ID: 983867398

View in Genome Browser
Species Human (GRCh38)
Location 4:172784989-172785011
Sequence CTGTCCTTGTGGAGATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983867398_983867400 -10 Left 983867398 4:172784989-172785011 CCAGGACATCTCCACAAGGACAG 0: 1
1: 1
2: 1
3: 28
4: 173
Right 983867400 4:172785002-172785024 ACAAGGACAGATGCAGTGCCTGG 0: 1
1: 0
2: 4
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983867398 Original CRISPR CTGTCCTTGTGGAGATGTCC TGG (reversed) Intronic
905826376 1:41028658-41028680 CTGTCCATGAGGAGGGGTCCCGG + Exonic
906608720 1:47188007-47188029 CTGCCCTTCTAAAGATGTCCTGG - Intronic
910081506 1:83347770-83347792 CTGTCCTTGTGCTCATGTCCAGG - Intergenic
910584501 1:88864204-88864226 ATGTCCATGTTGAGATTTCCTGG - Intronic
911329193 1:96507427-96507449 TTTACCTTGTGTAGATGTCCAGG + Intergenic
913543165 1:119841306-119841328 CTGTCATTGTGGAGGTGTGGAGG + Intergenic
915110405 1:153561218-153561240 CTGGCCTTGGAGAGATTTCCAGG + Exonic
915670333 1:157483499-157483521 TTGTCCTTGTGGAGTGGACCAGG - Intergenic
916887781 1:169086865-169086887 CTGGCCTTGAGCAGATGTCAGGG - Intergenic
922677954 1:227564260-227564282 CTGTCCAGGTGGAAATTTCCTGG + Intronic
923093110 1:230754174-230754196 CTGCCCTGGTGGAGCTGCCCTGG - Intronic
923797028 1:237167191-237167213 CTGTCCTTTTGGAGATTTCCAGG + Intronic
924155093 1:241167478-241167500 CTGTCCCTGTGGAAATCTCCTGG - Intronic
924787222 1:247210132-247210154 CTGTCCAGGTGGAAATTTCCTGG - Intergenic
1067225470 10:44373393-44373415 CTGTCCTTCTGGAGCTGGCTGGG - Intronic
1070339193 10:75481083-75481105 CCATCCATGTGGAAATGTCCAGG + Intronic
1071971786 10:90915399-90915421 CTGTCCTTGGGGAAATGGGCAGG + Intronic
1071983069 10:91023266-91023288 CTGTCCTTCTGGTGATGACGAGG - Intergenic
1075443944 10:122500943-122500965 CTGTCCCTGTGGAGTGATCCGGG + Intronic
1075724659 10:124605125-124605147 CTGTCCCTGTGAAGCTGGCCAGG + Intronic
1076607775 10:131700642-131700664 CTGCCCACGTGGAGAGGTCCTGG + Intergenic
1076676267 10:132149220-132149242 CAGTCCTTGTGGGCAGGTCCAGG + Intronic
1078626653 11:12964220-12964242 CTGTCCATATCGAGAAGTCCTGG - Intergenic
1088026768 11:105194590-105194612 CTCTACTGGTGGTGATGTCCAGG - Intergenic
1088627277 11:111738361-111738383 CTGTCCCTGTGGCGATGGCAGGG - Intronic
1090445605 11:126762252-126762274 CTTTCCTTTTGCAGATGCCCTGG + Intronic
1092916491 12:13194261-13194283 GTGTGCTTTTGGAGATGTCTAGG - Intergenic
1095040516 12:37435568-37435590 CTATAATAGTGGAGATGTCCTGG + Intergenic
1097005617 12:55915330-55915352 CTGTATTTGTGGAGATAACCAGG - Intronic
1098654766 12:73013849-73013871 CTGCTCTGGTGGAGATGTCAAGG + Intergenic
1100807402 12:98300832-98300854 CTGTCCTTGTGAAGATATCTTGG - Intergenic
1101347982 12:103904063-103904085 CTTTCTTTGTGGAGATCTCATGG - Intergenic
1103847416 12:123911273-123911295 CTGTCCTGGGGGATCTGTCCTGG + Intronic
1103847723 12:123911953-123911975 CTGTCCTGGGGGATCTGTCCCGG + Intronic
1104728780 12:131093873-131093895 CTTTCCTTGTGGAGCTGTGGTGG + Intronic
1105510204 13:21045386-21045408 CTGTTCTTGTGGAGATGAAAAGG - Intronic
1106139471 13:26999749-26999771 CTGCCCTTGGGAAGATGGCCAGG + Intergenic
1110794680 13:79622775-79622797 CTTTCCTGGAGGGGATGTCCAGG - Intergenic
1112234516 13:97623603-97623625 CTGCCCTTGTGGAGGTGTGATGG - Intergenic
1114635082 14:24182734-24182756 CTGTCCCTGTGGAGACTGCCTGG + Intronic
1115448702 14:33521250-33521272 CTTTCCTTGAGGAGGTGTCAAGG + Intronic
1117201399 14:53393622-53393644 CTGTCCTTGTTGGGATTTCCAGG + Intergenic
1121503422 14:94458397-94458419 CTGTTCTGGTGGAGATGGCAGGG + Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1124258015 15:28161714-28161736 TTGTCATTGTGGAAATGTTCTGG - Intronic
1125030261 15:35068994-35069016 CTGTCCTGGCAGACATGTCCTGG + Intergenic
1126426426 15:48531527-48531549 GTGCCCTTGTGAAAATGTCCTGG - Intronic
1126860936 15:52882443-52882465 CTGGCCATGTGGAGATATACTGG - Intergenic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1132158804 15:99517761-99517783 CTGTGCATGTGGAGTTTTCCAGG + Intergenic
1136045309 16:27610451-27610473 CTGTCCTTTGGGAGGGGTCCAGG + Intronic
1136289921 16:29265331-29265353 CTGTCCTTGTTGAGAAGAGCAGG + Intergenic
1136605480 16:31330648-31330670 CTGCGCTTGTGGAGATTTCTGGG + Intronic
1139901762 16:70333656-70333678 TTGTCCTTGGGGTGATGTCGGGG - Exonic
1139906852 16:70372060-70372082 TTGTCCTTGGGGTGATGTCGGGG - Exonic
1141046154 16:80717701-80717723 CTGTCCTTGGGAAGTTGGCCAGG + Intronic
1142063679 16:88047592-88047614 CTGCCCTTCTGGACATGTTCAGG - Intronic
1142095806 16:88238807-88238829 CTGTCCTTGTTGAGAAGAGCAGG + Intergenic
1143039434 17:4022658-4022680 CTTTCCTGGTGCAGATGTGCTGG - Intronic
1143205975 17:5139418-5139440 CTGTCCTGGTGGGGCTGTCCGGG + Exonic
1144234534 17:13245028-13245050 CTGTCCCTGGGGTTATGTCCCGG + Intergenic
1146842631 17:36166378-36166400 CTGTCCTGGTGGGGCTGTCCGGG - Exonic
1146854943 17:36254337-36254359 CTGTCCTGGTGGGGCTGTCCGGG - Exonic
1146865677 17:36334039-36334061 CTGTCCTGGTGGGGCTGTCCGGG + Exonic
1146870843 17:36378229-36378251 CTGTCCTGGTGGGGCTGTCCGGG - Exonic
1146878202 17:36429311-36429333 CTGTCCTGGTGGGGCTGTCCGGG - Exonic
1146882151 17:36450457-36450479 CTGTCCTGGTGGGGCTGTCCGGG - Intergenic
1146923528 17:36729188-36729210 CTGTCCACGTGGAGATGTGGAGG + Intergenic
1147068546 17:37934651-37934673 CTGTCCTGGTGGGGCTGTCCGGG + Exonic
1147073727 17:37978853-37978875 CTGTCCTGGTGGGGCTGTCCGGG - Intronic
1147080069 17:38014188-38014210 CTGTCCTGGTGGGGCTGTCCGGG + Intronic
1147085248 17:38058391-38058413 CTGTCCTGGTGGGGCTGTCCGGG - Exonic
1147096018 17:38138148-38138170 CTGTCCTGGTGGGGCTGTCCGGG + Intergenic
1147101195 17:38182357-38182379 CTGTCCTGGTGGGGCTGTCCGGG - Intergenic
1148694931 17:49553020-49553042 CTGTCCTTTAGGAGGTGTCTGGG - Intergenic
1149845793 17:60008863-60008885 CTGTCCTGGTGGGGCTGTCCGGG - Intergenic
1150084141 17:62265443-62265465 CTGTCCTGGTGGGGCTGTCCGGG - Intergenic
1150382037 17:64728617-64728639 CTGTCCCTCTGGACTTGTCCTGG - Intergenic
1153612273 18:6898556-6898578 CTGCCTATGTGGAGATGTCCAGG - Intronic
1154193065 18:12246265-12246287 TTGCCCTTGAGGAAATGTCCAGG - Intergenic
1156490964 18:37495793-37495815 CTGTCCCTGTGGATATATCAGGG - Intronic
1159488486 18:69097938-69097960 CTGTCAGTGTGCAGATTTCCTGG + Intergenic
1159837159 18:73352358-73352380 CTGTCCATTTGGGGAGGTCCTGG + Intergenic
1162472598 19:10881451-10881473 CTGTCCCTGGAGAGATGTCCTGG - Intronic
1165784609 19:38453545-38453567 CTGTCCTTATGGAGTTGACATGG + Intronic
925266247 2:2568609-2568631 CTGTCAGTGTGCAGCTGTCCGGG + Intergenic
925309858 2:2874907-2874929 CTGACCCTGCGGAGATGACCTGG + Intergenic
927392140 2:22607535-22607557 CTTTCCTGGTGGTGATGTCTTGG - Intergenic
931207708 2:60164004-60164026 CAGTTCTTGTGTAGAGGTCCTGG - Intergenic
931207983 2:60166180-60166202 CAGTCCTCGTGTAGAGGTCCTGG + Intergenic
932593989 2:73083029-73083051 CTGTCCAGGTGGAAATATCCTGG + Intronic
932627083 2:73306143-73306165 CTGTCCATGTGGACTTTTCCAGG + Intergenic
935076676 2:99752290-99752312 CCGTCCTTCAGGAGATGACCTGG - Exonic
935115359 2:100130770-100130792 CTGTCTCTGTGGGGCTGTCCTGG - Intronic
935881575 2:107570898-107570920 CTGTCCTTGTGGAGTTGGGGTGG + Intergenic
936405861 2:112201689-112201711 CTGTCCTTGTGTAGCTGTGAAGG - Intergenic
936427734 2:112434773-112434795 CTGTCCATGTGGGGGTCTCCCGG + Intergenic
939551374 2:143619792-143619814 CTGGCCATGTGAAGATGTGCTGG + Intronic
939960331 2:148560419-148560441 CACTCTTTGTGGAGATGCCCAGG + Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
944620675 2:201512385-201512407 AGGTCCTTGTGGAAATGTCTAGG - Intronic
944852944 2:203738640-203738662 ATGTCCTTCTGTAGATGACCTGG + Exonic
947684665 2:232072387-232072409 CTGTCCTTATGGAGATCTTGGGG + Intronic
948161693 2:235829949-235829971 CTGTCCATGTCCAGATGTGCCGG - Intronic
1171838071 20:30175723-30175745 CTGCAATAGTGGAGATGTCCCGG + Intergenic
1173540422 20:43847043-43847065 CTCTCCATGTGGAAATGTACAGG + Intergenic
1174095500 20:48086105-48086127 CTGTCCTTCTGCAGAAATCCAGG - Intergenic
1176075806 20:63247771-63247793 CTGTCCTAGGGGAGAGGTGCAGG + Exonic
1176374510 21:6080438-6080460 CTGTCCATGTGGGGGTCTCCCGG - Intergenic
1179748965 21:43457807-43457829 CTGTCCATGTGGGGGTCTCCCGG + Intergenic
1180052066 21:45335809-45335831 CAGTCCTGGTGGATATGTCCAGG + Intergenic
1180950033 22:19716814-19716836 CTGTCTTCCTGGAGATGCCCTGG + Intronic
1181052802 22:20245726-20245748 CTGTCCTTCTGGAGATAGCATGG + Intronic
1181520716 22:23448089-23448111 CTGTCCTTGTGGCTCTGTCTCGG + Intergenic
1181719596 22:24763717-24763739 CTGTGCTTGTGGGGATGCCTGGG - Intronic
1183020318 22:35021437-35021459 CTGTCCCCATGGAGCTGTCCCGG + Intergenic
1184306644 22:43607388-43607410 CTGTCTTTGGGGAGCTGTCAGGG - Intronic
1184646379 22:45897525-45897547 CTGGCCTTGTGGACTTGGCCAGG + Intergenic
949786476 3:7747102-7747124 CTGTCCATTTGGCTATGTCCAGG + Intergenic
955419041 3:58718750-58718772 CTGGCATTGTGGAAATATCCTGG + Intronic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
962989758 3:140567064-140567086 CTGTCCTTGTTGTGTTGTCCTGG - Exonic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967898885 3:194426615-194426637 CTGTCTTTGGGAAGATGTTCAGG - Intronic
968818266 4:2832833-2832855 CTGTCCTTGTGCAGGTGGTCTGG + Intronic
968893732 4:3386279-3386301 CTCTCCAGGTGGAGGTGTCCCGG - Intronic
971159403 4:24118395-24118417 ATCTCCTTGTGGAGTTTTCCTGG + Intergenic
974964031 4:68737916-68737938 TTGTCCTTTTGGAGAGGTCCTGG + Intergenic
975779868 4:77826917-77826939 CTGTCTAGGTGGAGATATCCAGG - Intergenic
976614935 4:87066676-87066698 CTTTCCCTGTGGAGAGTTCCAGG - Intronic
977234181 4:94487086-94487108 ATGTCATTGGGGAGATGCCCTGG + Intronic
979271036 4:118761788-118761810 CTGTCCTAGTTGTCATGTCCAGG + Intronic
980244824 4:130224988-130225010 CTGTCTTTGTGGAAATGTTCGGG + Intergenic
980764717 4:137286884-137286906 CTGTTCTTCTGGAAATGTACAGG - Intergenic
981198016 4:141943067-141943089 CTCTCCTTGTGCAGAGATCCTGG + Intergenic
981400929 4:144313289-144313311 CTGTTCTGGTGGAGATGTCAGGG + Intergenic
983397409 4:167217549-167217571 CTCTCCTGGTGGGGGTGTCCTGG + Intronic
983534189 4:168839707-168839729 CATTCCAAGTGGAGATGTCCAGG + Intronic
983867398 4:172784989-172785011 CTGTCCTTGTGGAGATGTCCTGG - Intronic
983940695 4:173531711-173531733 CTGTCCTTGTGGAGTCCTTCGGG - Intergenic
984934675 4:184880023-184880045 CTTGCCTTCTGCAGATGTCCAGG + Intergenic
986342781 5:6805475-6805497 CTGTCCTTTTTGAGATGGACAGG + Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
995567697 5:113448836-113448858 CTCTATTTGTGGAGCTGTCCTGG - Intronic
996572144 5:124943753-124943775 ATTTACTTGTGGATATGTCCAGG + Intergenic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
998741691 5:145210417-145210439 CTGCTCTGGTGGAGATGTCAGGG - Intergenic
1001337162 5:170808681-170808703 CTTTCCTGGTGGTGTTGTCCTGG + Exonic
1002173076 5:177386060-177386082 CTGCCCCTGTGGGGAGGTCCTGG + Exonic
1002786201 6:402401-402423 CTGGCTTTGTGGGGCTGTCCAGG + Intronic
1005224891 6:23631077-23631099 CTGTACTTGAGCAGATGACCAGG - Intergenic
1009033380 6:58087249-58087271 CTGTCCTCTTGGTGCTGTCCTGG - Intergenic
1009208993 6:60839018-60839040 CTGTCCTCTTGGTGCTGTCCTGG - Intergenic
1010312016 6:74398645-74398667 CAGCCCTGGTGGAGATCTCCTGG - Intergenic
1011827098 6:91320888-91320910 CTGTAATTGTGGAGAAATCCTGG + Intergenic
1012797596 6:103782324-103782346 CTGTAATTGTGGAGATATTCTGG - Intergenic
1012858708 6:104533397-104533419 CTGTCCTTGGGGGGATGTGAAGG - Intergenic
1016491892 6:144614381-144614403 CTGTCCTTGGGGGAAGGTCCTGG - Intronic
1019304430 7:326258-326280 CTGTCCTTGTGCTGTTTTCCTGG + Intergenic
1019590524 7:1828158-1828180 CTGTCCTTGTGGCTCTGTCTCGG - Intronic
1021505788 7:21383592-21383614 CTGTCTTTGGGGAAATGACCAGG + Intergenic
1021570515 7:22060103-22060125 CTGTCCTTCTGTAAATTTCCAGG + Intergenic
1022253215 7:28629336-28629358 CTTTCCTTGGAGAGTTGTCCTGG + Intronic
1022644723 7:32219600-32219622 TCTTCCTTGTGGTGATGTCCTGG + Intronic
1024817787 7:53291794-53291816 TGCTCCTTGTGGAGCTGTCCTGG + Intergenic
1025803094 7:64806043-64806065 CTGTCATTGTGGAGTTATTCTGG + Intronic
1027174023 7:75892031-75892053 CTGTCCTTGTGCAGATGTCCAGG - Intergenic
1027298993 7:76810010-76810032 CTGTCCTTGTGCTCATGCCCAGG - Intergenic
1028329666 7:89573866-89573888 CTGTCCTTGTGAAAAAGACCTGG - Intergenic
1029263566 7:99321140-99321162 CTGGCCTTGAGGAGATTTACAGG + Intergenic
1030328992 7:108252997-108253019 CTGTCATTTTAGATATGTCCTGG - Intronic
1032368924 7:131327409-131327431 CTGTCCTCCTGGAGTGGTCCTGG - Intronic
1035318107 7:158010082-158010104 CTGTCCTTGTGGAGGAGGCAGGG + Intronic
1035483316 7:159203555-159203577 CTGTCCATGAGGAGACGGCCTGG + Intergenic
1035753395 8:2011402-2011424 CTGTCCGTGTGGAGCTCGCCAGG + Intergenic
1035811507 8:2495392-2495414 CTTCCCCTGTGGACATGTCCGGG - Intergenic
1037688588 8:21164254-21164276 CTCTCCTTGGGGAGAAGGCCTGG - Intergenic
1038376689 8:27047117-27047139 GTGTCCAAGTGGAGATGTTCAGG + Intergenic
1045733266 8:105266438-105266460 CTGTCCTTGGGAAGACGTTCCGG + Intronic
1045879395 8:107020503-107020525 CTCTCCTTTAGGAGCTGTCCAGG - Intergenic
1046918165 8:119699368-119699390 CTGTCCCTGTGGAGGGGTCCTGG - Intergenic
1048821295 8:138382992-138383014 CTTTCCCAGTGGATATGTCCAGG - Intronic
1049009284 8:139876479-139876501 CAGAGCTTGTGCAGATGTCCCGG - Intronic
1049553301 8:143270516-143270538 CTGTCCTGGTGGACCTGGCCAGG + Intronic
1049822995 8:144647463-144647485 CTTTCCTTGTGGGAATGTTCTGG - Intergenic
1050525700 9:6544344-6544366 CTGTCCCTGCGGAGGTTTCCAGG - Intronic
1051675182 9:19551733-19551755 CTGGCCTTGAGGAGAGGTCAGGG + Intronic
1057008983 9:91584895-91584917 CTTGCCCTGTGGAGCTGTCCGGG - Intronic
1057601756 9:96464214-96464236 ATGTCCGGGTGGAGATGTCTAGG + Intronic
1058857178 9:109074289-109074311 CTTTCCTTGTTTGGATGTCCTGG - Intronic
1060856897 9:126921433-126921455 CTCTCCTTGGGGAGAAGTCATGG - Intronic
1061659487 9:132119366-132119388 CTGGCCATGTGAAGATGTGCTGG + Intergenic
1189853555 X:45200528-45200550 CCCTTCTTGTGAAGATGTCCAGG - Intronic
1191014527 X:55794268-55794290 CAGTCCTTGTGGAGATGGCAGGG - Intergenic
1192929629 X:75792165-75792187 CTGTCCTGGTGGAGGTGGCAGGG - Intergenic
1193307615 X:79968078-79968100 GTGGCCATGTGAAGATGTCCAGG - Intergenic
1196604876 X:117645841-117645863 TTGTCCTTGTCAAAATGTCCTGG - Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1197658199 X:129140937-129140959 CAGTCATTGCTGAGATGTCCTGG + Intergenic
1199951415 X:152708903-152708925 CTGGTCTGGTGAAGATGTCCAGG - Intergenic
1199954062 X:152728127-152728149 CTGGTCTGGTGAAGATGTCCAGG - Exonic
1199955630 X:152740326-152740348 CTGGTCTGGTGAAGATGTCCAGG + Intergenic
1199958268 X:152759558-152759580 CTGGTCTGGTGAAGATGTCCAGG + Intergenic
1200211953 X:154350674-154350696 CTTTCCCTGTGGAGATGGCATGG + Intronic