ID: 983877529

View in Genome Browser
Species Human (GRCh38)
Location 4:172893940-172893962
Sequence CTGACTAGGTCCTAAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983877529_983877536 -10 Left 983877529 4:172893940-172893962 CCCCTTCCTTAGGACCTAGTCAG 0: 1
1: 1
2: 4
3: 31
4: 126
Right 983877536 4:172893953-172893975 ACCTAGTCAGGTTTGGGAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 198
983877529_983877539 14 Left 983877529 4:172893940-172893962 CCCCTTCCTTAGGACCTAGTCAG 0: 1
1: 1
2: 4
3: 31
4: 126
Right 983877539 4:172893977-172893999 CCTCAGCATTCACCAACTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983877529 Original CRISPR CTGACTAGGTCCTAAGGAAG GGG (reversed) Intronic
904197136 1:28794344-28794366 CTGACTGGGTGATGAGGAAGTGG + Intergenic
909412634 1:75373328-75373350 CTCAACAGGTCCTAAGGAAGGGG + Intronic
913397534 1:118388704-118388726 CTGAATAAGTCCTAGGAAAGTGG - Intergenic
914332590 1:146686104-146686126 ATGTCTAAGACCTAAGGAAGTGG + Intergenic
917833127 1:178914410-178914432 CTGAACAGCTCCTAAGGAAGGGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
923694351 1:236232535-236232557 TTGAATATGTCCTGAGGAAGTGG - Intronic
1063658802 10:8018909-8018931 CTGACTAGGTTCTAAGGATATGG - Intergenic
1068192865 10:53675621-53675643 CTGACCAAATTCTAAGGAAGAGG - Intergenic
1069544146 10:69317344-69317366 CTGCATAGGCCCTAAGGCAGGGG + Intronic
1069559164 10:69417468-69417490 CTGACTTTGTCCTAAGACAGTGG - Intergenic
1071026620 10:81122050-81122072 CTGACTCCGTCATAAGGGAGGGG + Intergenic
1071772374 10:88743804-88743826 CTGAGTAGCTCCTGGGGAAGAGG + Intronic
1074759402 10:116655071-116655093 CTGAAGGGCTCCTAAGGAAGGGG - Intergenic
1074926744 10:118080788-118080810 CTGCATAGGCCCTCAGGAAGGGG - Intergenic
1076614255 10:131745765-131745787 CTGAGCAGGTGCTAAGGCAGAGG + Intergenic
1078084184 11:8224050-8224072 CTGAGTAGGTCCCTAAGAAGAGG - Intergenic
1078684559 11:13516452-13516474 TTGCCTAGGGCTTAAGGAAGAGG - Intergenic
1082208399 11:49467436-49467458 CAGAATGGCTCCTAAGGAAGTGG + Intergenic
1084584608 11:70050375-70050397 GTGACCAGGTACTAAGTAAGTGG - Intergenic
1085163447 11:74371907-74371929 CTGACTGGCTGCTAGGGAAGTGG + Intronic
1087327265 11:96738955-96738977 CTGAACAGCTCCTAAGGAAGGGG - Intergenic
1088237585 11:107742045-107742067 CTGAACAGCTCCTAAGGAAGGGG - Intergenic
1088591071 11:111403724-111403746 TTGAATAGGTCCTAAGGAAATGG + Intronic
1089055838 11:115584095-115584117 GTGAGTGGGTGCTAAGGAAGAGG + Intergenic
1089912199 11:122112265-122112287 CTGACGGGGTGCTGAGGAAGGGG - Intergenic
1096322238 12:50625268-50625290 TGGACTAGGTACTAAGGAAACGG - Intronic
1099467605 12:83006144-83006166 CTGAATGGCTCCTAAGGAAGTGG - Intronic
1100144940 12:91666455-91666477 TTGACTATGTCATCAGGAAGTGG + Intergenic
1104939211 12:132387001-132387023 CAGGCCAGGTCCTAGGGAAGGGG + Intergenic
1105067202 12:133210881-133210903 GTGCCTAGGTAGTAAGGAAGGGG - Exonic
1107368462 13:39713142-39713164 CTGACTGGTTTCCAAGGAAGTGG + Intronic
1110434794 13:75467077-75467099 CTGACTGGTTCCTAAGTAAACGG + Intronic
1110496815 13:76177344-76177366 CTGTCTTGGTCCTAAGGACTGGG - Intergenic
1115848466 14:37565732-37565754 CAGGCTAGGTCCTAGGTAAGAGG - Intergenic
1116984476 14:51204387-51204409 CTGAACAGGTCCTAAGGAAGGGG - Intergenic
1118068980 14:62224250-62224272 CTGAGCAGCTCCTAAAGAAGGGG - Intergenic
1121329410 14:93040616-93040638 CTCACCAGGTCCTGAGGAAGAGG - Intronic
1123999068 15:25739834-25739856 CTGACTAGGTGGAAAGAAAGAGG + Intronic
1124399226 15:29333847-29333869 CTGACTGTGTCCTTAGGAAAAGG + Intronic
1127287894 15:57546680-57546702 CTGCCGTGGTCCTAAGGATGGGG + Intronic
1131678648 15:94698648-94698670 CTGAGCAGCTCCCAAGGAAGGGG + Intergenic
1136587709 16:31198319-31198341 CTGGCTAGGAGCTAAGGAAAAGG + Intergenic
1139518661 16:67466877-67466899 CTGAGTCGGTCATAAGGAACTGG + Intronic
1140001024 16:71025137-71025159 ATGTCTAAGACCTAAGGAAGTGG - Intronic
1141890190 16:86921119-86921141 CTGACCAGGTTCTAATGGAGGGG + Intergenic
1142442276 16:90106553-90106575 CCGAGTAGGTCCTGAGGAGGAGG - Intergenic
1143107109 17:4535367-4535389 CTGGCTTGGTCCTCAGGGAGGGG + Intronic
1143592104 17:7891466-7891488 ATTACCAGGGCCTAAGGAAGGGG - Intronic
1147260023 17:39204427-39204449 CTGACTAGGCTCAAAGGGAGAGG + Intronic
1147615097 17:41822860-41822882 CTGACTGGCTCCTAGGGAAGGGG + Exonic
1148530362 17:48384412-48384434 CTGACAAGGGCCTAAACAAGTGG + Intronic
1150597128 17:66616105-66616127 CTGATTGGGCCCTTAGGAAGGGG - Intronic
1151393424 17:73803250-73803272 CTGCCCAGGTTCAAAGGAAGGGG + Intergenic
1164676399 19:30104459-30104481 TGGACTTGGTCCTGAGGAAGCGG - Intergenic
1166234765 19:41447532-41447554 CTGATCAGGTTCAAAGGAAGGGG + Intergenic
1166345596 19:42163346-42163368 CTGACAAGGTCCTAATCAAATGG + Intronic
926145709 2:10396198-10396220 CACACTAGGTGCTCAGGAAGAGG - Intronic
926782899 2:16491634-16491656 TTAACTAGGTCCTGAGGACGGGG - Intergenic
926843797 2:17111122-17111144 ATGACTAGGTCATGAGGAAGTGG - Intergenic
927466888 2:23343543-23343565 CTGCCTGGGTCCCAAGGAAGTGG + Intergenic
931016191 2:57983010-57983032 CTGAGCAGCTCCTAGGGAAGGGG - Intronic
931549177 2:63424056-63424078 CTGAACAGCTCCTAAGGAAGGGG + Intronic
931987722 2:67757490-67757512 CTGAGTAGAATCTAAGGAAGTGG - Intergenic
933328160 2:80864274-80864296 CAGAATAGGACCTAAGGAAGGGG - Intergenic
933470040 2:82710512-82710534 CTAACTAGATCCTAAGGGAATGG - Intergenic
933484671 2:82904082-82904104 CTGAACAGGTCCTAAGGAAGGGG + Intergenic
933544368 2:83691909-83691931 TTGACTGGGTCTTGAGGAAGAGG + Intergenic
934495134 2:94789652-94789674 CTGACTAGGTCCTGATGACCAGG + Intergenic
935135138 2:100293539-100293561 CTGACAAGGCCCTAAGGGATGGG + Intronic
939636395 2:144587873-144587895 CTGACTACGGCCTGAGGATGTGG + Intergenic
941141870 2:161793516-161793538 ATGACTAGGTAGTGAGGAAGAGG - Intronic
941858463 2:170254116-170254138 CTGAAAAGGTTCTCAGGAAGGGG + Intronic
942348742 2:175030859-175030881 CTGTCTTGGCCCTAAGGATGAGG + Intergenic
943234597 2:185301034-185301056 ATGAATAGGACCTAAGAAAGGGG - Intergenic
943656425 2:190513465-190513487 CTGCCTGGGTCCTAAGCAACTGG + Intronic
947267137 2:228295178-228295200 CTGAATGGCTCCTAGGGAAGGGG + Intergenic
1171086636 20:22243863-22243885 TTGACCAGGCCCTAAGGAAGGGG + Intergenic
1173624779 20:44464676-44464698 CTGACTAAGTGCAAAGGAAGTGG - Intronic
1181594652 22:23906481-23906503 CTGTCTGGGCCCTAAGGAAGTGG + Intergenic
1183813415 22:40277705-40277727 CTGACTAGAACTTAAGGACGGGG + Intronic
1184392705 22:44214086-44214108 CTCACTAGGACCTATGGAGGAGG - Intronic
949217007 3:1582817-1582839 CTGAACAGGTCCTAAGGAAGGGG + Intergenic
952092090 3:29899611-29899633 CACACTAGGTCATAAGAAAGTGG - Intronic
952622873 3:35367468-35367490 CTGAATGACTCCTAAGGAAGGGG + Intergenic
953239559 3:41136619-41136641 GTGATTAGGTCATAAGGATGGGG + Intergenic
954187808 3:48932595-48932617 CTGACAAGCTGCTCAGGAAGAGG + Intronic
954583515 3:51716294-51716316 CTGAATAGGACCTAGGGAAATGG + Intronic
954817376 3:53293301-53293323 GTGACTAGGGACTAAGGCAGTGG - Intronic
955572057 3:60318536-60318558 GTGACAAGGCCCAAAGGAAGAGG - Intronic
958625813 3:96623006-96623028 GAGACTAGGTCCTAGGCAAGTGG + Intergenic
958950662 3:100412225-100412247 CAGATTAGTTCCTAAGAAAGTGG - Intronic
960225917 3:115168426-115168448 TGGACTAGGTCTTAAGGGAGAGG + Intergenic
961842904 3:129732576-129732598 CTGACTAGGTAATGAGAAAGGGG - Intronic
962505684 3:136044786-136044808 CTGAATGGCTCCTAAGGAAGGGG + Intronic
963368617 3:144369155-144369177 CTGAAAAGTTCCTCAGGAAGGGG + Intergenic
964238541 3:154563787-154563809 CAGACAAGGTACTGAGGAAGTGG - Intergenic
966166655 3:177026947-177026969 CTGACCAGTTCCTAAGCTAGGGG + Intronic
969262124 4:6040706-6040728 CTGAACAGGTCCTGAGAAAGAGG + Exonic
969532488 4:7737499-7737521 CTGACTCGGGCCTCAGGACGTGG + Intronic
974343018 4:60638383-60638405 CTGAACAGTTCCCAAGGAAGAGG - Intergenic
974914360 4:68161418-68161440 CTGAACAGTTCCTAAGGAAGGGG - Intergenic
976511495 4:85914778-85914800 CTGTCTTGCTCCTAAAGAAGTGG + Intronic
977372040 4:96149938-96149960 CTGCCTGGTTGCTAAGGAAGAGG + Intergenic
977492598 4:97733692-97733714 CTGAATAAGTTCTAGGGAAGGGG - Intronic
978263314 4:106790232-106790254 GTGACTAGGTCATAAGAAAAGGG + Intergenic
981549660 4:145931035-145931057 GTGACTAGGTGCTGAGGCAGGGG - Intronic
983020874 4:162674694-162674716 CTGAACAGGTCCTAAAGAAAGGG + Intergenic
983877529 4:172893940-172893962 CTGACTAGGTCCTAAGGAAGGGG - Intronic
986794024 5:11191727-11191749 CTGGCCAGGACCTAGGGAAGTGG - Intronic
987582859 5:19819533-19819555 CTGACCAGGTCCTAAGGAAGGGG + Intronic
989132935 5:38125490-38125512 CTCACCAAGTCCTAAGGATGAGG + Intergenic
991281852 5:64923402-64923424 CTTAATGGCTCCTAAGGAAGGGG - Intronic
992162870 5:74019520-74019542 CTGACTGGGTGCTGAGGCAGAGG + Intergenic
992351972 5:75939436-75939458 TAGATTAGGTCCTAAGGATGGGG - Intergenic
994897783 5:105726757-105726779 CTGAAGGGCTCCTAAGGAAGGGG - Intergenic
995721783 5:115142825-115142847 CTGATTAGTTCCTAAAGAACTGG - Intronic
997074412 5:130654950-130654972 CTGACTGGTTCCTAAGGCATTGG - Intergenic
1003053286 6:2798553-2798575 GTGACTAGGGCCTGAGGAAGGGG - Intergenic
1009625583 6:66136314-66136336 CTGAATGACTCCTAAGGAAGTGG + Intergenic
1011951485 6:92971391-92971413 CTTCCTAGGTCCCAAGCAAGTGG + Intergenic
1017156796 6:151329737-151329759 CAGACTAGGCACTCAGGAAGTGG - Intronic
1018791344 6:167150446-167150468 TTGATTAGGTCCTGAGGATGGGG + Intronic
1019314408 7:377766-377788 CTGACCAGAGCCTCAGGAAGCGG + Intergenic
1022961307 7:35429416-35429438 TTGAAGAGGTCCTAAGGAAGGGG + Intergenic
1023761317 7:43467654-43467676 CTGGCTCTGACCTAAGGAAGGGG + Intronic
1023820818 7:43979631-43979653 CTGAGCAGGACCCAAGGAAGTGG + Intergenic
1024709259 7:51996513-51996535 CTGAACAGGTTCTAAGTAAGGGG - Intergenic
1026300807 7:69096497-69096519 CTGAATAGGTGGTGAGGAAGTGG - Intergenic
1029749094 7:102533068-102533090 CTGAGCAGGACCCAAGGAAGTGG + Intergenic
1029767037 7:102632172-102632194 CTGAGCAGGACCCAAGGAAGTGG + Intronic
1032482264 7:132256530-132256552 CTTACAAGGTGCTAAGGAGGAGG + Intronic
1033690670 7:143733527-143733549 CTGACCAAGTCCCAAGGAAAAGG - Intergenic
1034909103 7:154978154-154978176 CTGAATAGGGCCTGAGGATGAGG - Intronic
1038189258 8:25304051-25304073 CTCATGAGGTGCTAAGGAAGGGG - Intronic
1038876573 8:31557875-31557897 CTGAACAGGTCGCAAGGAAGGGG + Intergenic
1039041168 8:33410160-33410182 TTGACTAGATCCTAGGGAATAGG + Intronic
1040482670 8:47841066-47841088 CTAATCAGGTCCTAAGGAAGGGG + Intronic
1040811613 8:51460635-51460657 CTGATCAGGTCCTAAAGAAGAGG + Intronic
1041826222 8:62099169-62099191 CTGAATGGCTCCTGAGGAAGGGG + Intergenic
1045438276 8:102185985-102186007 CTGACTAAGTCCTAACCAAGAGG - Intergenic
1046216404 8:111152953-111152975 CTGAATAGCTCCTAAAGAAGAGG - Intergenic
1048812929 8:138304752-138304774 CTGGCTTGGCCCAAAGGAAGTGG + Intronic
1052250800 9:26394635-26394657 CTGAACAGCTCCTAAGGAAGGGG - Intergenic
1052489658 9:29149586-29149608 CTGAACAGCTCCTAGGGAAGAGG + Intergenic
1053661985 9:40290706-40290728 CTGACTAGGTCCTAATGACCAGG - Intronic
1053912435 9:42920870-42920892 CTGACTAGGTCCTGATGACCAGG - Intergenic
1054374111 9:64436942-64436964 CTGACTAGGTCCTGATGACCAGG - Intergenic
1054522624 9:66085578-66085600 CTGACTAGGTCCTAATGACCAGG + Intergenic
1054858357 9:69925012-69925034 CTGGTTAGGGCCTCAGGAAGGGG - Intergenic
1055990791 9:82102957-82102979 CTTCATAGGTACTAAGGAAGGGG - Intergenic
1061264898 9:129499183-129499205 CAGACCAGGTCCTGAGTAAGAGG - Intergenic
1062176639 9:135166889-135166911 CTGACAATGTCCTCGGGAAGGGG - Intergenic
1187601823 X:20839689-20839711 CTCAGCAGTTCCTAAGGAAGGGG - Intergenic
1188061565 X:25607100-25607122 CTGATTAGCTCCTAAGGAAGGGG - Intergenic
1190808692 X:53863543-53863565 CTGAAAAGGTCCTAAAGAAGTGG + Intergenic
1192396809 X:70790384-70790406 TTCAACAGGTCCTAAGGAAGGGG + Intronic
1193200587 X:78685686-78685708 CTGGCTAGGTCTTAAGCAACAGG + Intergenic
1194349584 X:92809234-92809256 CTGAACAGGCCCTAAGGAAGAGG - Intergenic
1196169235 X:112569160-112569182 CTGAATGGTTCCTGAGGAAGAGG - Intergenic
1196542137 X:116922398-116922420 CTGAACAAGTCCTAAGGAAGGGG - Intergenic
1200657902 Y:5925835-5925857 CTGAACAGGCCCTAAGGAAGAGG - Intergenic
1200743038 Y:6876307-6876329 TTGACTACTTCCTGAGGAAGAGG + Intergenic