCAAGG - Intronic
988217250 5:28290926-28290948 TTGAATGCCTACTATGTGCCAGG - Intergenic
989234005 5:39123097-39123119 TAGAGTAATTAATATGTGCAGGG - Intronic
989457091 5:41656997-41657019 TATAGTGCTTACTATGTGCTAGG + Intergenic
990055975 5:51578702-51578724 TAGAAAGCTAAGTAAGTGCATGG + Intergenic
990113723 5:52362001-52362023 CAGAATGCTTACTATGTGTTAGG - Intergenic
990161796 5:52949197-52949219 TCGAATGCTTACTATGTGCAGGG + Intronic
990247424 5:53876916-53876938 TTGAATGTATATTATGTGCAAGG - Intergenic
990346290 5:54875066-54875088 TAGAGTGCCTACTATGTGCCAGG + Intergenic
990662440 5:58031626-58031648 TACTGTGCTTAATATTTGCATGG - Intergenic
990676838 5:58196139-58196161 AAAACTGCTTAATATGTTCAAGG + Intergenic
990801362 5:59607679-59607701 TAGTATGCTCACTATATGCAAGG - Intronic
990894876 5:60688074-60688096 TAGGTTGCTTATTATGTGAAAGG + Intronic
990985456 5:61637358-61637380 TAGGGTACTTACTATGTGCAAGG - Intergenic
991075581 5:62532746-62532768 GATAATGCTTACTATGTGCCAGG - Intronic
991244956 5:64500716-64500738 TTGAATGTTTACTATGAGCAAGG - Intergenic
991276346 5:64851808-64851830 TTGAATACTTACTAAGTGCAAGG + Intronic
991454906 5:66792478-66792500 CTGAATGCTTTCTATGTGCAAGG - Intronic
991655538 5:68900594-68900616 TGTAATGTTTAATATGTGCCAGG + Intergenic
991954268 5:71976813-71976835 TAAAATGCTCAATATGTGAAGGG + Intergenic
992382888 5:76255986-76256008 CAGAATGCAAAATATGTGCTAGG + Intronic
992460974 5:76959985-76960007 TTGAATGCTTACCATGTGCAAGG + Intronic
993109210 5:83634868-83634890 TAGGGTGCTTATTATGTGCCAGG + Intergenic
993390586 5:87315658-87315680 TAGAATGTTTAATATGGGAGAGG + Intronic
993735500 5:91471618-91471640 TTGAATGCTTACTATGTAGAAGG + Intergenic
993958979 5:94273240-94273262 TTGAGTTCTTACTATGTGCAAGG - Intronic
994009063 5:94878681-94878703 TTGAGTGCTTATTATGTGCCAGG + Intronic
994023553 5:95055432-95055454 TTGAATACTTACTATGTGCCAGG + Intronic
994052483 5:95378634-95378656 CTGAATGCCTACTATGTGCAAGG - Intergenic
994225913 5:97251265-97251287 TGGAATGCCTAATTTGTGCTGGG + Intergenic
994954490 5:106510639-106510661 AAGAATGCTTAATATCTGATGGG - Intergenic
995165724 5:109039329-109039351 TTGAATGCCTACTATGTGCAAGG + Intronic
995365131 5:111351107-111351129 AAGAATGCCTAATATATGCCAGG - Intronic
995526795 5:113056762-113056784 TTGAGTGCTTACTATGTGCTGGG - Intronic
995559795 5:113368439-113368461 TAGAATGCCTATTATCTGAACGG + Intronic
995561588 5:113387808-113387830 TTGAGTACTTAATATGTGCCAGG - Intronic
995601425 5:113801269-113801291 TAGAATACTTACTATATGCATGG + Intergenic
995948986 5:117686712-117686734 CTGAATGCTTACTATGTGCTGGG + Intergenic
996530638 5:124523350-124523372 TAGACCACTTAAAATGTGCATGG + Intergenic
996698524 5:126424748-126424770 GAGAATGCTTACTATGTGACAGG + Intronic
996770903 5:127084300-127084322 AAGAATGCTTTATATCTGCAAGG - Intergenic
996798391 5:127375894-127375916 TTGAATGATTACTGTGTGCAAGG + Intronic
996824601 5:127667609-127667631 TTGAATGTTTATTATATGCAAGG - Intergenic
997452771 5:133996680-133996702 TTGAATGCCTATTATGTGCCAGG - Intronic
998044596 5:138976258-138976280 CTGAATGCTTACTATGTGCCCGG + Intronic
998257787 5:140601883-140601905 TATACTGCTTAGTATGTGCCAGG - Intergenic
998276256 5:140756459-140756481 AAGAATGCTTATTGTGTTCAAGG + Intergenic
998368816 5:141648193-141648215 TTGAGTGCTTACTATGTGCCTGG + Intronic
998409715 5:141900342-141900364 TAGAAAGCTTACTATATGCCAGG - Intergenic
998547745 5:143045616-143045638 TTGGATGCTTATTATGTGCCAGG + Intronic
998839811 5:146241325-146241347 TTGAATGCCTACTATGTGCCAGG + Intronic
998885165 5:146686526-146686548 TTGAGTGCTTACTATGTGCCAGG - Intronic
999122963 5:149224216-149224238 TTGAGTGCTTAGTATGTGCCAGG - Intronic
999726309 5:154441095-154441117 TTGAGTACCTAATATGTGCAAGG + Intergenic
1000186160 5:158860165-158860187 TTGAGTGCTTACTATGTGCAAGG + Intronic
1000228818 5:159295975-159295997 TTGAATGCTCACTATGTGCCAGG - Intergenic
1000269977 5:159675079-159675101 TTGAATGCTTACTATATGCTTGG - Intergenic
1000836136 5:166156453-166156475 TAAAATGGTTAAAATGTGCCAGG - Intergenic
1001086114 5:168701176-168701198 CAGAATGCCTACTATGTGCTAGG - Intronic
1001213212 5:169830437-169830459 TTGAATTCTTACTATGTGCTGGG - Intronic
1001699258 5:173695051-173695073 TTGAGTGCTTAATATATGCCTGG + Intergenic
1001974597 5:175987166-175987188 TAGAATGCTTTAAAAGTGGAGGG - Intronic
1003517752 6:6831964-6831986 TTGAATGCTTACTATGTGCCAGG + Intergenic
1003828724 6:9981217-9981239 TTGAACACTTATTATGTGCAAGG - Intronic
1003899709 6:10642934-10642956 TTGAATTCTTAGTATGTGCCAGG + Intergenic
1004594678 6:17087894-17087916 TTGAATGGTTAATACGTGCCTGG - Intergenic
1004705545 6:18121231-18121253 TTGAATGCATACTCTGTGCAAGG - Intergenic
1004840024 6:19572903-19572925 TAGACTGCTTAATATATGTCAGG - Intergenic
1004957131 6:20740240-20740262 TTGAGTGCTTACTATGTGCCAGG - Intronic
1005028779 6:21490252-21490274 CAGAATGCTGAATATCAGCACGG - Intergenic
1005267226 6:24125111-24125133 TAAAATAGTTAATATTTGCATGG - Intergenic
1005366870 6:25087287-25087309 TTGAGTGCTTACTATGTGCCAGG - Intergenic
1005799714 6:29409046-29409068 TTGCATGCTTATTATGTGTAAGG - Intronic
1005888557 6:30117098-30117120 TTGAATGCTTACCATGTGCCAGG + Intergenic
1005956019 6:30664035-30664057 AAAAATGTTTAATATGGGCATGG + Intronic
1006208535 6:32372470-32372492 TAAAATGCTTATTCTGTGGAAGG - Intergenic
1006562231 6:34923480-34923502 TTGAATGCTTACTGTGTGCCAGG + Intronic
1006934371 6:37707038-37707060 TAGTATGCTTACTATATGCCAGG - Intergenic
1007108008 6:39296571-39296593 TTAAATGCTTATTATGTGCTAGG - Intergenic
1007417105 6:41698074-41698096 TAGAATGCTTACTGTGTGCTAGG + Intronic
1007519482 6:42440495-42440517 TAGAAAGCTTACTATGTGCCTGG - Intronic
1007526939 6:42504416-42504438 TATAATGCTTATTATGTACCAGG + Intergenic
1008143429 6:47859575-47859597 TTGAATGCCTAACATGTGCCTGG + Intergenic
1009286523 6:61825907-61825929 TACAATGCTTAGTATGTGGCAGG - Intronic
1009687314 6:66979208-66979230 TTGAATACCTAATATGTGCCAGG - Intergenic
1009779109 6:68246146-68246168 TTAAATGCTTAAAATGTGTAAGG - Intergenic
1009848497 6:69164891-69164913 TGAAATGTTTAATATGTGCCAGG - Intronic
1009925846 6:70119771-70119793 TATAGTGCTTATTATGTGCTAGG - Intronic
1010020226 6:71151379-71151401 TTGAGTGCTTACTATGTGGAAGG + Intergenic
1010161183 6:72857893-72857915 TTGAATGCCTACTATGTGCTGGG + Intronic
1010265313 6:73859272-73859294 TGGAAAGCTAAATATGTGTATGG + Intergenic
1010658911 6:78545792-78545814 TTGAATGCTTTCTATGTGCCAGG - Intergenic
1010940234 6:81908126-81908148 CTGAATGCTTACTATGTGCAAGG - Intergenic
1011752976 6:90472006-90472028 TTGAATGCTTACTATGTGCTAGG - Intergenic
1011761630 6:90573567-90573589 TTGAATGTTTACTATGTGCCAGG + Intronic
1011781507 6:90794929-90794951 TTGAATGCCTACTATGTGCTTGG + Intergenic
1012092147 6:94912172-94912194 TAAAATGCTCTATATTTGCAGGG - Intergenic
1012199621 6:96389464-96389486 TTGAATGCTTACTGTGTGCCAGG + Intergenic
1012636249 6:101546549-101546571 TAGAAAGATTAATTTGTTCAAGG - Intronic
1013395983 6:109740234-109740256 TACTATGTTTAATATGTGCCAGG - Intronic
1013494044 6:110679910-110679932 TTGAATGCTTATTATGTGCTAGG - Intronic
1013555644 6:111254466-111254488 TTGAATACTTAAGATGTGCAAGG - Intergenic
1013745259 6:113337841-113337863 TTGAATGCCTACTATGTGCCAGG - Intergenic
1013954426 6:115824324-115824346 TTGAATGCTTACTATGTGTCAGG - Intergenic
1014690766 6:124560659-124560681 TATCATGCTTACTATGTGCCAGG - Intronic
1015002149 6:128230980-128231002 AAGAAAGCTTTATATCTGCAAGG + Intronic
1015254739 6:131165628-131165650 TAGAGTGCCTACTATGTGCCAGG - Intronic
1015318198 6:131841643-131841665 TTGAATGTTTACTTTGTGCAAGG + Intronic
1015536557 6:134272751-134272773 TGGATTGCTTAATATTTGCAAGG + Intronic
1016108373 6:140190265-140190287 TTCAATGCCTAATTTGTGCAGGG - Intergenic
1016189876 6:141251851-141251873 TTGAGTGCTTAATAAGTGCGAGG - Intergenic
1017170648 6:151451595-151451617 TCGAATGCCTACTATGTGCTGGG - Intronic
1017209568 6:151840096-151840118 TTGAATGCTTGCTATGTGCTGGG + Intronic
1018205529 6:161434191-161434213 TAGAATGCTTACTATTGGAATGG - Intronic
1018604478 6:165583077-165583099 TTGAATGCCTACTATGTGCGGGG + Intronic
1019142040 6:169954486-169954508 TAGAATGATTGATCTGTCCAAGG + Intergenic
1020702989 7:11506688-11506710 TAGAATGCTTAAAGTGTTCCAGG - Intronic
1020806902 7:12801359-12801381 TAAAATGCTTCCTATGTGGAAGG + Intergenic
1020978740 7:15041177-15041199 TTGAATGCTTACTCTATGCATGG - Intergenic
1021869287 7:24987674-24987696 TTGAATGCTTACTAGGTGCTAGG - Intergenic
1022024379 7:26432466-26432488 CATAGTGCTTAATATGTGCCAGG + Intergenic
1022451526 7:30520347-30520369 TTGAGTGCTTACTATGTGCCAGG + Intronic
1022743143 7:33142354-33142376 TTGAGTGCTTATTATGTGCCAGG + Intronic
1022999356 7:35791586-35791608 TTGAGTGCCTACTATGTGCAAGG + Intergenic
1023366879 7:39473605-39473627 TACAATGCTCACTGTGTGCATGG - Intronic
1023434780 7:40130997-40131019 TTGAGTGCTTACTATGTGCCAGG + Exonic
1023552568 7:41385897-41385919 TATAGTGCTTAATATGTTCCAGG + Intergenic
1025173238 7:56780557-56780579 GATAATGCTTACTATGTGCTAGG - Intergenic
1025698865 7:63797624-63797646 GATAATGCTTACTATGTGCTAGG + Intergenic
1025917733 7:65879430-65879452 GATAATGCTTACTATGTGCTAGG + Intronic
1026361423 7:69604349-69604371 TGGAGTGCTTAATATGTACAAGG + Intronic
1026657317 7:72268108-72268130 TTGAGTGCTTACTATGTGCTAGG - Intronic
1027716819 7:81682291-81682313 CATCATGCTTAATATGTGCCAGG - Intergenic
1027748670 7:82112160-82112182 TACAATGATTAATATGTGTAGGG - Intronic
1027796978 7:82707931-82707953 TTGAATACTTAATATGTGCCAGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028545072 7:91989012-91989034 GAGAATGTTTAATATGTGTTTGG + Intronic
1028602948 7:92622439-92622461 TAAAGTGCTTACTATGTGCCAGG + Intronic
1028727093 7:94100697-94100719 TAGCATGTGTAATCTGTGCATGG - Intergenic
1028960325 7:96741494-96741516 CAGAATGCTTAGTATATACAAGG - Intergenic
1030422765 7:109329229-109329251 TAGACTTTTTAATATGTGCTTGG - Intergenic
1030765463 7:113404013-113404035 TTGAGTGCTTACTATGTGCAAGG + Intergenic
1031426453 7:121611249-121611271 TGGAGTGCTTAGTATGTGCTAGG + Intergenic
1031504662 7:122566929-122566951 TAAAGTGCATAATATGTCCATGG + Intronic
1031768345 7:125809472-125809494 TGGAATTCTTATTATGTGTATGG - Intergenic
1031863811 7:127014622-127014644 TAGAGTTCTTACTATGTGCTAGG - Intronic
1032027300 7:128454177-128454199 TAGAATGTTTTTTATGTGCCAGG + Intergenic
1032636625 7:133716200-133716222 TTGAATACTTACAATGTGCAGGG + Intronic
1032641533 7:133774452-133774474 TTGAAAGCTTATTATGTGCTGGG - Intronic
1032647128 7:133837161-133837183 TTGAATGCCTACTATGTGCCAGG + Intronic
1032900517 7:136301824-136301846 AAGAATAGTTAATATGTGCTGGG + Intergenic
1033243589 7:139700858-139700880 TTGAATACCTACTATGTGCATGG - Intronic
1033273997 7:139957422-139957444 TTGAGTGCTTACTATGTGCCAGG + Intronic
1035136367 7:156707684-156707706 TTGCATGCTTAATCTGTGGAGGG - Intronic
1035936008 8:3840456-3840478 TTGAATGCCTATTATGTTCAGGG - Intronic
1036786964 8:11694193-11694215 TTGAATGTTTACTATGTGCCAGG - Intronic
1037342638 8:17862948-17862970 TTGAATGCTTACTTTGTGCGAGG + Intergenic
1037666946 8:20977965-20977987 CAGGATGCTTACTATGTGCCAGG + Intergenic
1037673203 8:21033121-21033143 TAGAGTTCTTACTATGTGCCTGG - Intergenic
1037789369 8:21923177-21923199 CAGAATGCTTAGTGTGTGCAAGG + Intronic
1037807183 8:22065028-22065050 TTGAATGCTCATTATGTGCTAGG - Intronic
1038628473 8:29217509-29217531 CTGAATGCTTATTATGTGCCAGG - Intronic
1038829989 8:31046395-31046417 TAAAATGCTTAATATGAGGGAGG + Intronic
1038943858 8:32335638-32335660 TGGAAGGCCTATTATGTGCAAGG - Intronic
1039252840 8:35685612-35685634 TTGAGTGCTTACTATGTGCCAGG + Intronic
1039299372 8:36193011-36193033 AAGAATGTTAAATATGTGCTAGG + Intergenic
1039739037 8:40363010-40363032 TAGAACACTTACTATGTGCCAGG + Intergenic
1039739379 8:40367896-40367918 CATAATGCTTAGTATGTGCCTGG + Intergenic
1040655592 8:49503893-49503915 TTGAATGCTTTATATGTGCCAGG - Intergenic
1040761070 8:50844434-50844456 TATAGTGTTTAATATGTGCTAGG - Intergenic
1042332829 8:67599016-67599038 TATAATACTTAATATTAGCATGG + Intronic
1042974755 8:74455447-74455469 CAGAATTGTTAATATGTGAAAGG + Intronic
1043018383 8:74969660-74969682 TTGAATACTTATTAGGTGCAAGG + Intergenic
1043392214 8:79802905-79802927 TAGAATGCCTACTATGTGCCAGG + Intergenic
1043424389 8:80134175-80134197 CTGAATGCTTACTATGTGCCGGG + Intronic
1044493426 8:92847558-92847580 TGGAATGCCTACTATGTGTATGG - Intergenic
1044726463 8:95198316-95198338 TGGCATGCTTAATATGGGCGAGG - Intergenic
1044804224 8:95988380-95988402 TAGAAACCTTAATTTGTGCCAGG + Intergenic
1044882219 8:96735268-96735290 TTGAAGGCTTAATATATGCCAGG - Intronic
1045661223 8:104440143-104440165 TTGAGTGCTTAATATGTGCCTGG - Intronic
1045958083 8:107933273-107933295 TAGCAGGCTCAACATGTGCATGG - Intronic
1046030480 8:108777273-108777295 TTGAGTGCTTACTATGTGCCAGG - Intronic
1046102702 8:109632962-109632984 TTGAATACTTATTGTGTGCAAGG - Intronic
1046104962 8:109654014-109654036 TTGAGTGCTTAGTGTGTGCAGGG - Intronic
1046141544 8:110100280-110100302 TTGAATGCTTATTATATGCCAGG + Intergenic
1046697212 8:117355822-117355844 TTGAATTCTTAATATCTGCCAGG - Intergenic
1046828442 8:118717622-118717644 GAGAATGCTTACTATGTGCCAGG + Intergenic
1047260295 8:123251942-123251964 TAGAGAGCTTAATATGTACCAGG - Intronic
1047321033 8:123783290-123783312 TTGAATGCTTACTAAGTGCTAGG - Intronic
1047595570 8:126374557-126374579 TAGAAGGCCTAAAATGTCCAGGG + Intergenic
1047825576 8:128570722-128570744 TGGAAAGCTCAATATCTGCAGGG + Intergenic
1048068814 8:131000462-131000484 CAGAACACTTAATATGTGCCAGG + Intronic
1048118470 8:131551948-131551970 ATGAATGCTTAGTATGTGCTAGG + Intergenic
1048228368 8:132612695-132612717 TAGAATACCTACTATGTGCCAGG - Intronic
1048570242 8:135647181-135647203 CAGAATGCTTAAAATCTGAATGG + Exonic
1050170608 9:2811991-2812013 TTGAATGCCTACTATGTGCCAGG + Intronic
1050811775 9:9757687-9757709 TAGAATGCATAATATGTGACAGG - Intronic
1051027796 9:12634503-12634525 TTGGATGATTACTATGTGCAAGG + Intergenic
1051106853 9:13590155-13590177 TTGAATGCTTACTATGTGGCAGG + Intergenic
1051719930 9:20026381-20026403 TAGAGTGCTTACTATGTGCTAGG - Intergenic
1052163962 9:25299048-25299070 TTGGATGCTTACTATGGGCAAGG - Intergenic
1052383798 9:27801554-27801576 TTGAATGCCTACTATGTGCCAGG - Intergenic
1052430369 9:28358746-28358768 TAGAATGTTTACTAAGTGCCAGG - Intronic
1052575494 9:30284429-30284451 TGAAATGCTTATTATGTTCATGG - Intergenic
1055032271 9:71782736-71782758 TAGAATGCTTGCTATGAGCTAGG + Intronic
1055943812 9:81674849-81674871 CAGAATTCTTAAAATGTACATGG + Intronic
1056084390 9:83130920-83130942 TTGAAGGCTTACCATGTGCAAGG + Intergenic
1057021362 9:91700046-91700068 TAGAATTCTGAGTTTGTGCAAGG + Intronic
1057717780 9:97508567-97508589 TAAAATGCTTAAGACGTGCCTGG + Intronic
1058186643 9:101863360-101863382 ATGAATGTATAATATGTGCAGGG + Intergenic
1058797324 9:108511299-108511321 TAAAATTCCTAATATATGCAAGG + Intergenic
1059031659 9:110704523-110704545 TATAGTGCTTACCATGTGCAAGG + Intronic
1059520539 9:114937254-114937276 TTGAGAGCTTAATATGTGCTAGG + Intergenic
1059539422 9:115116020-115116042 TTGAACCCTTAATATGTGGAAGG + Intronic
1059548025 9:115198436-115198458 TATGATGCTTAATAAGTGGAAGG + Intronic
1059604712 9:115821768-115821790 TTAAATGCTTGCTATGTGCAAGG + Intergenic
1059682636 9:116600910-116600932 TTGAGTGCTTACTATGTGCCTGG + Intronic
1059743586 9:117179119-117179141 TTGAAGGCTTACTATGTGCCAGG + Intronic
1059813601 9:117885384-117885406 TTGAAGGCTTATTATGTGCCAGG - Intergenic
1059920873 9:119158436-119158458 TTGAATGCTTACTAGGTGCCAGG + Intronic
1060274744 9:122173931-122173953 TTGAATGTTTATTATGTGCCAGG - Intronic
1061250790 9:129425141-129425163 TACAATGCTTTATCTGTGCCAGG + Intergenic
1186299565 X:8185073-8185095 TTGAATGCCTGAAATGTGCAAGG + Intergenic
1186717840 X:12272170-12272192 TAGAGTGCTTATTATGTGCCAGG - Intronic
1186769650 X:12805049-12805071 TAAAATGTTACATATGTGCAGGG - Intronic
1187089408 X:16079445-16079467 TAAACTGCTTAATATGTGCCTGG + Intergenic
1187219450 X:17309396-17309418 TTGAATGCTTACAATGTGCCAGG + Intergenic
1187267691 X:17750548-17750570 TTCAATGCATATTATGTGCAAGG + Intronic
1187769948 X:22683965-22683987 CATAATGCTTAATATGTGCCAGG - Intergenic
1187790996 X:22950147-22950169 TAGAATGCTTGCTATGTGCCAGG - Intergenic
1188264847 X:28060318-28060340 TTGAATGCCAAATATGTGCCAGG + Intergenic
1188276105 X:28203049-28203071 TTGAATGTTTACTATGTGCCAGG + Intergenic
1188608246 X:32060996-32061018 TTGAAGGCTTACTATGTGCCAGG - Intronic
1188943893 X:36273115-36273137 TTGAATGCTTACTGTGTGCTAGG - Intronic
1189261224 X:39680112-39680134 CATAATGCTTACTCTGTGCAAGG - Intergenic
1189451590 X:41137340-41137362 TAGAATGCCTAAAATGATCACGG - Intronic
1189747544 X:44184958-44184980 TAGAGAGCTTACTATGTGCCAGG - Intronic
1190798151 X:53762976-53762998 TAGAGTACTCATTATGTGCAAGG + Intergenic
1191152144 X:57230803-57230825 AATTATGCTTAGTATGTGCAAGG - Intergenic
1191247984 X:58243058-58243080 TAGAATGCCTAAAATAGGCAAGG - Intergenic
1193166413 X:78285777-78285799 TTGAGTGCCTACTATGTGCAAGG - Intronic
1193173455 X:78363763-78363785 TAGATTACTTACTATGTGCCAGG - Intergenic
1193534928 X:82702562-82702584 AAGAATGCTTACTATGTGTCGGG + Intergenic
1193603159 X:83533939-83533961 TAGAATTCTTAATTTGAGCATGG - Intergenic
1193819133 X:86140821-86140843 TAAAATAATTAATATGTCCAAGG - Intergenic
1193829234 X:86268288-86268310 TTGAGTGCTTACTATGTGCCAGG + Intronic
1193901644 X:87186335-87186357 TAGAAAGCTCAAAATGTGCAGGG + Intergenic
1194054359 X:89112907-89112929 TTGAGTGCTTACTATGTGCCAGG + Intergenic
1194705031 X:97165021-97165043 TTGAATGCTGAATTTGTGCCAGG + Intronic
1194771268 X:97908707-97908729 TTGAGTGCTCACTATGTGCAAGG + Intergenic
1194974192 X:100376767-100376789 TTGAATGCTTAACATGTGCCAGG - Intronic
1195004662 X:100673909-100673931 TCAAATGCTTTTTATGTGCAAGG - Intergenic
1195045755 X:101053113-101053135 TAACATGCCTATTATGTGCAAGG + Intergenic
1195310420 X:103626921-103626943 TAGAGTGCTTTCTATGTGCTAGG + Intronic
1195438227 X:104870407-104870429 TTGAGTGCTTACTATGTGCCAGG + Intronic
1195749642 X:108150988-108151010 TAGAATGCTTACAATGTGCCAGG - Intronic
1195769565 X:108335860-108335882 TCTAATGCTTAATATGTGTCAGG + Intronic
1196187400 X:112759208-112759230 TGAAATACTTAATATGTGCCAGG - Intergenic
1196344685 X:114640110-114640132 TATAATACTTAATATATGAAAGG + Intronic
1196575251 X:117309747-117309769 TTAAGTGCTAAATATGTGCATGG - Intergenic
1196759778 X:119190727-119190749 TGGAGTGCTTACTATGTGCTGGG + Intergenic
1196978582 X:121186811-121186833 TTGAATGCTTACTGTGTGCTAGG + Intergenic
1197019767 X:121672760-121672782 TCAAATGCTTAATATGTACCAGG + Intergenic
1197081248 X:122419647-122419669 GAGAGTGCTTAATAGGTACAGGG - Intergenic
1197263220 X:124338152-124338174 TAGAGTGCTTACTATGTGTTAGG + Intronic
1197613202 X:128661708-128661730 TTGAATGCCTACTATGTGCCAGG + Intergenic
1197662780 X:129192112-129192134 TTGAATGATTAATATGTGTTTGG - Intergenic
1197742784 X:129908234-129908256 TATAATGCTTACTATATGCTAGG - Intronic
1197863429 X:130994196-130994218 TGGAATTCTTACTATGTGCCAGG - Intergenic
1197954952 X:131936369-131936391 TTGAATGCCTATTATGTGCCAGG - Intergenic
1198119473 X:133578079-133578101 TTGAGTGCTTACTATGTGCCCGG - Intronic
1198217369 X:134568273-134568295 TTGAATGCCTACTATGTGCACGG + Intronic
1198466832 X:136910739-136910761 TTGAAAGCTTACTATGTGCAAGG - Intergenic
1198485321 X:137081376-137081398 TTGAGTCCTTAATATGTGCCAGG - Intergenic
1198486895 X:137096181-137096203 CAGAATGCTTCCTATGTGCTAGG + Intergenic
1198512428 X:137365810-137365832 TTGAGTGCTTACTATGTGCCAGG + Intergenic
1198514128 X:137387328-137387350 TTGAATGCCTACTATGTGCCAGG + Intergenic
1198802413 X:140461130-140461152 TTGAATGCTTATTATGTGTCAGG - Intergenic
1199263253 X:145800449-145800471 TATGATGCTTACTATGTACAAGG - Intergenic
1199286595 X:146061207-146061229 TTGAATGCTTATTATGTACCAGG + Intergenic
1199294396 X:146140897-146140919 TAGAGTGCTTACGATGTGCTGGG - Intergenic
1199427504 X:147719906-147719928 TAGAAGCCTTAAGAAGTGCATGG - Intergenic
1199503791 X:148538661-148538683 TTAAATCCTTACTATGTGCAAGG + Intronic
1200517778 Y:4168217-4168239 TTGAATGTTTAATATGGGCTTGG + Intergenic
1200843119 Y:7803911-7803933 TGTAATGCTTCATATGGGCAAGG + Intergenic
1200845242 Y:7825718-7825740 CAGAATGCTTTTTATATGCAGGG + Intergenic
1202134105 Y:21643328-21643350 TAGAAGGCTTCATCTGTGCCAGG + Intergenic