ID: 983862857

View in Genome Browser
Species Human (GRCh38)
Location 4:172729675-172729697
Sequence CTGTGCAAAATTAACAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1373
Summary {0: 1, 1: 0, 2: 12, 3: 104, 4: 1256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983862857_983862860 -3 Left 983862857 4:172729675-172729697 CCAACTTTGTTAATTTTGCACAG 0: 1
1: 0
2: 12
3: 104
4: 1256
Right 983862860 4:172729695-172729717 CAGGATTGCTTTGGCTATTAAGG 0: 11
1: 209
2: 1427
3: 3333
4: 5112
983862857_983862861 -2 Left 983862857 4:172729675-172729697 CCAACTTTGTTAATTTTGCACAG 0: 1
1: 0
2: 12
3: 104
4: 1256
Right 983862861 4:172729696-172729718 AGGATTGCTTTGGCTATTAAGGG 0: 2
1: 57
2: 343
3: 1277
4: 2292
983862857_983862862 8 Left 983862857 4:172729675-172729697 CCAACTTTGTTAATTTTGCACAG 0: 1
1: 0
2: 12
3: 104
4: 1256
Right 983862862 4:172729706-172729728 TGGCTATTAAGGGTCTTTAGTGG 0: 1
1: 2
2: 127
3: 844
4: 2182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983862857 Original CRISPR CTGTGCAAAATTAACAAAGT TGG (reversed) Intronic
900084496 1:884410-884432 CTAAGCAAAAATAACAAAGCTGG - Intergenic
900904329 1:5541522-5541544 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
901942285 1:12672192-12672214 CTAAGCAAAAATAACAAAGTTGG - Intergenic
902046437 1:13528194-13528216 CTGTGCAGAATTAAGCAAATTGG + Intergenic
903796615 1:25933821-25933843 ATGTGGAAAATTAGCAAAATGGG - Intergenic
904099395 1:28010807-28010829 CTGAGCAAAATAAACTAAATTGG - Intronic
904146439 1:28395962-28395984 CTGTTCAAAAAAAAAAAAGTTGG - Intronic
904866450 1:33582773-33582795 CAGTACACACTTAACAAAGTAGG + Intronic
905053142 1:35070028-35070050 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905331740 1:37207634-37207656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
905739527 1:40357867-40357889 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905746292 1:40421473-40421495 CTGTTCAGAATGAACAAAGGCGG - Intronic
906222721 1:44094784-44094806 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
906393084 1:45436067-45436089 CTGAGCAAAAAGAACAAAGCTGG - Intronic
906435457 1:45792346-45792368 CTGAGCAAAAAGAACAAAGTGGG - Intronic
906851457 1:49254714-49254736 CTAAGCAAAATGAACAAAGCTGG + Intronic
906857027 1:49318896-49318918 CTGGGCAAAATGGAAAAAGTAGG - Intronic
906889237 1:49689513-49689535 CTGAGCAAAAATAACAAAACTGG - Intronic
906906660 1:49901738-49901760 CTATGCAAAAAGAACAAAGCTGG + Intronic
906971952 1:50524826-50524848 CTAAGCAAAAATAACAAAGATGG - Intronic
906997900 1:50817123-50817145 CTGAGCAAAAAGAACAAAGTTGG - Intronic
907008366 1:50939007-50939029 CTAAGCAAAAAGAACAAAGTGGG - Intronic
907583865 1:55597292-55597314 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
907849150 1:58237391-58237413 CTGTGCAATGTTAACACAGTAGG - Intronic
908070977 1:60459781-60459803 CTGAGCAAAATGAACAAAGCTGG + Intergenic
908262974 1:62353158-62353180 CTGAGCAAAAACAACAAAGCTGG + Intergenic
908351587 1:63291232-63291254 TTGAGCAAAAAGAACAAAGTGGG + Intergenic
908838942 1:68258991-68259013 CTGAGCAAAATAAACAAAGTTGG - Intergenic
908943435 1:69464749-69464771 CTATGCAAAAAGAACAAAGCTGG - Intergenic
909098823 1:71324136-71324158 CTATGCAAAAATAACAAATCTGG + Intergenic
909325657 1:74348439-74348461 CTAAGCAAAAAGAACAAAGTTGG - Intronic
909386440 1:75062734-75062756 CTGAGCAAAATGAAGAAAATTGG - Intergenic
909734066 1:78934124-78934146 CTAAGCAAAAAGAACAAAGTTGG + Intronic
909767823 1:79379496-79379518 CTATGGAAAATTAAGACAGTTGG - Intergenic
909987062 1:82173787-82173809 ATGAGCAAAAGTAACAAAGCTGG + Intergenic
910167444 1:84342406-84342428 CTAAGCAAAAAGAACAAAGTTGG + Intronic
910475845 1:87605902-87605924 CTGAGCAAAAAGAACAAAGCAGG - Intergenic
910568279 1:88670571-88670593 CAGAACAAAATTAACAAAATAGG - Intergenic
910634984 1:89397829-89397851 CTGAGCAAAAAGAACAAAATTGG - Intergenic
910827388 1:91423816-91423838 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
911082596 1:93948336-93948358 CTGAGCAAAAATAACAAAGTTGG - Intergenic
911172870 1:94788062-94788084 CTGAACAAAAAGAACAAAGTTGG + Intergenic
911320335 1:96406296-96406318 CTGAGCAAAAAGAACAAAGGTGG - Intergenic
911486260 1:98510087-98510109 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
911492265 1:98585062-98585084 CTAAGCAAAATGAACAAAGCTGG + Intergenic
911540932 1:99157595-99157617 CTATGCAAAAAGAACAAAGCTGG - Intergenic
911711081 1:101073743-101073765 CTGTGATAAATTTCCAAAGTTGG + Intergenic
911837681 1:102642165-102642187 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
911983041 1:104589621-104589643 CTAAGCAAAAATAACAAAGCTGG + Intergenic
912104884 1:106260140-106260162 CTAAGCAAAAATAACAAAGCTGG - Intergenic
912150939 1:106857914-106857936 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
912464363 1:109860699-109860721 CTAAGCAAAATGAACAAAGCTGG + Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
912605935 1:110988753-110988775 CTGAGCAAAAATAACAAAGTTGG + Intergenic
912606615 1:110996901-110996923 CTGAGCAAAAATAACAAAACTGG - Intergenic
912632839 1:111262197-111262219 CTGAGCAAAAATAACAAAACTGG - Intergenic
913310262 1:117483180-117483202 CTAAGCAAAAAGAACAAAGTTGG - Intronic
913410619 1:118547162-118547184 CTAAGCAAAAATAACAAAGCTGG + Intergenic
913424730 1:118714835-118714857 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
914513943 1:148357692-148357714 CTTAGCAAAGTTAACAAATTAGG + Intergenic
914750654 1:150532811-150532833 CTGAGCAAAATAAACTAAGATGG + Intergenic
915005631 1:152632766-152632788 CTAAGCAAAAATAACAAAGCTGG + Intergenic
915076924 1:153315709-153315731 CTAAGCAAAATGAACAAAGCCGG - Intergenic
915887916 1:159742854-159742876 CTATGCAAAAAGAACAAAGCTGG - Intergenic
915919858 1:159967543-159967565 TTGAGCAAAAATAACAAAGCTGG - Intergenic
915967334 1:160322160-160322182 CTGAGCAAAAAGAACAAAGATGG + Intronic
916341438 1:163740348-163740370 CTGAGCAAAAATAACAAAACTGG - Intergenic
916872320 1:168929272-168929294 CTAAGCAAAAATAACAAAGCTGG + Intergenic
917146395 1:171896080-171896102 CTAAGCAAAAAGAACAAAGTTGG - Intronic
917389977 1:174525084-174525106 CTGAGCAAAAAGAACAAAGCTGG - Intronic
917446595 1:175110808-175110830 CTGAGCAAAAATAACAAAGCTGG - Intronic
917489984 1:175489923-175489945 CTAAGCAAAAATAACAAAGCTGG + Intronic
917607473 1:176647883-176647905 CTGAGCAAAAGGAACAAAGCTGG - Intronic
917698299 1:177552781-177552803 CTGAGTAAAATGAATAAAGTTGG - Intergenic
917820933 1:178763285-178763307 CTAAGCAAAAATAACAAAGCAGG - Intronic
917888909 1:179417654-179417676 CTGTGCAAAAAGAACAAAGCAGG - Intronic
917893332 1:179461492-179461514 CTAAGCAAAATGAACAAAGCTGG - Intronic
917896771 1:179498207-179498229 CTGAGCAAAAGGAACAAAGCTGG + Intronic
917991439 1:180383720-180383742 CTGAGCAAAAAGAACAAAGCTGG + Intronic
918157665 1:181865186-181865208 CTAAGCAAAATGAACAAAGCTGG + Intergenic
918503446 1:185224428-185224450 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918601557 1:186369189-186369211 CTGAGCAAGAAAAACAAAGTTGG - Intronic
918651591 1:186970848-186970870 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918664624 1:187134876-187134898 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
919012238 1:191980269-191980291 CTGAGCAAAAGGAACAAAGCTGG - Intergenic
919304821 1:195818854-195818876 CTAAGCAAAATGAACAAAGCTGG - Intergenic
919590808 1:199499534-199499556 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
920606082 1:207387774-207387796 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
920654986 1:207868415-207868437 CCCTGCCAAATTAATAAAGTGGG - Intergenic
920934743 1:210421184-210421206 CTGAGCAAAAAGAACAAAGCTGG + Intronic
921120878 1:212136170-212136192 CTGAGCAAAAAGAACAAAGTGGG + Intergenic
921593429 1:217029410-217029432 GTGTTCAAAATTCACTAAGTAGG + Intronic
921640417 1:217546310-217546332 CTGAGCAAAAAGAACAAAGCTGG + Intronic
922065326 1:222132648-222132670 ATGTGAAAAGTTAACAAAATAGG + Intergenic
922373261 1:224932871-224932893 CTGAACAAAAAGAACAAAGTTGG - Intronic
922388153 1:225109156-225109178 CTGGGCAAAAAGAACAAAGCTGG - Intronic
922395599 1:225197482-225197504 CTAAGCAAAAATAACAAATTTGG - Intronic
922403985 1:225292540-225292562 CTGAGCAAAAAGAACAAAATTGG - Intronic
922549927 1:226487129-226487151 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
922943331 1:229488156-229488178 ATTTCCAAAATTAACAAATTTGG + Intronic
923228564 1:231962498-231962520 CTGAGCAAAAAGAACAAAGCTGG + Intronic
923365595 1:233258038-233258060 CTGAGCAGAATGAAGAAAGTGGG - Exonic
923759847 1:236831996-236832018 CTCTCCAATGTTAACAAAGTTGG - Exonic
924398465 1:243650844-243650866 CTGAGCAAAAAGAACAAAGCTGG - Intronic
924834118 1:247631144-247631166 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1064729753 10:18318174-18318196 CTAGGCAAAAATAACAAAGCTGG + Intronic
1064814268 10:19239939-19239961 CTGTGCAAAAATAACAAAGCTGG - Intronic
1064837691 10:19552493-19552515 CTGAAAAAAATTAATAAAGTAGG - Intronic
1064857388 10:19785148-19785170 CTAAGCAAAATGAACAAAGCTGG + Intronic
1064872206 10:19950701-19950723 CTCAGCAAAAAGAACAAAGTTGG + Intronic
1064898249 10:20263057-20263079 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1064975175 10:21106627-21106649 CTAAGCAAAAAGAACAAAGTGGG - Intronic
1064975574 10:21111293-21111315 CTAAGCAAAAAGAACAAAGTGGG + Intronic
1065198217 10:23287175-23287197 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1065405674 10:25360701-25360723 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1065590150 10:27255216-27255238 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1065789194 10:29244120-29244142 GGGTGCAAATTTAACAAAGCTGG + Intergenic
1065994693 10:31046852-31046874 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1066037195 10:31504396-31504418 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1066599525 10:37089723-37089745 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1066679319 10:37921382-37921404 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1066685103 10:37973830-37973852 TTGTGCAAAAAGAACAAAGGTGG + Intronic
1066705839 10:38176457-38176479 CTGTTCAAAGATAAGAAAGTTGG + Intergenic
1067413146 10:46082656-46082678 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1067911220 10:50348866-50348888 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1068109348 10:52660885-52660907 CTGAGGAAAACAAACAAAGTTGG - Intergenic
1068357687 10:55931221-55931243 ATGTACAAAATTAACCAAATCGG + Intergenic
1068511849 10:57976488-57976510 CTGAACAAAAATAACAAAGCTGG + Intergenic
1068568453 10:58602126-58602148 CTTTCCAAAGTAAACAAAGTAGG + Intronic
1068716140 10:60190784-60190806 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1068897684 10:62225520-62225542 CTGTGAAAAATAAAAAAAGTTGG - Intronic
1069076956 10:64047850-64047872 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1069158536 10:65059306-65059328 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1069194810 10:65537902-65537924 CTATGCAAAACCAACAAAGCTGG + Intergenic
1069260343 10:66386646-66386668 CTAAGCAAAAATAACAAAGCTGG + Intronic
1069262765 10:66419589-66419611 CTGAGCAAAAATAATAAAGCTGG + Intronic
1069337076 10:67364924-67364946 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1070213609 10:74352125-74352147 CTAAGCAAAAATAACAAAGCTGG + Intronic
1070871010 10:79752976-79752998 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1071637937 10:87275189-87275211 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1071657308 10:87462762-87462784 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1071723679 10:88173425-88173447 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1071799748 10:89045457-89045479 CTGAGCAAAAAGAACAAAGCCGG - Intergenic
1071922493 10:90367234-90367256 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1072266807 10:93737868-93737890 CTGAGCAAAAAGAACAAAATTGG + Intergenic
1072356940 10:94620904-94620926 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1072514202 10:96162178-96162200 CTGTGCAAAATTTACATAAAAGG - Exonic
1073694664 10:105851186-105851208 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1073813922 10:107184380-107184402 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1073857059 10:107688929-107688951 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1073962369 10:108947295-108947317 CTGGTCAAAATTAAGAAAGGCGG - Intergenic
1073962788 10:108953217-108953239 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1074434650 10:113423959-113423981 TTTTGCAAAATTAAAAAAGTGGG - Intergenic
1074985421 10:118654468-118654490 CTAAGCAAAATAAACAAATTTGG - Intergenic
1075332943 10:121586945-121586967 CTAAGCAAAAATAACAAAGCTGG + Intronic
1075449233 10:122537309-122537331 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1075859839 10:125665647-125665669 TTGAGCAAAATGAACAAAGCTGG - Intronic
1076039398 10:127230707-127230729 TTGGGCAAAAATAACAAAGATGG - Intronic
1076074156 10:127519631-127519653 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1077450681 11:2642062-2642084 CTGAGCAAAAATAACAAAGTTGG - Intronic
1077514906 11:2995534-2995556 CTGTGGGGCATTAACAAAGTGGG + Intergenic
1077632920 11:3823338-3823360 CTGATCATGATTAACAAAGTGGG - Intronic
1077758622 11:5065106-5065128 CTGTTGAAAATTTACATAGTTGG - Intergenic
1077759730 11:5080503-5080525 ATTTGAAAAATTAACAAAATAGG + Intergenic
1077955058 11:7009131-7009153 CTAAGCAAAATGAACAAAGCTGG + Intronic
1078295970 11:10070600-10070622 CTAAGCAAAATGAACAAAGCTGG - Intronic
1078297110 11:10083433-10083455 CTGAGCAAAAAGAACAAAGTTGG + Intronic
1079529629 11:21434632-21434654 CTGAGCAAAAAGAACAAAGTTGG - Intronic
1079578235 11:22029637-22029659 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1079861383 11:25676480-25676502 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1079868300 11:25762992-25763014 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1079879419 11:25906255-25906277 CTAAGCAAAATTAACAAAGCTGG + Intergenic
1080077310 11:28166080-28166102 TTCAGCAAAAATAACAAAGTTGG - Intronic
1080092730 11:28367648-28367670 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
1080093009 11:28371468-28371490 CTGATCAAAAATAACAAAGCTGG - Intergenic
1080513262 11:32996458-32996480 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1080594099 11:33753485-33753507 CTATGCAAAAATAACAACGAGGG + Intronic
1080681191 11:34477677-34477699 CTGTGACAAATTATCAAAATTGG - Intergenic
1081211837 11:40345248-40345270 CTAAGCAAAATAAACAAAGCTGG + Intronic
1081311000 11:41572120-41572142 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
1081376587 11:42366882-42366904 TTGAGCAAAATGAACAAAGCTGG - Intergenic
1081467849 11:43340482-43340504 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1081741818 11:45446269-45446291 TTGTGCAAATTTAAAAAAGATGG + Intergenic
1082272495 11:50186540-50186562 CTTTGCAGAACTAACAAATTAGG - Intergenic
1082560404 11:54613260-54613282 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1082596578 11:55089067-55089089 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1082680102 11:56157112-56157134 CTATGCAAAAATAACAAATCTGG + Intergenic
1082684096 11:56217222-56217244 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1082720976 11:56675950-56675972 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1082873461 11:57964975-57964997 CTGTGCAACACTATCACAGTAGG - Intergenic
1082876511 11:57994000-57994022 GTGTGCAAAATGCACAAAGTCGG + Intergenic
1082884703 11:58069707-58069729 CTGTGAAAAACTAAAAAATTAGG + Intronic
1082900231 11:58241170-58241192 CTGAGCAAAAAGAACAATGTTGG - Intergenic
1082901849 11:58263218-58263240 CTGAGCAAAAATCACAAAGCTGG - Intergenic
1083096468 11:60256013-60256035 CTTTGCAAAGTTTACAAATTTGG - Intergenic
1083125075 11:60556828-60556850 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1084159965 11:67342315-67342337 CTAAGCAAAAATAACAAAGCTGG + Intronic
1084986692 11:72880322-72880344 CTGAGCAAAAATAATAAAGCTGG + Intronic
1085001665 11:73042499-73042521 CTGAGCAAAAGGAACAAAGCTGG - Intronic
1085007726 11:73109160-73109182 CTGAGCAAAAATAACAAAATTGG - Intronic
1085379547 11:76102021-76102043 CTAAGCAAAAATAACAAAGCAGG - Intronic
1085842272 11:80026001-80026023 CTGAGCAAAATGAACACAGCTGG + Intergenic
1085965947 11:81526560-81526582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1085991978 11:81859299-81859321 TTGAGCAAAAATAACAAAGCTGG - Intergenic
1086277575 11:85149190-85149212 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1086288159 11:85272803-85272825 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1086522811 11:87689954-87689976 CTCAGCAAAAAGAACAAAGTTGG + Intergenic
1086536598 11:87854328-87854350 GTGTGCACAATTAACAAAATAGG - Intergenic
1087166387 11:95008250-95008272 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087253209 11:95926795-95926817 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1087308936 11:96517651-96517673 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1087337179 11:96859134-96859156 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1087406413 11:97736345-97736367 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1087471765 11:98584522-98584544 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087566138 11:99860738-99860760 CTGAGCAAAAATAACAAAGCTGG - Intronic
1088081458 11:105921046-105921068 CTCTGCAAAATTATTAAATTTGG + Intronic
1088307587 11:108426699-108426721 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1088981572 11:114868816-114868838 CTGGGCAAAATTATCCAAGATGG + Intergenic
1089765591 11:120761890-120761912 CTATGCAAAAAGAACAAAGCTGG - Intronic
1090045723 11:123331204-123331226 CTGTGCATATTGAGCAAAGTGGG + Intergenic
1090306477 11:125695582-125695604 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1090630385 11:128641966-128641988 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1090719894 11:129461928-129461950 CTGAGCAAAAAGAACAAAGATGG - Intergenic
1090853509 11:130591637-130591659 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1090864282 11:130683434-130683456 CTAAACAAAAATAACAAAGTTGG - Intronic
1091089590 11:132758245-132758267 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1091160863 11:133418506-133418528 CTTTGCAAAATTATGACAGTAGG + Intronic
1092393789 12:8106329-8106351 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1092639324 12:10486361-10486383 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1092710681 12:11334099-11334121 CTGTGACAAATTAAACAAGTAGG - Intergenic
1092715405 12:11384178-11384200 CTGTGACAAATTAAACAAGTAGG - Intronic
1092715683 12:11387603-11387625 CTAGGCAAAATAAACAAATTTGG + Intronic
1092803475 12:12196131-12196153 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1092941667 12:13414667-13414689 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1093257592 12:16889534-16889556 CTGAGCAAAAATAATAAAGCTGG + Intergenic
1093297418 12:17408126-17408148 TTGAGCAAAATGAACAAAGCTGG + Intergenic
1093691001 12:22108715-22108737 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1094299405 12:28945088-28945110 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1094721639 12:33071157-33071179 CTAAGCAAAATTAACAAATCTGG - Intergenic
1094760372 12:33525421-33525443 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1095041250 12:37443532-37443554 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1095181229 12:39148681-39148703 CTGAGCAAAAAGAACAAAATGGG - Intergenic
1095224359 12:39662087-39662109 CTGAGCAAAAAGAACAAAGGTGG - Intronic
1095281681 12:40358662-40358684 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1095384293 12:41632153-41632175 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1095503762 12:42869796-42869818 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1095564615 12:43607726-43607748 TTGTGCAAAAGGAACAAAGCTGG - Intergenic
1095682766 12:44998220-44998242 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1095866239 12:46975240-46975262 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1095876793 12:47088254-47088276 ATGTGCAAAATAAACAGAGCTGG + Intronic
1095919132 12:47511741-47511763 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1096442646 12:51658056-51658078 CTGAGCAAAAGGAACAAAGCTGG - Intronic
1096894614 12:54808384-54808406 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1096925561 12:55140911-55140933 TTAAGCAAAAGTAACAAAGTTGG + Intergenic
1097257187 12:57687459-57687481 CTAAGCAAAATAAACAAAGCTGG + Intergenic
1097303949 12:58048305-58048327 CTGAGCAAAAATAACAAGGCTGG + Intergenic
1097634789 12:62109421-62109443 CTAAGCAAAAATAACAAAGGTGG - Intronic
1097653978 12:62338911-62338933 CTAAGCAAAAATAACAAAGCTGG - Intronic
1098215493 12:68212323-68212345 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1098458913 12:70710101-70710123 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1098563005 12:71899299-71899321 CTGCTAAAAATGAACAAAGTAGG - Intronic
1098685225 12:73411150-73411172 CTAAGCAAAAATAACAAAGTTGG - Intergenic
1099192860 12:79578421-79578443 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1099369959 12:81816925-81816947 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1099522930 12:83686237-83686259 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1099583096 12:84478453-84478475 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1099616391 12:84941077-84941099 CTGAGCAAAATGAACAAAACTGG + Intergenic
1099663296 12:85594444-85594466 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1099701460 12:86087932-86087954 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1099950414 12:89295914-89295936 CTTTTTAAAATTAACAAAGTCGG + Intergenic
1100024998 12:90117283-90117305 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100040150 12:90306803-90306825 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100094433 12:91014758-91014780 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1100123040 12:91391473-91391495 CTGAGCAAAATGAACAAAACTGG - Intergenic
1100193334 12:92216663-92216685 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100374288 12:93998489-93998511 CTAAGCAAAAGGAACAAAGTTGG + Intergenic
1100414803 12:94360800-94360822 CTGTGTAAAAAGAACAAAGTTGG + Intronic
1100804811 12:98271710-98271732 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1100948607 12:99818908-99818930 CTGAGCAAAATTAAATAAATTGG + Intronic
1101025757 12:100604041-100604063 CTGAGCAAAAAGAACAAAATTGG - Intronic
1101174290 12:102132595-102132617 TTGAGCAAAATGAACAAAGCTGG - Intronic
1101952515 12:109187759-109187781 CTGTAAAAAAATAACGAAGTTGG - Intronic
1102267375 12:111498765-111498787 CTGAGCAAAATGAACAAAACGGG + Intronic
1103055080 12:117812865-117812887 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1103460523 12:121101059-121101081 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1104515022 12:129417249-129417271 CTATGCAAAAAGAACAAAGCTGG + Intronic
1105318102 13:19287486-19287508 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1105497659 13:20944999-20945021 CTGGGCAAGATTAACCAAGTTGG - Intergenic
1105734932 13:23257988-23258010 CTATGCAAAAAGAACAAAGCTGG - Intronic
1105938577 13:25126307-25126329 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1106073632 13:26438214-26438236 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1107213761 13:37890882-37890904 CTTTGTAAAATTAACAAACCTGG + Intergenic
1107214556 13:37901207-37901229 CTATGCAAAAAGAACAAAGCTGG + Intergenic
1107287940 13:38817260-38817282 CTGTGCAAAAAGAACAAAGCTGG + Intronic
1107379298 13:39838793-39838815 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1107551589 13:41480746-41480768 CTGAGCAAAATGAACAAAACTGG - Intergenic
1107807448 13:44167065-44167087 CTGAGCAAAAAGAACAAAATTGG - Intergenic
1108038577 13:46317902-46317924 CTGAACAAAATGAACAAAGCTGG + Intergenic
1108261663 13:48663282-48663304 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1108566455 13:51703633-51703655 CTGTGAAAAACTATCAAGGTAGG + Exonic
1108673603 13:52716789-52716811 CTATGCAAAAAGAACAAAGCTGG - Intronic
1108720679 13:53128361-53128383 GTGAACAGAATTAACAAAGTGGG - Intergenic
1108815234 13:54282767-54282789 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1108928198 13:55779526-55779548 CTGAGCCAAAATAACAAAGCTGG + Intergenic
1109086863 13:57985232-57985254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1109362400 13:61312386-61312408 CTGAACAAAAGTAACAAAGCTGG - Intergenic
1109675517 13:65671251-65671273 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1109948358 13:69467762-69467784 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1110128947 13:71982404-71982426 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1110398372 13:75059866-75059888 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1110488665 13:76076297-76076319 CTATGCAAAAAGAACAAAGCTGG + Intergenic
1110491623 13:76116703-76116725 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110530739 13:76594768-76594790 CTACGCAAAAAGAACAAAGTTGG + Intergenic
1110531694 13:76605499-76605521 CTAAGCCAAAATAACAAAGTTGG + Intergenic
1110556641 13:76867356-76867378 TTGAGCAAAAAGAACAAAGTTGG - Intergenic
1110629239 13:77687498-77687520 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1110747799 13:79076364-79076386 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110866571 13:80402904-80402926 CTATGCAAAATGAACAAAGTGGG - Intergenic
1110899647 13:80804852-80804874 TTGAGTAAAATGAACAAAGTTGG + Intergenic
1111030813 13:82595800-82595822 CTGAGCAAAAATAAGAAAGCTGG + Intergenic
1111064335 13:83071563-83071585 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1111080182 13:83295230-83295252 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1111359853 13:87162075-87162097 CTATGCAAAAAGAACAAAGATGG + Intergenic
1111486897 13:88914320-88914342 CTGTTAAAAAATAACAAAGCTGG + Intergenic
1111665494 13:91262883-91262905 CTAAGCAAAAATAACAAAGGTGG - Intergenic
1112072948 13:95874854-95874876 CTATGTAAAATCAAAAAAGTAGG - Intronic
1112877435 13:104061642-104061664 CTGTACAAAGTTAAAAAACTTGG + Intergenic
1112970004 13:105249873-105249895 CTGTTTAAAATTTACAATGTAGG - Intergenic
1113283979 13:108826124-108826146 ATGTGAAAAAAGAACAAAGTTGG + Intronic
1113498186 13:110750482-110750504 CTTTTCAAAATTAACATATTTGG + Intergenic
1114373094 14:22111754-22111776 ATGTGTAAAAGTAACATAGTGGG + Intergenic
1114691650 14:24587844-24587866 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1114707221 14:24739272-24739294 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1114869692 14:26641267-26641289 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1114900668 14:27053783-27053805 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1114946496 14:27688312-27688334 CAGTGAAAAATTAACAACATGGG + Intergenic
1115041781 14:28939339-28939361 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1115047330 14:29012259-29012281 CTGAGCAAGATTCACAAAGCAGG + Intergenic
1115077327 14:29407679-29407701 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1115108005 14:29784333-29784355 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1115182477 14:30645276-30645298 CTAAGCAAAAATAACAAAGCTGG - Intronic
1115673360 14:35641798-35641820 CTGAGCAAAATGAACAAAACTGG + Intronic
1116354065 14:43905283-43905305 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1116354465 14:43910922-43910944 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116475712 14:45336312-45336334 CTGAGCAAAAGAAACAAAGCTGG - Intergenic
1116496691 14:45569232-45569254 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1116559765 14:46362941-46362963 CTCTGCCAACTTAACCAAGTTGG - Intergenic
1116560505 14:46373025-46373047 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1116579366 14:46619399-46619421 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116616022 14:47140382-47140404 TTGAGCAAAAACAACAAAGTTGG + Intronic
1117082076 14:52162382-52162404 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1117238413 14:53802873-53802895 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1117648174 14:57874527-57874549 CAGTGCAAAGTTTACAAAGAAGG + Intronic
1117856102 14:60035782-60035804 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1117902278 14:60547392-60547414 CTGTCCTAAAAGAACAAAGTTGG - Intergenic
1117917690 14:60694990-60695012 CTGTGTAAAAAGAACAAAGCTGG - Intergenic
1118043733 14:61944433-61944455 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118479405 14:66148814-66148836 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118523584 14:66616146-66616168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118529522 14:66687289-66687311 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118559470 14:67063373-67063395 CTAAGCAAAAATAACAAAGCTGG - Intronic
1118835293 14:69473636-69473658 CTGTCCAAAAATTACAAAATTGG - Intergenic
1118931190 14:70242568-70242590 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1118957989 14:70500733-70500755 CTAAGCAAAAAGAACAAAGTGGG + Intergenic
1119074720 14:71625094-71625116 CTGTGAAAAATGAACATAATGGG - Intronic
1119079404 14:71677915-71677937 CTATGCAAAAAGAACAAAGCTGG - Intronic
1119312275 14:73658345-73658367 CTGAGCAAAAAGAACAAAATTGG - Intronic
1119875035 14:78051967-78051989 CTAAGCAAAAGCAACAAAGTTGG - Intergenic
1119947486 14:78710350-78710372 CTATGGAATAGTAACAAAGTGGG + Intronic
1120114150 14:80594021-80594043 CTAAGCAAAAAGAACAAAGTGGG + Intronic
1120304696 14:82754235-82754257 CTGAGCATAAGGAACAAAGTTGG + Intergenic
1120394277 14:83948190-83948212 CTGAGCAAAACAAACAAAGCTGG - Intergenic
1120588072 14:86340582-86340604 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1120619277 14:86743258-86743280 CTGAGCAAAAACAACAAAGTTGG - Intergenic
1120945063 14:89986986-89987008 CTTTGCATAATTATCAAAGCAGG + Intronic
1121240872 14:92429086-92429108 TTGTGCAGAAATAAGAAAGTGGG - Intronic
1122148868 14:99712845-99712867 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1123202560 14:106680384-106680406 ATAAGCAAAATTAACAGAGTGGG - Intergenic
1123795367 15:23765507-23765529 CTTTGTAAAACTAACAAATTAGG - Intergenic
1123814128 15:23959588-23959610 CTAAGCAAAATGAACAAAGCCGG - Intergenic
1124682821 15:31750556-31750578 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1124875649 15:33590345-33590367 CTGAGCAAAAATAACAAAGCTGG - Intronic
1124914240 15:33953338-33953360 CTATGCAAAAAGAACAAAGCTGG + Intronic
1124947997 15:34288424-34288446 CTGTGCAAGAAGAACAAAGCTGG - Intronic
1125397233 15:39262474-39262496 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1125449375 15:39792246-39792268 CAGTGCAGAATTAACAAGGAGGG + Intergenic
1126032031 15:44508417-44508439 CAGTAGAAAATAAACAAAGTTGG - Intronic
1126046399 15:44645121-44645143 CTATGCAAAAAGAACAAAGCTGG + Intronic
1126293529 15:47110167-47110189 CTAAGCAAAAAAAACAAAGTTGG - Intergenic
1126714228 15:51497046-51497068 CTGTGGGACATTAAGAAAGTAGG - Intronic
1126770144 15:52048069-52048091 CTGTGGAAAGCTAACAAAGCAGG - Intronic
1126772436 15:52071527-52071549 CTTTGCAAATTACACAAAGTTGG - Intergenic
1126927285 15:53604030-53604052 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1127047347 15:55041136-55041158 CTGAGCAAAAATAAGAAAGCTGG - Intergenic
1127058417 15:55156232-55156254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1127101344 15:55568017-55568039 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1127135795 15:55922343-55922365 ATATGCAAAATAAACAATGTGGG + Intronic
1127163782 15:56221123-56221145 CTAAGCAAAATGAACAAAGCGGG - Intronic
1127180843 15:56415680-56415702 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1127374167 15:58367611-58367633 CTTAGCAAAAAGAACAAAGTTGG + Intronic
1127680346 15:61289595-61289617 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1127730195 15:61793730-61793752 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1127780671 15:62311833-62311855 CTGAGCAAAAATAACAAAACTGG + Intergenic
1128968147 15:72081972-72081994 CTAAGCAAAAACAACAAAGTTGG - Intronic
1129548862 15:76426768-76426790 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG + Intergenic
1130665824 15:85869054-85869076 CTGAGCAAAAAAAACAAAGCTGG - Intergenic
1130687017 15:86047259-86047281 TTGAGCAAAAATAACAAAGGTGG + Intergenic
1130700396 15:86173884-86173906 CTAAGCAAAATGAACAAAGCTGG - Intronic
1131444209 15:92482789-92482811 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1131959865 15:97778230-97778252 CTATGCAAAAAGAACAAAGCTGG + Intergenic
1132037319 15:98495986-98496008 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1132334258 15:101034695-101034717 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1133093234 16:3421845-3421867 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1133844657 16:9442733-9442755 CTGTTGAAAAATATCAAAGTAGG - Intergenic
1134316627 16:13124667-13124689 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1134781314 16:16898602-16898624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1135914384 16:26591950-26591972 CTCTGCAAAATTTCAAAAGTGGG + Intergenic
1136600876 16:31287310-31287332 CTAAGCAAAAATAACAAAGCTGG - Intronic
1136658887 16:31736340-31736362 CTGAGCAAAAGGAACAAAGCAGG - Intronic
1136734176 16:32448268-32448290 GTGAGCAAAAAGAACAAAGTAGG - Intergenic
1137036887 16:35575527-35575549 CTCTGCAAGATTAACCAGGTAGG + Intergenic
1137385368 16:48037094-48037116 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1138300536 16:55924620-55924642 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1138780116 16:59774314-59774336 CTGAACAAGATTAACAAAGCTGG - Intergenic
1139046895 16:63072010-63072032 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1139097566 16:63723316-63723338 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1139381252 16:66532929-66532951 CTGAGCAAAAAAAACAAAGTTGG + Intronic
1140421167 16:74820322-74820344 CTGAGCAAAAGGAACAAAGCTGG - Intergenic
1141043924 16:80698095-80698117 CTGAGCAAAAGAAACAAAGCTGG + Intronic
1143328008 17:6112996-6113018 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1143436235 17:6929031-6929053 CTGAGCAAAAGGAACAAAGCTGG + Intronic
1144163816 17:12587760-12587782 CTGTGGAAAAAAAATAAAGTAGG - Intergenic
1148397396 17:47320688-47320710 TTGAGCAAAAAGAACAAAGTTGG + Intronic
1149187680 17:54018911-54018933 TTGAGCAAAAAGAACAAAGTTGG + Intergenic
1149279553 17:55087682-55087704 CTGAGCAAAAACAACAAAGCTGG - Intronic
1150053564 17:61989807-61989829 TTGAGCAAAAAGAACAAAGTTGG - Intronic
1150151649 17:62814232-62814254 CTGTGCAAAAAGAACAAAGCTGG - Intergenic
1150169941 17:62982903-62982925 CTGAGCAAAAAGAACGAAGTTGG - Intergenic
1150465682 17:65390907-65390929 CTCTGCAAAAATAAAAAAATTGG + Intergenic
1203162681 17_GL000205v2_random:65163-65185 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1153074912 18:1150996-1151018 CTGAGCAAAAATAACAAAACTGG - Intergenic
1153094741 18:1387983-1388005 CTAAGCAAAATGAACAAAGGTGG + Intergenic
1153129252 18:1835518-1835540 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153133046 18:1879661-1879683 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1153274634 18:3355898-3355920 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153361406 18:4201563-4201585 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1153371801 18:4325564-4325586 CTAAGCAAAATAAACAAAGCTGG + Intronic
1153644473 18:7182719-7182741 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153701938 18:7703119-7703141 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1154288756 18:13085835-13085857 CTAGGCAAAATGAACAAAGCTGG - Intronic
1154308670 18:13250258-13250280 CTGAGCAAAAAGAACAAAATTGG - Intronic
1155244045 18:23890415-23890437 CTCAGCAAAATCACCAAAGTAGG - Intronic
1155486557 18:26349754-26349776 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1155769351 18:29677244-29677266 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1156136547 18:34046712-34046734 GTGAGCAGAATTAACAAAATAGG - Intronic
1156606829 18:38676303-38676325 CTCAGCAAAATCAACAAAGAAGG - Intergenic
1156672943 18:39492270-39492292 TTGAGCAAAATGAACAAAGCTGG + Intergenic
1156937261 18:42725322-42725344 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1157059232 18:44267845-44267867 CTGAACAAAAAGAACAAAGTTGG + Intergenic
1157071494 18:44414087-44414109 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1157083909 18:44557577-44557599 CTGTTCAACATTAAAAAATTAGG + Intergenic
1157647777 18:49294257-49294279 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1157668327 18:49506834-49506856 CTGTGCAAAAAGTACAAAGCTGG + Intergenic
1158163349 18:54510911-54510933 CTGAGCAAAAATAACAAAACTGG + Intergenic
1158747852 18:60222158-60222180 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1158853848 18:61522614-61522636 CTAAGCAAAAATAACAAAGCTGG + Intronic
1159086829 18:63802126-63802148 CTTTGCAAAATTATAACAGTAGG - Intronic
1159327772 18:66946374-66946396 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1159376125 18:67595904-67595926 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159416615 18:68157680-68157702 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159485213 18:69047037-69047059 CTAAGCAAAAATAACAAAGCTGG - Intronic
1159545272 18:69833113-69833135 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1160085796 18:75776589-75776611 CTGTGCAATGTTCACTAAGTAGG + Intergenic
1160184517 18:76664828-76664850 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1161506956 19:4649228-4649250 CTGTGCAAAAAAAAAAAAGCTGG - Intronic
1162214359 19:9120695-9120717 CTATGCAAAAGGAACAAAGCTGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164271731 19:23678633-23678655 CTAAGCAAAAATAACAAAGCTGG + Intronic
1164414770 19:28037947-28037969 CTTTGCAAAACAAACCAAGTGGG + Intergenic
1165250473 19:34529263-34529285 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1165260314 19:34609763-34609785 CTGAGAAAAATGAAAAAAGTTGG - Intronic
1165566878 19:36737527-36737549 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1166026223 19:40087708-40087730 TTGAGCAAAAGGAACAAAGTTGG + Intronic
1166263613 19:41661790-41661812 CTAAGCAAAATGAACAAAGCTGG + Intronic
1166399177 19:42465451-42465473 CTCTGTAAAATTAACAATGTAGG + Intergenic
1166622801 19:44318087-44318109 CTGAGCAAAAGTAAGAAAGCTGG - Intergenic
1167519267 19:49943247-49943269 CTGGGCAAAAAGAACAAAGCTGG + Intronic
1167763888 19:51467431-51467453 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1167860498 19:52279315-52279337 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1168169962 19:54579550-54579572 CTAAGCAAAAAGAACAAAGTTGG - Intronic
924994993 2:351501-351523 TTGAGCAAAAAGAACAAAGTTGG + Intergenic
925271395 2:2611449-2611471 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
925904510 2:8531789-8531811 CTCTTGAAAATAAACAAAGTAGG + Intergenic
926101074 2:10118445-10118467 CTGTGCTACATTAAGAATGTTGG + Intergenic
926348417 2:11971093-11971115 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
926546484 2:14247280-14247302 CTAAGCAAAAATAACAAAGCTGG + Intergenic
926964341 2:18393513-18393535 CTAAGCAAAAATAACAAAGCAGG + Intergenic
927015443 2:18955211-18955233 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
927165177 2:20312768-20312790 CTAAGCAAAAAGAACAAAGTTGG + Intronic
928083538 2:28330886-28330908 CTAAGCAAAAAGAACAAAGTTGG + Intronic
928384647 2:30856372-30856394 CTGAGCAAAAATAACAAAACTGG + Intergenic
928475753 2:31625802-31625824 CTAAGCAAAAATAACAAAGCTGG - Intergenic
928491610 2:31789921-31789943 CTGAGCAAAACTAACAAAACTGG + Intergenic
928679398 2:33684159-33684181 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
928726776 2:34183311-34183333 CTAAGCAAAAATAACAAAGCTGG - Intergenic
928799696 2:35072499-35072521 CTAAGCAAAATAAACATAGTTGG + Intergenic
928802763 2:35114730-35114752 TTGAGCAAAAGCAACAAAGTTGG + Intergenic
928940257 2:36720191-36720213 CTGAGCAAAAAGAACAAAGGTGG + Intronic
929348022 2:40910790-40910812 CTCAGCAAAAATAACAAAGTTGG - Intergenic
929385127 2:41397367-41397389 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
929734834 2:44536713-44536735 CTGAGCAAAAAGAACAAAGCTGG + Intronic
930292997 2:49519153-49519175 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
930477153 2:51896016-51896038 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
930623190 2:53666220-53666242 CTAAGCAAAAAGAACAAAGTTGG + Intronic
930770353 2:55124763-55124785 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
930861668 2:56080650-56080672 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
931217043 2:60255480-60255502 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
931539787 2:63317464-63317486 CTAAGCAAAAAGAACAAAGTTGG + Intronic
931567072 2:63625887-63625909 CTAAGCAAAAATAACAAAGCTGG + Intronic
932101490 2:68904549-68904571 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
932913199 2:75826963-75826985 CTGAGCGAAAAGAACAAAGTTGG + Intergenic
932935914 2:76100847-76100869 CTAAGCAAAAAAAACAAAGTTGG + Intergenic
933001852 2:76935293-76935315 CTAAGCAAAAATAACAAAGCTGG - Intronic
933031831 2:77337804-77337826 CTAAGCAAAAAGAACAAAGTCGG + Intronic
933068266 2:77826240-77826262 CTGAGCAAAAAGAACAAATTTGG - Intergenic
933084096 2:78033067-78033089 CTGGGCAAAATTTTCAAAGGAGG - Intergenic
933132092 2:78684182-78684204 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
933319578 2:80757065-80757087 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
933521741 2:83382509-83382531 CTAAGCAAAATGAACAAAGCTGG + Intergenic
933873249 2:86590954-86590976 CTAAGCAAAAATAACAAAGCTGG - Intronic
934311557 2:91871178-91871200 GTGAGCAAAAAGAACAAAGTAGG + Intergenic
934996804 2:98969849-98969871 CCGAGCAAAAATAACAAAGCTGG - Intergenic
935004129 2:99054076-99054098 TTGAGCAAAAAGAACAAAGTTGG + Intronic
935092043 2:99904809-99904831 CTCTGCAAAACTAACATAGGTGG + Intronic
935288226 2:101585218-101585240 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
935290402 2:101605651-101605673 CTGAGCAAAATCAACAAAGTTGG + Intergenic
935531928 2:104244088-104244110 CTGAGCAAAAAGAACAAAGTGGG + Intergenic
935777006 2:106482497-106482519 ATGTGGAAAAATAAAAAAGTGGG + Intergenic
936274931 2:111087352-111087374 CTAAGCAAAAGGAACAAAGTTGG + Intronic
936510908 2:113145536-113145558 CTGTGCAAAAAGAACAAAACTGG - Intergenic
937017412 2:118618725-118618747 CTGTGCAAAGGTAAGAAAGGAGG - Intergenic
937585336 2:123540779-123540801 CTAAGCAAAAATAACAAAGTCGG - Intergenic
937586234 2:123553928-123553950 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
937735783 2:125287115-125287137 ATGTGCAAAATTAAAATAGCAGG + Intergenic
937739839 2:125337879-125337901 ATGTACAACATTAACAAAATGGG + Intergenic
937889216 2:126923871-126923893 CTGAGCAAAAATATCAAAGCTGG - Intergenic
938136408 2:128761630-128761652 CTAAGCAAAAATAACAAAGCTGG - Intergenic
938167741 2:129046142-129046164 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
938575722 2:132602093-132602115 CTGAGCAAAAATAACAGAGCAGG + Intronic
939058330 2:137389990-137390012 CTGAGCAAAAAGAACAAAGCTGG - Intronic
939224505 2:139347869-139347891 CTAAGCAAAAATAACAAAGCTGG - Intergenic
939391564 2:141575160-141575182 CTAAGCAAAAAGAACAAAGTTGG + Intronic
940271408 2:151895151-151895173 CTGAGCAAAACGAACAAAGCTGG + Intronic
940425779 2:153530570-153530592 CTGAGCAAAAATAACAAAACTGG + Intergenic
940456549 2:153908831-153908853 CTCAGCAAAAAGAACAAAGTTGG - Intronic
940506555 2:154561693-154561715 CTGAGAAAAATGAACAAAGCTGG - Intergenic
940684667 2:156831851-156831873 CTGAACAAAAAGAACAAAGTTGG + Intergenic
940716302 2:157228647-157228669 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
940760192 2:157730338-157730360 CTAAGCAAAAATAACAAAGCTGG + Intergenic
941117174 2:161485604-161485626 CTGAGCAAAATAAACAAAGCTGG + Intronic
941196142 2:162454392-162454414 CTAAGCAAAAATAACAAAGCTGG - Intronic
941238896 2:163012553-163012575 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
941622927 2:167798724-167798746 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
941750022 2:169125577-169125599 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
942010403 2:171756677-171756699 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
942216568 2:173726376-173726398 CTTAGCAAAAAGAACAAAGTTGG + Intergenic
942467074 2:176219592-176219614 CTAAGCAAAAATAACAAAGCTGG - Intergenic
942586641 2:177486704-177486726 CTGTTCACAAATAGCAAAGTGGG + Intronic
942652694 2:178185006-178185028 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
942817302 2:180066976-180066998 CTCTGAAAAATTGACAGAGTGGG + Intergenic
942825774 2:180173934-180173956 CTGAGCAAAATAAACAGAGCTGG + Intergenic
942924498 2:181415829-181415851 CTAAGCAAAATGAACAAAGCTGG + Intergenic
942927671 2:181453544-181453566 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
942977892 2:182041092-182041114 CTATGCAAAATGAACAAATCTGG - Intronic
943073426 2:183168312-183168334 CTAAGCAAAATGAACAAAGCTGG - Intergenic
943164808 2:184307670-184307692 CTAAGCAAAATGAACAAAGCTGG - Intergenic
943245605 2:185446607-185446629 CTATGCAAAATGAACAAAGTTGG + Intergenic
943357697 2:186878015-186878037 TTGAGCAAAAAGAACAAAGTTGG - Intergenic
943629888 2:190239407-190239429 CTAAGCAAAAAGAACAAAGTTGG - Intronic
943667333 2:190623367-190623389 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
943714689 2:191137567-191137589 CTGAGCAAAAAGAACAAAGCTGG + Intronic
943920863 2:193706345-193706367 CTGTGCCAAAAGAACAAAGCTGG - Intergenic
944008451 2:194941174-194941196 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
944098490 2:195995833-195995855 TTGAGCAAAAAGAACAAAGTTGG - Intronic
944159988 2:196649076-196649098 TTGAGCAAAAATAACAAAGGTGG - Intronic
944178482 2:196860887-196860909 CTGAGCAAAAAGAACAAAGCTGG + Intronic
944261575 2:197683591-197683613 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
944519527 2:200550400-200550422 TTGAGCAAAATGAACAAAGCTGG + Intronic
944569580 2:201030143-201030165 CTTTCCAAAATAAACAAAATTGG + Intronic
944913022 2:204328675-204328697 CTGTGCCAAATTAACAGTGAAGG - Intergenic
944994891 2:205282791-205282813 CAGTGAAAAATTAGCAAACTGGG + Intronic
945176860 2:207052002-207052024 CTGTGCAAGATTAAAAATGCAGG + Intergenic
945211145 2:207383604-207383626 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
945520419 2:210820715-210820737 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
945563157 2:211363266-211363288 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
945626416 2:212212617-212212639 CTATGCAAAAAGAACAAAGCTGG + Intronic
945667574 2:212761322-212761344 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
945845499 2:214939404-214939426 CTGAGCAAAAAGAACAAAGCTGG - Intronic
946874891 2:224118633-224118655 CTATGCAAAAATAACAAATCTGG + Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947040629 2:225915206-225915228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
947123551 2:226842727-226842749 CTTAGCAAAAAGAACAAAGTTGG - Intronic
947192677 2:227524877-227524899 ATGTGCAAAGTTAGCAAAATTGG - Exonic
947193901 2:227541637-227541659 CTAAGCAAAAAGAACAAAGTTGG - Intronic
947200898 2:227613635-227613657 CTATGAAAAATTAGCAAAATGGG + Intronic
948245134 2:236476016-236476038 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1168741632 20:196781-196803 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1169695256 20:8380388-8380410 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1169980891 20:11382758-11382780 TTTTGAAAAATTAACAAAATAGG + Intergenic
1169987770 20:11464986-11465008 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1169989083 20:11480179-11480201 CTGAGCAAAAATAACAAAACTGG + Intergenic
1170197629 20:13706286-13706308 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1170384568 20:15801642-15801664 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1170826813 20:19803292-19803314 GTGTGCAAAAAGAACAAAGCTGG + Intergenic
1170996891 20:21370296-21370318 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1171194005 20:23182711-23182733 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1171535841 20:25888449-25888471 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1171572018 20:26261453-26261475 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1171805248 20:29672733-29672755 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1171838809 20:30183700-30183722 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1172164131 20:32888520-32888542 CTCTACAAAATTAACAAAAAAGG - Intronic
1172396583 20:34610755-34610777 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1173141565 20:40489430-40489452 CTGTGCCAATTTAGCAAAGATGG - Intergenic
1173390118 20:42624157-42624179 CTGTGCAAATTTCACAGAGCAGG - Intronic
1173780812 20:45755731-45755753 CTGGGCAAAAACAACAAAGCTGG + Intronic
1174413021 20:50348296-50348318 TTGTGCAAAATGAGCAAAATAGG - Intergenic
1174695793 20:52556375-52556397 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1175438138 20:58969559-58969581 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1176773835 21:13110442-13110464 TTCTGAAAAATTAACAAAGAAGG + Intergenic
1176876424 21:14134491-14134513 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1177022589 21:15881817-15881839 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1177040143 21:16098205-16098227 CTGGGCAAAATTCAAAATGTTGG - Intergenic
1177042254 21:16128643-16128665 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1177240701 21:18453107-18453129 CATTGCAAAATTAAAAATGTGGG - Intronic
1177313623 21:19428855-19428877 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1177379104 21:20314953-20314975 CTGAGCAAAAATTACAAAGCTGG - Intergenic
1177541421 21:22498182-22498204 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1177709075 21:24747360-24747382 CTAGGCAAAATGAACAAAATGGG + Intergenic
1177764189 21:25438171-25438193 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1177768323 21:25485031-25485053 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1178113454 21:29393419-29393441 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1179196375 21:39167043-39167065 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1179237145 21:39557837-39557859 ATGTTCCAAATTAACAAAATGGG + Intronic
1179473668 21:41629541-41629563 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1180123874 21:45773679-45773701 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1180192995 21:46176831-46176853 CTAAGCAAAAATAACAAAGCTGG + Intronic
1180538306 22:16416975-16416997 GTGAGCAAAAAGAACAAAGTAGG + Intergenic
1180599352 22:17005551-17005573 CTAAGCAAAAATAACAAAGCTGG + Intronic
1181137317 22:20777516-20777538 CTGTGAAAAATTAAATAAATAGG - Intronic
1181912475 22:26250603-26250625 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1181915464 22:26276264-26276286 CTGTCCAAACTTTACAAAGCAGG + Intronic
1182402681 22:30092929-30092951 CTGAGCAAAAAGAACAAAGTTGG - Intronic
1182638513 22:31748860-31748882 CTTTCCCAAATTAACAAAGAGGG - Intronic
1183024800 22:35057078-35057100 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1183132456 22:35851900-35851922 CTGTTAAGAATTGACAAAGTAGG - Intronic
949297957 3:2548616-2548638 CTAAGCAAAATGAACAAAGCTGG - Intronic
949304990 3:2629624-2629646 CTGTGGAAAACTAAGAAAGCTGG - Intronic
949385111 3:3492802-3492824 CTGAGCAAAATGAACAAAGCTGG + Intergenic
950323288 3:12078745-12078767 CTAAGCAAAAAGAACAAAGTTGG - Intronic
950350850 3:12350574-12350596 CTGTGCCAAATTACCGATGTGGG - Intronic
950953934 3:17030458-17030480 CTCTGTATAAATAACAAAGTGGG - Intronic
951124885 3:18971732-18971754 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
951320986 3:21245029-21245051 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
951618181 3:24571460-24571482 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
951653313 3:24977202-24977224 CTGAGCAAAAGGAACAAAGCTGG - Intergenic
951654891 3:24994931-24994953 CTGAGCAAAAACAACAAAGCTGG - Intergenic
951687181 3:25357949-25357971 CTAAGCAAAAATAACAAAGCTGG - Intronic
951864844 3:27296568-27296590 CTCTGTAAAATTCACTAAGTAGG + Intronic
952129959 3:30350037-30350059 CTGTGCAAATTTAGCTAAGCAGG + Intergenic
952514114 3:34086779-34086801 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
952629130 3:35443412-35443434 CTGTGCAAAATGAACTGGGTAGG + Intergenic
953013042 3:39046565-39046587 CTGAGCAAAAAGAACAAAATTGG + Intergenic
953113629 3:39968764-39968786 CTAAGCAAAATGAACAAAGCTGG - Intronic
953267498 3:41406409-41406431 CTAAGCAAAATGAACAAAGCTGG - Intronic
953541185 3:43819975-43819997 CTAAGCAAAAGTAACAAAGCTGG - Intergenic
953806386 3:46072820-46072842 CTAAGCAAAATGAACAAAGCTGG + Intergenic
954584990 3:51725762-51725784 TTGAGCAAAAATAACAAAGCTGG - Intergenic
954949334 3:54455991-54456013 CTGAGCAAAAAGAACAAAGCTGG - Intronic
955520854 3:59774072-59774094 CTGTCCAAAATAAACATAATGGG - Intronic
955617058 3:60820592-60820614 TTATGCAAAATTTGCAAAGTTGG - Intronic
955847079 3:63176505-63176527 ATGAGCAAAAATAACAAAGCTGG + Intergenic
956806350 3:72816992-72817014 CTCTGCAAAAATAGCAGAGTAGG - Intronic
956905374 3:73760018-73760040 ACGTGCAAAATGAACAAAATCGG + Intergenic
957438181 3:80207078-80207100 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
957681117 3:83437009-83437031 GTGTGAAAAATTAATAAGGTAGG - Intergenic
957700308 3:83701682-83701704 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
957890369 3:86349621-86349643 TTGTGCAAAAAGAACAAAGCTGG - Intergenic
958051803 3:88357519-88357541 TTGAGCAAAAGGAACAAAGTTGG - Intergenic
958156011 3:89756736-89756758 CTAAGCAAAATGAACAAAGCTGG + Intergenic
958164886 3:89867932-89867954 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
958447789 3:94236462-94236484 CTAAGCAAAATGAACAAAGCTGG - Intergenic
958463035 3:94422983-94423005 CTAAGCAAAATCAACAAAGCTGG + Intergenic
958589005 3:96129634-96129656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
958589682 3:96139749-96139771 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
958774027 3:98459575-98459597 CTAAGCAAAAATAACAAAGCTGG - Intergenic
959191493 3:103118008-103118030 CTGAGCAAAATTAACAAAACTGG + Intergenic
959271910 3:104222181-104222203 CTAAGCAAAATGAACAAAGCTGG - Intergenic
959559502 3:107763369-107763391 CAGTGGAAAAATAACAAATTAGG - Intronic
959601741 3:108194539-108194561 CTGAGCAAAAAGAACAAAGCTGG + Intronic
959828578 3:110832284-110832306 CTAAGCAAAAATAACAAAGCTGG - Intergenic
960135186 3:114097508-114097530 CTTTGCAAAATTATGACAGTGGG - Intergenic
960159635 3:114336067-114336089 TTGTTCAAATTTAGCAAAGTAGG - Intergenic
960218336 3:115071514-115071536 CTTTACAAACTAAACAAAGTAGG + Intronic
960346826 3:116543305-116543327 CTAAGCAAAATGAACAAAGCTGG + Intronic
960353657 3:116624183-116624205 CTGAGCAAAAAGAACTAAGTTGG - Intronic
960493409 3:118346254-118346276 TTGAGCAAAATGAACAAAGCTGG - Intergenic
960531972 3:118775099-118775121 CTAAGCAAAAATAACAAAGCTGG + Intergenic
960751768 3:120962718-120962740 CTAAGCAAAATGAACAAAGCTGG - Intronic
960792103 3:121444026-121444048 CTGTGCAAAAAGAACAAAACTGG - Intronic
960831299 3:121851580-121851602 CAGTGGCAAATTAAGAAAGTTGG + Intronic
961150555 3:124634160-124634182 GTGTGCAGAATTCTCAAAGTGGG + Intronic
961850716 3:129815303-129815325 CTGAGCAAAAAGAACAAAATGGG + Intronic
962496066 3:135940051-135940073 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
962734412 3:138312318-138312340 CTGAGCAAAAATAACAAACCTGG + Intronic
962823481 3:139076002-139076024 CTGAGCAAAAAGAACAAAGTTGG + Intronic
963033816 3:141006797-141006819 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
963403549 3:144834254-144834276 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
963413140 3:144957876-144957898 CTGAGTCAAATTAACACAGTAGG + Intergenic
963493434 3:146030046-146030068 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
964051766 3:152402404-152402426 CTGTTCATAAATATCAAAGTTGG + Intronic
964114604 3:153122646-153122668 CTAAGCAAAAAGAACAAAGTCGG - Intergenic
964148174 3:153491542-153491564 CTGAGCAAAAAGAACAAAGCTGG + Intronic
964153770 3:153560651-153560673 CTAAGCAAAAATAACAAAGCTGG + Intergenic
964154610 3:153569855-153569877 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
964456249 3:156870146-156870168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
964501211 3:157350069-157350091 CTGGGCAAAAAGAACAAAGCTGG + Intronic
964513657 3:157481492-157481514 CTAAGCAAAAAGAACAAAGTTGG + Intronic
964900367 3:161651967-161651989 CTGTGAAAAATGGACAAATTTGG + Intergenic
965110199 3:164411195-164411217 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
965157739 3:165086566-165086588 CTGCACAAAATTTAGAAAGTTGG + Intergenic
965274225 3:166660050-166660072 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
965310617 3:167123593-167123615 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
965452205 3:168852045-168852067 CTGAGCAAAAGGAACAAAGGAGG - Intergenic
965871682 3:173272623-173272645 CTCTGCAAAAAGAACAAAGCTGG - Intergenic
966199794 3:177350081-177350103 TTGAGCAATAATAACAAAGTTGG - Intergenic
966374661 3:179283838-179283860 CTGAGCAAAAAGAACAAAATGGG + Intergenic
966664593 3:182457056-182457078 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
966972492 3:185057930-185057952 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
967524757 3:190478324-190478346 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
967944328 3:194790958-194790980 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
968072204 3:195791693-195791715 CTAAGCAAAAAGAACAAAGTGGG + Intronic
969165702 4:5309436-5309458 CTGAGCAAAAAGAACAAGGTTGG + Intronic
969851570 4:9961269-9961291 CTAAGCAAAAATAACAAAGCTGG + Intronic
970209275 4:13690845-13690867 CTAAGCAAAAATAACAAAGCTGG - Intergenic
970305099 4:14723385-14723407 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
970416115 4:15858624-15858646 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
970749347 4:19338734-19338756 CTAAGCAAAATGAACAAAGCTGG - Intergenic
970810021 4:20081455-20081477 CTAAGCAAAATGAACAAAGCTGG - Intergenic
971723283 4:30274554-30274576 CTAAGCAAAATGAACAAAGCTGG + Intergenic
971772889 4:30921605-30921627 CTCTGCAAAATTAATCAAGAGGG - Intronic
971844466 4:31900721-31900743 CTGTGTGAAATTAACAAATGTGG - Intergenic
971925521 4:33004791-33004813 CTAAGCAAAAATAACAAAGCAGG + Intergenic
972140614 4:35954756-35954778 CTGTGCAAAAATAACAAAGGTGG - Intronic
972837031 4:42883920-42883942 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
973008250 4:45040920-45040942 CTATGGAAAATTAATAATGTGGG + Intergenic
973010020 4:45061287-45061309 CTAAGCAAAATGAACAAAGCTGG + Intergenic
973078801 4:45963658-45963680 CTAAGCAAAATGAACAAAGCTGG - Intergenic
973585511 4:52386541-52386563 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
973659224 4:53085584-53085606 CTGTGCAAAAATAACAAAACTGG + Intronic
974527757 4:63066018-63066040 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
974531722 4:63116585-63116607 CTAAGCAAAATGAACAAAGCTGG - Intergenic
974597638 4:64035982-64036004 CTAAGCAAAATTAACAAAGCTGG + Intergenic
974598454 4:64043841-64043863 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
974629322 4:64462891-64462913 CTAAGCAAAAATAACAAACTTGG + Intergenic
974769073 4:66387276-66387298 CTAAGCAAAATGAACAAAGTTGG + Intergenic
974876226 4:67706428-67706450 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
974918500 4:68206871-68206893 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
974953411 4:68608462-68608484 CTAAGCAAAAATAACAAAGCTGG - Intronic
975030871 4:69614521-69614543 CTGAGCAAAAAGAACAAAGTTGG + Intronic
975304507 4:72833709-72833731 CCAAGCAAAATGAACAAAGTTGG - Intergenic
975410840 4:74047408-74047430 CTGAACAAAAAGAACAAAGTAGG - Intergenic
975845402 4:78519913-78519935 CTTTGCCAAATGAATAAAGTGGG - Intronic
976024293 4:80668743-80668765 CTGAGCAAAAAGAACAAAGCTGG - Intronic
976136402 4:81941796-81941818 CTGACCAAAAATAACAAAGCTGG + Intronic
976665931 4:87591821-87591843 CTGAGCAAAAGGAACAAAGCTGG + Intergenic
976716438 4:88127472-88127494 CTATGCAAAAAGAACAAAGCTGG + Intronic
976878429 4:89887348-89887370 CTAAGCAAAAAGAACAAAGTTGG + Intronic
976926587 4:90505334-90505356 CTGTCCAAAATAAAGAATGTAGG + Intronic
976943343 4:90733965-90733987 CTGAGCAAAAAGAACAAAATTGG - Intronic
977060349 4:92251476-92251498 CTATGCAAAAAGAACAAAGCTGG - Intergenic
977227969 4:94416009-94416031 CTAAGCAAAAATAACAAAGCTGG - Intergenic
977385924 4:96339077-96339099 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
977428412 4:96900101-96900123 CTAAGCAAAATGAACAAAGCTGG + Intergenic
977538202 4:98281051-98281073 CTATGCAAAAAGAACAAAGCTGG - Intronic
977605172 4:98977234-98977256 CTATGAAAAATAAACAAAATTGG + Intergenic
977696989 4:99976539-99976561 CTAAGCAAAAATAACAAAGCAGG + Intergenic
977888302 4:102277685-102277707 CTAAGCAAAAAGAACAAAGTTGG + Intronic
977896649 4:102372984-102373006 CTAAGCAAAAATAACAAAGCTGG - Intronic
978020162 4:103799016-103799038 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978047293 4:104146100-104146122 CTGAGCAAAAATAACAAAGCTGG - Intergenic
978137836 4:105284209-105284231 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978252163 4:106644514-106644536 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978422730 4:108551090-108551112 CTGAGCAAAATGAACAAAGCTGG + Intergenic
978635180 4:110795936-110795958 CTATGTAAAACTAAGAAAGTGGG + Intergenic
979003425 4:115257506-115257528 CTAAGCAAAATGAACAAATTCGG + Intergenic
979050541 4:115925252-115925274 CTGAGCAAAAATAACAAAGCGGG + Intergenic
979180777 4:117723571-117723593 CTGAGAAAAATGAACAAAATCGG + Intergenic
979471391 4:121101757-121101779 TTGAGCAAAAAGAACAAAGTTGG - Intergenic
979528957 4:121748021-121748043 CTGCACAAAATTAATAAATTTGG + Intergenic
979662739 4:123276922-123276944 CTAAGCAAACTGAACAAAGTTGG - Intronic
980151233 4:129051166-129051188 CTAAGCAAAAAGAACAAAGTTGG - Intronic
980432573 4:132723258-132723280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
980548767 4:134305281-134305303 CTATGCAAAAAGTACAAAGTTGG + Intergenic
980767775 4:137330161-137330183 ATGAACAAAATTAAGAAAGTGGG - Intergenic
980772998 4:137402887-137402909 TTGGGAAAAATGAACAAAGTAGG + Intergenic
980799326 4:137728709-137728731 CTGTGCAAAAGGAACAAAACTGG - Intergenic
980808079 4:137839034-137839056 CTGAGCAAAATGAACAAAGCTGG + Intergenic
980882766 4:138729935-138729957 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
981180706 4:141740632-141740654 TTGTGCAAAAAGAACAAAGTTGG + Intergenic
981290275 4:143067068-143067090 CTAAGCAAAAGGAACAAAGTTGG - Intergenic
981388565 4:144160224-144160246 CTAAGCAAAATGAACAAAGCTGG - Intergenic
981459776 4:144999752-144999774 CTACGCAAAAAGAACAAAGTTGG + Intronic
981751761 4:148099184-148099206 CTGTGCAAAATGAACATAAGGGG + Intronic
981794501 4:148580935-148580957 CTAAGCAAAATGAACAAAGCTGG - Intergenic
982050302 4:151494611-151494633 CTAAGCAAAAAGAACAAAGTTGG - Intronic
982347921 4:154381984-154382006 CTAAGCAAAAAGAACAAAGTTGG + Intronic
982463572 4:155702159-155702181 TTATGAAAAATTTACAAAGTTGG + Intronic
982499513 4:156135574-156135596 CTGAGCAAAATGAACAAAGCTGG + Intergenic
982674272 4:158357926-158357948 CTGAGCAAAAAGAACAAAGCTGG + Intronic
983046855 4:162997650-162997672 ATATGCAATATTAACAAACTTGG - Intergenic
983130273 4:164010814-164010836 CAGAGCAAAAATAACAAACTTGG + Intronic
983333977 4:166368593-166368615 TTGAGCAAAAAGAACAAAGTAGG - Intergenic
983612971 4:169670556-169670578 CTAAGCAAAAATAACAAAGCTGG - Intronic
983788471 4:171763620-171763642 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
983842782 4:172478217-172478239 CTAAGCAAAAAGAACAAAGTTGG + Intronic
983862857 4:172729675-172729697 CTGTGCAAAATTAACAAAGTTGG - Intronic
983879482 4:172916947-172916969 CTGAGCAAAAAGAACAAAGCTGG + Intronic
984179154 4:176460317-176460339 CTGAAGAAAATGAACAAAGTTGG + Intergenic
984542213 4:181053426-181053448 CTAAGCAAAACTAACAAAGCCGG + Intergenic
985151503 4:186951862-186951884 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
985300481 4:188483142-188483164 CTAAGCAAAAATAACAAAGCTGG - Intergenic
985831211 5:2232854-2232876 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
986011521 5:3720591-3720613 CTAAGCAAAAATAACAAAGCTGG - Intergenic
986113391 5:4743717-4743739 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
986549048 5:8932475-8932497 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
986748943 5:10767880-10767902 ATGAGCAAAATTAACAATGGAGG - Intergenic
986915795 5:12618445-12618467 CTATGCAAAAAGAACAAAGTTGG - Intergenic
986951544 5:13092512-13092534 TTGAGCAAAATAAACAAAGCTGG + Intergenic
987226160 5:15844085-15844107 CTGTGCTAAATTGCCACAGTTGG - Intronic
987260832 5:16201119-16201141 CTAAGCAAAAATAACAAAGCTGG + Intergenic
987395332 5:17417680-17417702 CTAAGCAAAATGAACAAAGCTGG - Intergenic
987631855 5:20483468-20483490 CTGAGCAAAATGAACAAAATTGG + Intronic
987832253 5:23110133-23110155 CTGAGCAAAAGTAACAAAATTGG + Intergenic
988172680 5:27680084-27680106 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
988186228 5:27866576-27866598 CTATGCAAAAGGAACAAAGCTGG + Intergenic
988195697 5:28002701-28002723 CTGCGCAAAAAGAACAAAGCTGG - Intergenic
988323623 5:29733654-29733676 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
988368411 5:30333462-30333484 CTGAGCAAAATAAACAAAGCTGG + Intergenic
988425727 5:31061523-31061545 CTGTGCAGAATAATCAAAGTAGG - Intergenic
988971701 5:36474996-36475018 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
989008401 5:36841324-36841346 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
989364349 5:40638962-40638984 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
989707102 5:44347680-44347702 CTGTGCTAAAATTGCAAAGTAGG - Intronic
989991566 5:50773598-50773620 CTGAGCAAAAAGAACAAAGCTGG - Intronic
990289811 5:54338321-54338343 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
990615392 5:57502440-57502462 TTGTGCAAAATTGAAAAAGGGGG + Intergenic
990619559 5:57545098-57545120 CTAAGCAAAATGAACAAAGCTGG - Intergenic
990975212 5:61554558-61554580 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991026241 5:62033112-62033134 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
991158254 5:63463902-63463924 CTAAGCAAAAATAACGAAGTTGG + Intergenic
991177030 5:63701017-63701039 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
991394811 5:66193098-66193120 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991627177 5:68615466-68615488 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
991877173 5:71183537-71183559 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
991926823 5:71713790-71713812 CGGTGCAAAATTAAGAAATAAGG + Intergenic
992121095 5:73593344-73593366 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
992195357 5:74333842-74333864 TTGTGAAAAATTAAAGAAGTGGG + Intergenic
992310051 5:75488676-75488698 CTTTACAAAATTAAGAAAGAAGG - Intronic
992355753 5:75981417-75981439 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
993208115 5:84910966-84910988 CTAAGCAAAAATAACAAATTTGG + Intergenic
993228422 5:85201051-85201073 CTGAGCAAAATGATCAAAGCTGG - Intergenic
993345718 5:86779732-86779754 CTGAGCAAAAGGAACAAAGCTGG - Intergenic
993375531 5:87145615-87145637 CTATGGAAAAATAACAAAGCTGG - Intergenic
993400187 5:87439747-87439769 CTGAGCAAAAATAACAGAGCTGG - Intergenic
993577513 5:89620754-89620776 CTAAGCAAAAATAACAAAGCTGG - Intergenic
993673006 5:90784969-90784991 CTAAGCAAAAATAACAAAGCTGG + Intronic
993734781 5:91463677-91463699 CTAAGCAAAATGAACAAAGCTGG + Intergenic
993773191 5:91957465-91957487 CTGTGTAAGATTAACAATTTAGG + Intergenic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
994015472 5:94959969-94959991 CTAAGCAAAAATAACAAAGCTGG + Intronic
994053261 5:95386483-95386505 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
994068855 5:95575286-95575308 CTGAGCAAAAAGAACAAAATTGG - Intronic
994228989 5:97291174-97291196 CTGAGCAAAATGAACAAAGCTGG - Intergenic
994416678 5:99480917-99480939 CTCTGCAAAATTGGCATAGTAGG + Intergenic
994422957 5:99545186-99545208 CTGAGCAAAACTAACAAAGCTGG - Intergenic
994463295 5:100094243-100094265 CTCTGCAAAATTGGCATAGTAGG - Intergenic
994598101 5:101864956-101864978 CTATGCAAAAAGAACAAAGCTGG + Intergenic
994610892 5:102037977-102037999 ATGTGCATAATTAACAAAACTGG - Intergenic
994650866 5:102525574-102525596 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
994743442 5:103649283-103649305 CTGTGAAAAATTACCATTGTAGG + Intergenic
994850614 5:105050671-105050693 CTATGCAAAAAGAACAAAGCTGG - Intergenic
994861757 5:105204498-105204520 CTGAGCAAATTTTACAAATTAGG + Intergenic
995050061 5:107693208-107693230 CTGAGCAAAAAGAACAAAATGGG + Intergenic
995093498 5:108208752-108208774 CTGTGCAAGAAGAACAAAGCTGG - Intronic
995134016 5:108660849-108660871 CTGTAGCAAATGAACAAAGTAGG - Intergenic
995188396 5:109295227-109295249 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
995317272 5:110789610-110789632 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
995398277 5:111712646-111712668 CTAAGCAAAAAGAACAAAGTTGG - Intronic
995472131 5:112513831-112513853 ATGTCCAGAATTAAGAAAGTCGG + Intergenic
995535727 5:113134511-113134533 CTGAGCAAAAAGAACAAAGCTGG - Intronic
995812408 5:116122423-116122445 CTGAGCAAAAAGAACAAAGCTGG - Intronic
995951010 5:117713919-117713941 CTAAGCAAAAATAACAAAGCTGG + Intergenic
995965331 5:117899879-117899901 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
996095477 5:119394476-119394498 CTGTGTATAAATAATAAAGTAGG + Intronic
996146777 5:119986594-119986616 CTGGGCAAGAAGAACAAAGTTGG - Intergenic
996245510 5:121259113-121259135 CTAGGCAAAAATAACAAAGCTGG - Intergenic
996248513 5:121296761-121296783 CTCTGCAAAATTAAAAAAAGAGG + Intergenic
996271209 5:121606847-121606869 CTATGCAAAAAGAACAAAGCTGG + Intergenic
996296284 5:121921195-121921217 CTAAGCAAAAACAACAAAGTTGG + Intergenic
996427126 5:123326061-123326083 CTATGCAAAAAGAACAAATTTGG - Intergenic
996468377 5:123830253-123830275 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996481812 5:123984164-123984186 CTAAGCAAAAATAACAAAGCTGG - Intergenic
996521535 5:124432264-124432286 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996608177 5:125348340-125348362 CAGTTCAAAATGAACAAATTAGG - Intergenic
996679708 5:126218588-126218610 CTAAGCAAAAAGAACAAAGTGGG + Intergenic
996953778 5:129159325-129159347 CTAAGCAAAAATAACAAAGCTGG - Intergenic
997026718 5:130072602-130072624 TTGAGCAAAAATAACAAAGCTGG - Intronic
997040494 5:130247433-130247455 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
997070117 5:130611704-130611726 CTAAGCAAAATGAACAAAGCTGG + Intergenic
997108423 5:131047273-131047295 CTAAGCAAAAATAACAAAGCTGG + Intergenic
997115119 5:131118272-131118294 CTTAGCAAAAAGAACAAAGTTGG - Intergenic
997127585 5:131243623-131243645 CTGTGCAAAATGAAAAATGCAGG - Intergenic
997782184 5:136670259-136670281 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
998306924 5:141087497-141087519 CTCTGCAAAATTAGCAATGAAGG - Intergenic
998323501 5:141256407-141256429 TTTTTCAAAATTAACAAAATTGG - Intergenic
998359320 5:141571628-141571650 CTGTTCAAAAGTATCAAAATGGG + Intronic
998574913 5:143304608-143304630 CTAAGCAAAAAGAACAAAGTTGG + Intronic
998650256 5:144111590-144111612 TTGAGCAAAAAAAACAAAGTTGG + Intergenic
998932585 5:147197846-147197868 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1000498336 5:162014623-162014645 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1000798656 5:165696395-165696417 CTAAGCAAAATAAACAAAGCTGG + Intergenic
1001090024 5:168732520-168732542 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1001462557 5:171930067-171930089 CTGTGCAGAATAAAAAAAGAAGG + Intronic
1002258232 5:177975741-177975763 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1002686390 5:181014344-181014366 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1002686608 5:181016564-181016586 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1002867513 6:1135441-1135463 CTGTCCAAAAAGAACAAAGCTGG - Intergenic
1003025091 6:2547702-2547724 CTTTGCAAAATTATGACAGTAGG + Intergenic
1003156301 6:3598490-3598512 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1003902199 6:10664991-10665013 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1004586614 6:17008144-17008166 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1004795403 6:19077788-19077810 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1005183420 6:23134542-23134564 TTGAGCAAAAATAACAAAGCAGG - Intergenic
1005527879 6:26669146-26669168 CTTTGTAAAACTAACAAATTAGG - Intergenic
1005658320 6:27966860-27966882 GTGGGCAAAATTAGCCAAGTGGG - Intergenic
1005720064 6:28592626-28592648 TTGAGCAAAATGAACAAAGCTGG + Intronic
1006127371 6:31848139-31848161 CTCTACAAAATTAAAAAATTAGG + Intergenic
1006240674 6:32675275-32675297 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1006280368 6:33047772-33047794 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1006962815 6:37950809-37950831 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1007058999 6:38919439-38919461 CAGTGCAAAATGAAAAATGTGGG - Intronic
1007190270 6:40009737-40009759 CTGAGCAAAAAGAACAAACTTGG - Intergenic
1007847282 6:44769977-44769999 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1008043895 6:46832231-46832253 CTGTGCAAAAATATCAGTGTAGG + Intronic
1008194536 6:48502155-48502177 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
1008210669 6:48720832-48720854 CTGAGCAAAAGGAACAAAGCTGG - Intergenic
1008255103 6:49289058-49289080 ATGAGCAAAATGAACAAAGCTGG - Intergenic
1008352093 6:50504096-50504118 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1008524301 6:52392587-52392609 CTTTCCCAAATTAACAAAGTGGG - Intronic
1008745325 6:54662859-54662881 ATGAGCAAAAAGAACAAAGTTGG - Intergenic
1009013733 6:57874695-57874717 CTTTGTAAAACTAACAAATTAGG + Intergenic
1009030581 6:58052911-58052933 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1009306376 6:62095001-62095023 CTGAGCAAAAACAACAAAGCTGG - Intronic
1009583227 6:65564323-65564345 CTAAGCAAAAAGAACAAAGTGGG + Intronic
1009621288 6:66081177-66081199 CTATGCAAAAAGAACAAAGTTGG - Intergenic
1009652494 6:66493737-66493759 CTAAGCAAAAATAACAAAGCCGG + Intergenic
1009675878 6:66820537-66820559 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1009776739 6:68214710-68214732 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1009915650 6:69992325-69992347 CTAGGCAAAAAGAACAAAGTTGG - Intronic
1009997755 6:70915844-70915866 CTGGGCAAAAAGAACAAAGCTGG - Intronic
1010008217 6:71019745-71019767 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010019964 6:71147988-71148010 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010158877 6:72828170-72828192 CTGAGCAAAAAGAACAAAGATGG - Intronic
1010236786 6:73581458-73581480 CTGAGCAAAATGAACAAAGCTGG + Intergenic
1010280700 6:74019551-74019573 CTGAGCAAAAAGAACAAAATGGG + Intergenic
1010343019 6:74779580-74779602 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1010412291 6:75574242-75574264 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1010477038 6:76300448-76300470 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1010484675 6:76395593-76395615 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1010496044 6:76534566-76534588 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1010530047 6:76957550-76957572 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1010539918 6:77080327-77080349 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010675244 6:78735944-78735966 CTGAGGAAAAATAACAAAGCTGG - Intergenic
1010848327 6:80740361-80740383 CTGAACAAAAATAACAAAGTTGG - Intergenic
1010913938 6:81592371-81592393 CTGAGCAAAAAGAACGAAGTTGG - Intronic
1010946063 6:81974754-81974776 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1011103611 6:83753341-83753363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011116812 6:83902461-83902483 CTGAGCAAAAAGAACAAAGATGG - Intronic
1011324283 6:86131953-86131975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011539093 6:88411065-88411087 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1011651117 6:89507118-89507140 ATCTGTAAAATAAACAAAGTAGG + Intronic
1011851962 6:91640072-91640094 CTTTGTAAAATTAGAAAAGTTGG - Intergenic
1011892503 6:92183037-92183059 CTGTTCAAATTTCACAAAGGCGG - Intergenic
1011894014 6:92201351-92201373 CTTTGCAAAATTATGAGAGTTGG + Intergenic
1011969650 6:93207212-93207234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1012027082 6:94009333-94009355 CTGGGCAAAAAGAACAAAATTGG + Intergenic
1012214650 6:96567428-96567450 CTGAGCAAAATGAACAAAGCCGG - Intronic
1012336960 6:98071766-98071788 CTAAGCAAAAATAACAAAGGTGG - Intergenic
1012706817 6:102541821-102541843 ATAAGCAAAAATAACAAAGTTGG - Intergenic
1012922023 6:105229987-105230009 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1013965399 6:115949731-115949753 CTAAGCAAAAATAACAAAGCTGG + Intronic
1013968862 6:115990714-115990736 CTAAGCAAAAGGAACAAAGTTGG - Intronic
1014029778 6:116686971-116686993 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1014120255 6:117716618-117716640 TTGAGCAAAAAGAACAAAGTTGG - Intergenic
1014334938 6:120121570-120121592 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1014347638 6:120294159-120294181 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1014462023 6:121707630-121707652 CTTAGCAAAAATAACAAAGCTGG + Intergenic
1014560218 6:122880744-122880766 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1014643861 6:123949243-123949265 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1014833935 6:126136683-126136705 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1014862750 6:126489839-126489861 ATGAGCAAAAAGAACAAAGTTGG - Intergenic
1015103596 6:129509795-129509817 CTATGCAAAAGGAACAAAATTGG - Intronic
1015156655 6:130103818-130103840 CTGTGCATCATTATCCAAGTTGG + Intronic
1015192961 6:130491961-130491983 CTAGGCAAAAAGAACAAAGTTGG - Intergenic
1015205963 6:130639005-130639027 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1015462286 6:133505167-133505189 GTGTTTAAAATTATCAAAGTTGG - Intronic
1015488190 6:133795610-133795632 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1015710251 6:136131242-136131264 TTATGCAAAATTATCAATGTAGG + Intronic
1015735561 6:136396006-136396028 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1015739069 6:136433988-136434010 CTGTGCAGAGTTCACAAGGTGGG - Intronic
1016103699 6:140135347-140135369 CTGAGCAAAAATAACAAAACTGG + Intergenic
1016155161 6:140797045-140797067 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016270417 6:142282191-142282213 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1016444996 6:144122367-144122389 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1016494053 6:144639563-144639585 CTGAGCAAGATTAACAAACAAGG - Intronic
1016650849 6:146457926-146457948 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016660716 6:146575902-146575924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016663371 6:146606842-146606864 CTATGCAAAAAGAACAAAGCTGG - Intronic
1016847547 6:148583351-148583373 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1016855327 6:148664169-148664191 CTGAGCAAAAACAACAAAGCTGG - Intergenic
1016955053 6:149618537-149618559 CTGAGCAAAAGGAACAAAGTTGG + Intronic
1017144877 6:151225656-151225678 CTCTGTAAAATTAACAGAGAAGG - Intergenic
1017392451 6:153956152-153956174 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1017411931 6:154176839-154176861 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1017517286 6:155168250-155168272 CTGTGCACATTAAAAAAAGTAGG + Intronic
1018034533 6:159870917-159870939 TTGAGCAAAAATAACAAAGCTGG - Intergenic
1018325724 6:162665730-162665752 CTAAGCAAAAGGAACAAAGTTGG + Intronic
1018448613 6:163883212-163883234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1018458477 6:163974493-163974515 CTGTGGAAAATAAAAAAAGCTGG + Intergenic
1018600638 6:165536016-165536038 CTGAGCAAAAGGAACAAAGCTGG + Intronic
1018673198 6:166196189-166196211 GTGTGCAAAATAAACAGACTTGG + Intergenic
1019086652 6:169484722-169484744 CTAAGCAAAATGAACAAAGCTGG + Intronic
1020550521 7:9597668-9597690 TTTTGCAAAATTGATAAAGTTGG + Intergenic
1020622218 7:10532348-10532370 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1020636387 7:10700564-10700586 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1020640322 7:10746602-10746624 CTGGGCAAGAAAAACAAAGTGGG + Intergenic
1020694936 7:11401710-11401732 CTGTTAAAAATAAACAAAGTTGG - Intronic
1020747852 7:12100382-12100404 CTATGCAAAAAGAACAAAGCAGG - Intergenic
1020970332 7:14930164-14930186 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1021299031 7:18948349-18948371 ATATGTAAATTTAACAAAGTGGG + Intronic
1021605824 7:22408505-22408527 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1021764629 7:23935012-23935034 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1022293577 7:29027994-29028016 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1022313645 7:29222411-29222433 CTAAGCAAAAAGAACAAAGTGGG + Intronic
1022365794 7:29714806-29714828 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1022549302 7:31222695-31222717 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1022762987 7:33377461-33377483 CTAGGCAAAATGAACAAAATTGG - Intronic
1022885324 7:34637569-34637591 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1022999164 7:35789730-35789752 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1023003947 7:35842314-35842336 TTGAGTAAAATTAACAAGGTTGG - Intronic
1023571835 7:41580628-41580650 CTGTCAAGAATTATCAAAGTGGG + Intergenic
1023650790 7:42366876-42366898 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1024412180 7:49057114-49057136 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1024435589 7:49350400-49350422 ATCTGGAAAATTAAGAAAGTTGG - Intergenic
1025257612 7:57395814-57395836 TTGTGCAAAATGAGCAAAATAGG + Intergenic
1025287308 7:57675143-57675165 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1025972534 7:66341147-66341169 CTGAGCAGAAAGAACAAAGTTGG + Intronic
1027349554 7:77297042-77297064 CTGAACAAAATGAACAAAGCTGG - Intronic
1027407652 7:77878721-77878743 CTTTGCAAAATTATGACAGTAGG - Intronic
1027415615 7:77970804-77970826 CTGTGAAAAAAAAACAAACTTGG - Intergenic
1027455321 7:78384035-78384057 CTGAGCAAAAATAACAAAGCTGG - Intronic
1027496783 7:78897572-78897594 CTAAGCAAAATGAACAAAGCTGG - Intronic
1027533295 7:79363513-79363535 ATTTTCAAAATTAATAAAGTGGG + Intronic
1027573328 7:79900132-79900154 TTGAGCAAAAATAACAAAGCGGG + Intergenic
1027627070 7:80559391-80559413 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1027628365 7:80572001-80572023 CTAAGCAAAATGAACAAAGCTGG - Intronic
1027802855 7:82777453-82777475 CTAAGCAAAAAGAACAAAGTAGG + Intronic
1027919715 7:84377543-84377565 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1028022666 7:85796049-85796071 CTGAGCAAAAATAACAAAACTGG + Intergenic
1028140695 7:87271753-87271775 CTGAGCAAAATGAACAAAGCTGG - Intergenic
1028332240 7:89609212-89609234 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1028444279 7:90902293-90902315 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028459596 7:91076171-91076193 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028779111 7:94715552-94715574 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1028817858 7:95168092-95168114 CTGTGCAAAAAGAACAAAGTTGG + Intronic
1028948356 7:96606058-96606080 CAGTGCAAAAGTAGCAATGTTGG + Intronic
1029004221 7:97190642-97190664 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
1030014752 7:105207626-105207648 ATATGCAAAATAAATAAAGTTGG + Intronic
1030404011 7:109087859-109087881 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1030429282 7:109421494-109421516 CTGTGGAAGATGAACAAAGCTGG - Intergenic
1030599464 7:111577038-111577060 CTGAGCAAAAGGAACAAAATTGG + Intergenic
1030718283 7:112836884-112836906 CTAAGCAAAAATAACAAAGCTGG - Intronic
1030732596 7:113007595-113007617 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
1030756861 7:113296184-113296206 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1030759787 7:113336392-113336414 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1030910943 7:115248081-115248103 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1030959523 7:115899327-115899349 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1031182353 7:118434353-118434375 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1031260817 7:119517614-119517636 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1031348692 7:120701502-120701524 CTAAGCAAAAATAACAAAGCTGG + Intronic
1031623869 7:123969733-123969755 CTGAGCAAAAGGAACAAAGCTGG - Intronic
1031733927 7:125332740-125332762 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1031738230 7:125394723-125394745 CTGCGCAAAAAGAACAAAGCTGG + Intergenic
1031801746 7:126255447-126255469 CTGAGCAAAATGAACAAAACCGG + Intergenic
1032229964 7:130065885-130065907 CTGTTAAAAATAAACAAAATTGG + Intergenic
1032318508 7:130863185-130863207 CTGAACAAAATGAACAAAGCTGG + Intergenic
1032361565 7:131260653-131260675 CTATGCAAAAAGAACAAAGCTGG + Intronic
1032368151 7:131320128-131320150 ATAAGCAAAAATAACAAAGTTGG + Intronic
1032647036 7:133836205-133836227 CTGGGGAAAATTAATAATGTAGG - Intronic
1032914092 7:136467844-136467866 CTAAGCAAAAATAACAAAGATGG - Intergenic
1033108380 7:138552452-138552474 CTGTGAGAAATTAAGAAAGAAGG - Intronic
1033270264 7:139925097-139925119 CTGAGCAAAATGAACAAAACTGG - Intronic
1033412900 7:141136077-141136099 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1033614114 7:142995234-142995256 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1033964065 7:146951735-146951757 CTATGCAAAAAGAACAAAGCTGG - Intronic
1034173874 7:149085230-149085252 CTAGGCAAAATGAACAAAGCTGG - Intronic
1035349224 7:158233670-158233692 CTGAGCAAAAATAACAAACATGG + Intronic
1035794487 8:2341594-2341616 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1035798308 8:2380114-2380136 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1035980689 8:4367500-4367522 CTGAGCAAAAGGAACAAAGCTGG - Intronic
1037154238 8:15680023-15680045 CTAAGCAAAAATAACAAAGCTGG - Intronic
1037282452 8:17257360-17257382 CTGAGCAAAAAGAACAAGGTTGG - Intronic
1037295891 8:17399676-17399698 CTGTGCAAAAAGAACAAAACTGG + Intronic
1037296216 8:17403517-17403539 CTGTGCAAAAAGAACAAAACTGG - Intronic
1037664970 8:20960912-20960934 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1038130145 8:24720873-24720895 TTATCCAAAATTAACAAAATTGG + Intergenic
1038225109 8:25648775-25648797 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1039005582 8:33032964-33032986 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1039516937 8:38141770-38141792 CAGTGTAAAATTAAACAAGTGGG + Intronic
1039646841 8:39294466-39294488 ATGAGCAAAATGAACAAAGATGG - Intergenic
1039678635 8:39702924-39702946 CTATGCAAAAAGAACAAAGCTGG - Intronic
1039679376 8:39712989-39713011 CTAAGCAAAATGAACAAAGCTGG + Intronic
1039849694 8:41353391-41353413 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1039863659 8:41481756-41481778 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1039958493 8:42225578-42225600 CTGTATGAAAATAACAAAGTAGG - Intergenic
1040401844 8:47058761-47058783 CTAAGCAAAAGTAACACAGTTGG + Intergenic
1040443398 8:47468403-47468425 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1040474857 8:47766731-47766753 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1040702226 8:50079989-50080011 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1040734556 8:50490212-50490234 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1040793387 8:51260986-51261008 TTGGGCAAAAATAACAAAGCTGG - Intergenic
1041038769 8:53823953-53823975 CTGAAAAAAATTAACAAAATGGG + Intronic
1041213459 8:55576274-55576296 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1041749807 8:61248226-61248248 CTATGCAAAAAGAACAAAGCTGG - Intronic
1041941511 8:63393098-63393120 CTGTTCAAAATTAATAAACCTGG - Intergenic
1042129473 8:65573109-65573131 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1042313176 8:67398741-67398763 CTGGGCAAAATTCAAAATGTTGG + Intergenic
1042637050 8:70888894-70888916 CTGAGCAAAAAGACCAAAGTTGG - Intergenic
1043171862 8:76975699-76975721 CTGAGCAAAATGAACAAAGTTGG + Intergenic
1043231511 8:77808012-77808034 CTGAGGAAAATAAACAAAGCTGG + Intergenic
1043281175 8:78468606-78468628 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1043301300 8:78736794-78736816 GTATGAAAAATTAACATAGTAGG + Intronic
1043318440 8:78950593-78950615 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1043351891 8:79371697-79371719 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1043532833 8:81169886-81169908 CTAAGCAAAAACAACAAAGTTGG + Intergenic
1043610690 8:82059390-82059412 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1043829866 8:84974690-84974712 CTGGGCAAAATGAACAAGATTGG + Intergenic
1043861526 8:85322976-85322998 CTGTGAAAAATTAAATATGTTGG - Intergenic
1044128109 8:88483801-88483823 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1044143540 8:88684902-88684924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1044218534 8:89642600-89642622 CGGAGCAAAATGAACAAAGCTGG + Intergenic
1044440928 8:92222492-92222514 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1044447145 8:92292255-92292277 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1044448780 8:92309799-92309821 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1044470209 8:92558263-92558285 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1044850956 8:96427161-96427183 CTGAGCAAAAAGAACAAAATGGG - Intergenic
1044883719 8:96752077-96752099 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1044955942 8:97480630-97480652 CTAAGCAAAAAGAACAAAGTCGG + Intergenic
1045570786 8:103367235-103367257 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1045727483 8:105191592-105191614 CTGAGCAAAAATAACAAAACTGG - Intronic
1045732000 8:105253029-105253051 CTGAGCAAAAAGAACAAAATTGG - Intronic
1045776297 8:105807197-105807219 GTGTGCAAAATTAATTAAGCTGG + Intergenic
1045789887 8:105970887-105970909 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1045812810 8:106243628-106243650 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1045945710 8:107793699-107793721 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1045946053 8:107797551-107797573 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1045971909 8:108088287-108088309 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1046134218 8:110005260-110005282 CTGAGCAAAATGAACAAAACTGG - Intergenic
1046152450 8:110245554-110245576 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1046409364 8:113819119-113819141 CTGAGCAAAAGTAACAAAGCTGG + Intergenic
1046441248 8:114257720-114257742 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1046488242 8:114914087-114914109 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1046726178 8:117676529-117676551 CTGTGGAAAAATGACAAAGTTGG + Intergenic
1047036562 8:120945698-120945720 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1047431205 8:124794008-124794030 CTGAGCAAAATGAACAAAGTGGG - Intergenic
1047536917 8:125728406-125728428 CTGGGAAAAATTACCAAAGGAGG + Intergenic
1048786230 8:138053374-138053396 CTAAGCCAAAATAACAAAGTGGG - Intergenic
1048916326 8:139187397-139187419 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1049136028 8:140900958-140900980 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1049811087 8:144572176-144572198 CTAAGCAAAAATAACAAAGCTGG + Intronic
1050039948 9:1479277-1479299 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1050127519 9:2374453-2374475 CTGAGCAAAAAGAACAAAGCCGG + Intergenic
1050505535 9:6344962-6344984 CTGAGCAAAAAGAATAAAGTTGG + Intergenic
1050672117 9:8009193-8009215 TTGAGCCAAATTAACAAAGCTGG - Intergenic
1050788414 9:9434573-9434595 CTGAGCAAAAAGAACAAAGTTGG + Intronic
1050877392 9:10655654-10655676 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1050922180 9:11217490-11217512 CTGAGCAAAAAGAACAAAATTGG + Intergenic
1051186820 9:14469188-14469210 CTGTGCAAACTGAACCTAGTAGG + Intergenic
1051451260 9:17200279-17200301 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1051519649 9:17971655-17971677 CTTTGCAAATTTAACTAAATGGG + Intergenic
1051620032 9:19041495-19041517 CTGAGCAAAAAGAACAAAATTGG + Intronic
1051862418 9:21641392-21641414 CTATGCAAAAATAACAAAACTGG + Intergenic
1052134506 9:24893398-24893420 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1052154417 9:25166904-25166926 CTAAGCAAAAACAACAAAGTTGG - Intergenic
1052489326 9:29144209-29144231 CTAAGCAAAAAGAACAAAGTCGG - Intergenic
1052551399 9:29954744-29954766 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1052590255 9:30483083-30483105 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1053028781 9:34756653-34756675 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1053460593 9:38267470-38267492 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1053653705 9:40194739-40194761 CTGTGCAAAAATATCAGTGTAGG - Intergenic
1053793924 9:41707494-41707516 CTGTGAATATTTATCAAAGTAGG + Intergenic
1053904089 9:42823898-42823920 CTGTGCAAAAATATCAGTGTAGG - Intergenic
1054151248 9:61607292-61607314 CTGTGAATATTTATCAAAGTAGG - Intergenic
1054182335 9:61919509-61919531 CTGTGAATATTTATCAAAGTAGG + Intergenic
1054334431 9:63791734-63791756 CTAAGCAAAAAGAACAAAGTCGG + Intergenic
1054471028 9:65538471-65538493 CTGTGAATATTTATCAAAGTAGG - Intergenic
1054530896 9:66181615-66181637 CTGTGCAAAAATATCAGTGTAGG + Intergenic
1054656175 9:67668970-67668992 CTGTGAATATTTATCAAAGTAGG - Intergenic
1054770678 9:69080319-69080341 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1054908789 9:70434552-70434574 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1055165694 9:73189772-73189794 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055234486 9:74104054-74104076 CTATGCAAAAAGAACAAAGCTGG + Intergenic
1055283732 9:74705167-74705189 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055624014 9:78154463-78154485 CTAAGCAAAAATAACAAAGTTGG + Intergenic
1055908779 9:81323709-81323731 CTGAGGAAAAATAACAAAGCTGG - Intergenic
1056174197 9:84018206-84018228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1057155280 9:92832580-92832602 TTGTGCAAAAAGAACAAAGCTGG + Intergenic
1057345155 9:94243659-94243681 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1057754790 9:97823739-97823761 CTGTGCAAAATCAATAAAAGAGG + Intergenic
1057973606 9:99580602-99580624 CTGTGCAAAATTTTCATATTTGG + Intergenic
1058129951 9:101240337-101240359 CTTAGCAAAAATAACAAAGCTGG - Intronic
1058138664 9:101335386-101335408 GTGAGCAAAATAAACAAACTAGG - Intergenic
1058206117 9:102110198-102110220 CTATGAAAAAATAACAAAGCTGG - Intergenic
1058227241 9:102380539-102380561 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1058315317 9:103557856-103557878 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1058343133 9:103922227-103922249 CTCTGCAAAATTAGCATAGAAGG + Intergenic
1059053874 9:110958278-110958300 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1059060023 9:111025969-111025991 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1059262290 9:112989562-112989584 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1059490686 9:114664660-114664682 TTGTGCTAAATTTACAAATTAGG - Intergenic
1059597384 9:115736566-115736588 CTGAGCAAAAATAGCAAAGCTGG - Intergenic
1059951727 9:119470665-119470687 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1060079686 9:120631417-120631439 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1060567836 9:124609550-124609572 CTAAGCAAAAAGAACAAAGTTGG - Intronic
1186001155 X:5012392-5012414 CTGAGCAAAATGAACAAAGCTGG + Intergenic
1186066006 X:5765448-5765470 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1186169214 X:6859306-6859328 CTTTGCAAAATTATAACAGTGGG + Intergenic
1186381506 X:9065130-9065152 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1186934870 X:14437602-14437624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1186985972 X:15014142-15014164 CTGAGCAAAACAAATAAAGTAGG + Intergenic
1187024711 X:15422869-15422891 CTGAGCAAAATGAACAAAGCTGG + Intronic
1187108569 X:16271048-16271070 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1187178690 X:16921441-16921463 CTGAGCAAAAGGAACAAAATTGG + Intergenic
1187181043 X:16944560-16944582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1187627614 X:21133584-21133606 TTTTGCAAAAAGAACAAAGTTGG + Intergenic
1187705952 X:22009577-22009599 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1187713986 X:22083307-22083329 CTGGGCAAAAATAACAAAGCTGG - Intronic
1187801902 X:23073145-23073167 CTATGCAAAAAGAACAAAGCTGG + Intergenic
1188178924 X:27029163-27029185 CTATGCAAAATAAACACATTGGG - Intergenic
1188265728 X:28071456-28071478 CTGAGCAAAAAGAACAAAATTGG + Intergenic
1188664437 X:32801950-32801972 CTAAGCAAAAATAACAAAGCTGG - Intronic
1188724695 X:33568022-33568044 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1188766311 X:34096214-34096236 CTGAGCAAAAATAACAAATCTGG + Intergenic
1188814404 X:34693774-34693796 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1188825673 X:34831233-34831255 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1188995065 X:36874311-36874333 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1189721445 X:43923341-43923363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1189888411 X:45573915-45573937 CTGAGCAAAATGAAAAAAGCTGG - Intergenic
1189951096 X:46231764-46231786 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1190585641 X:51937851-51937873 CTGAGCAAAATGAACAAAGCTGG + Intergenic
1190891181 X:54569569-54569591 CTCTGAAAAAGGAACAAAGTTGG + Intergenic
1190901553 X:54679106-54679128 CTAAGCAAAATTAACAAAGCTGG - Intergenic
1190992950 X:55571218-55571240 CTGAGCAAAAAGAACAAAGATGG + Intergenic
1191073814 X:56430554-56430576 CTCAGCAAAAAGAACAAAGTTGG - Intergenic
1191078451 X:56482799-56482821 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1191168149 X:57413654-57413676 CTAAGCAAAATGAACAAAGCTGG - Intronic
1191169513 X:57428441-57428463 CTATGCAAAAGGAACTAAGTCGG + Intronic
1191595604 X:62940674-62940696 CTATGCAAAATGACCAAAGCTGG - Intergenic
1191679711 X:63828790-63828812 CTGGGCAAAAAGAATAAAGTTGG - Intergenic
1191722242 X:64242010-64242032 ATGTGCAAAAATAACAAAGCAGG - Intergenic
1191768458 X:64728713-64728735 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1191815784 X:65242678-65242700 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1191925650 X:66306953-66306975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1191973528 X:66844140-66844162 CTAAGCAAAAAGAACAAAGTTGG + Intergenic
1192020125 X:67380914-67380936 CTATGCAAAAATAACAAAACTGG + Intergenic
1192086575 X:68104364-68104386 CTAAGCAAAAATAACAAAGCTGG + Intronic
1192154691 X:68735523-68735545 CTGTGAAAAATTAATTATGTTGG - Intergenic
1192303413 X:69931065-69931087 CTTTGAAAAAAGAACAAAGTTGG + Intronic
1193039882 X:76993701-76993723 CTAAGCAAAATTAACAAAGCTGG - Intergenic
1193088206 X:77466552-77466574 TTGAGCAAAATGAACAAAGTTGG - Intergenic
1193201012 X:78690861-78690883 CTAAGCAAAAATAACAAAGGTGG - Intergenic
1193375400 X:80753962-80753984 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1193434771 X:81459491-81459513 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1193452927 X:81692905-81692927 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1193490225 X:82140653-82140675 CTGATCAAAAAGAACAAAGTTGG + Intergenic
1193506786 X:82354093-82354115 TTGAGCAAAAATAACAAAGCTGG + Intergenic
1193581189 X:83265099-83265121 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1193623863 X:83792751-83792773 CTGAGCAAAAATAACAAAGCTGG + Intergenic
1193804203 X:85973773-85973795 CTGGGAAAAAAGAACAAAGTAGG + Intronic
1193913481 X:87335176-87335198 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1193976225 X:88122476-88122498 CTAAGCAAAATAAACAAAGCTGG + Intergenic
1194034898 X:88858286-88858308 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1194037956 X:88901923-88901945 CTATGTAAAAATAACAAAGCTGG + Intergenic
1194074485 X:89371610-89371632 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1194132729 X:90101924-90101946 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1194139691 X:90194510-90194532 CTAAGCAAAATGAACAAAGTTGG - Intergenic
1194174239 X:90627540-90627562 CTGTGCAAATAGAACAAAGCAGG + Intergenic
1194217131 X:91144526-91144548 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1194238340 X:91412517-91412539 CTAAGCAAAAAGAACAAAGTAGG + Intergenic
1194325133 X:92505640-92505662 CTAGGCAAAAATAACAAAGCTGG - Intronic
1194431882 X:93818217-93818239 CTGAGCAAAAAGAACAAAATTGG + Intergenic
1194708564 X:97204872-97204894 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1194806902 X:98340612-98340634 CTGAGCAAAAGGAACAAAGTTGG - Intergenic
1194900996 X:99511449-99511471 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1194986766 X:100498570-100498592 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1195225895 X:102792853-102792875 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1195270546 X:103224997-103225019 CTAAGCAAAAAGAACAAAGTAGG + Intergenic
1195346807 X:103958851-103958873 CTAAGCAGAATGAACAAAGTTGG + Intronic
1195360635 X:104079990-104080012 CTAAGCAGAATGAACAAAGTTGG - Intergenic
1195396689 X:104418554-104418576 CTATGCAAAATGAACAAATCTGG + Intergenic
1195632485 X:107072691-107072713 CTGAACAAAAATAACAAAGCTGG + Intronic
1195663824 X:107409840-107409862 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1196161068 X:112483164-112483186 CTGTGAAAGAAAAACAAAGTTGG - Intergenic
1196169138 X:112568056-112568078 CTGAGCAAAAATAACAAAGCTGG - Intergenic
1196181910 X:112701743-112701765 CTGAGCAAAATAAACAAAACTGG - Intergenic
1196476171 X:116089647-116089669 CTAAGCAAAAAGAACAAAGTTGG - Intergenic
1196531297 X:116789907-116789929 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1196539421 X:116887702-116887724 TTGAGCAAAAATAACAAAGCTGG - Intergenic
1196566796 X:117216353-117216375 CTGAGCAAAAATAATAAAGTTGG + Intergenic
1196998489 X:121410852-121410874 CTGTGCAAAAACAACAAAGCTGG - Intergenic
1197079095 X:122390354-122390376 TTGAGCAAAAATAACAAAGCTGG - Intergenic
1197093265 X:122564017-122564039 CTTTGCAAAAAGAACAAAGCTGG + Intergenic
1197156786 X:123278866-123278888 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197165624 X:123374297-123374319 CTAGGCAAAAATAACAAAGCTGG - Intronic
1197166833 X:123386899-123386921 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197413220 X:126143406-126143428 CTAAGCAAAAAGAACAAAGTAGG + Intergenic
1197487520 X:127072361-127072383 CTAAGAAAAATTAACAAATTTGG - Intergenic
1197497271 X:127200361-127200383 CTATGCAAAAAGAACAAAGGTGG - Intergenic
1197516191 X:127432698-127432720 CTAAGCAAAATGAACAAAGCTGG - Intergenic
1197529633 X:127606809-127606831 CAAAGCAAAATGAACAAAGTCGG - Intergenic
1198165728 X:134054123-134054145 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1198255190 X:134918258-134918280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1198585298 X:138114096-138114118 TTTTGCAAAGTTAAAAAAGTGGG - Intergenic
1198648259 X:138833105-138833127 CTAAGCAAAAAGAACAAAGTAGG - Intronic
1198698820 X:139374146-139374168 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
1198733131 X:139755534-139755556 CTAAGCAAAATGAACAAAGCTGG + Intronic
1198796416 X:140401211-140401233 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1198948151 X:142038728-142038750 ATGGGCAAAATTACCAAAGATGG - Intergenic
1199000370 X:142629270-142629292 CTAAGCAAAATGAACAAAGCAGG - Intergenic
1199161557 X:144618050-144618072 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1199332537 X:146579656-146579678 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199333647 X:146591427-146591449 CTGTCCAACTTTAACAAAATGGG + Intergenic
1199376264 X:147113436-147113458 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199659720 X:150036831-150036853 TTGAGCAAAAGTAACAAGGTGGG + Intergenic
1199918899 X:152375176-152375198 CTAAGCAAAAAGAACAAAGTTGG + Intronic
1199995365 X:153021302-153021324 GTGTGAAAAATTAAGTAAGTGGG + Intergenic
1200320263 X:155181052-155181074 TTGTGCAAAAAGAACAAAGCTGG - Intergenic
1200330204 X:155287689-155287711 CTAAGCAAAAATAACAAAGCTGG - Intronic
1200387845 X:155911389-155911411 CTGAGCAAAATGAACAAAGCTGG - Intronic
1200407891 Y:2832326-2832348 CTTTTCAAAAAGAACAAAGTTGG + Intergenic
1200478513 Y:3672003-3672025 CTAAGCAAAAATAACAAAGCTGG - Intergenic
1200485435 Y:3763475-3763497 CTAAGCAAAATGAACAAAGTTGG - Intergenic
1200553648 Y:4608318-4608340 CTATGCAAAAAGAACAAAGCTGG - Intergenic
1200729881 Y:6723137-6723159 CTAAGCAAAAATAACAAAGCTGG + Intergenic
1200810119 Y:7475617-7475639 CTAAGCAAAAAGAACAAAGTGGG - Intergenic
1201258112 Y:12129776-12129798 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1201492127 Y:14553471-14553493 CTAAGCAAAAATAACAAAGTTGG + Intronic
1201537952 Y:15071453-15071475 CTAAGCAAAATGAACAAAGCTGG + Intergenic
1201610004 Y:15830565-15830587 TTGTACAAAAGTAAAAAAGTGGG - Intergenic
1201958678 Y:19653909-19653931 CTGAGCAAAAAGAACAAAATTGG - Intergenic