ID: 983877719

View in Genome Browser
Species Human (GRCh38)
Location 4:172896577-172896599
Sequence CAATTGCAACAAGGAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983877708_983877719 28 Left 983877708 4:172896526-172896548 CCCAGACAAGCATGTCTCCCAGC 0: 1
1: 0
2: 2
3: 13
4: 147
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247
983877716_983877719 0 Left 983877716 4:172896554-172896576 CCTGCACAGGCAGGATGGATCCT 0: 1
1: 0
2: 0
3: 21
4: 188
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247
983877709_983877719 27 Left 983877709 4:172896527-172896549 CCAGACAAGCATGTCTCCCAGCA 0: 1
1: 0
2: 3
3: 12
4: 145
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247
983877715_983877719 1 Left 983877715 4:172896553-172896575 CCCTGCACAGGCAGGATGGATCC 0: 1
1: 0
2: 1
3: 15
4: 171
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247
983877711_983877719 11 Left 983877711 4:172896543-172896565 CCCAGCAGATCCCTGCACAGGCA 0: 1
1: 1
2: 4
3: 38
4: 254
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247
983877712_983877719 10 Left 983877712 4:172896544-172896566 CCAGCAGATCCCTGCACAGGCAG 0: 1
1: 1
2: 6
3: 53
4: 327
Right 983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG 0: 1
1: 0
2: 0
3: 15
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983877719 Original CRISPR CAATTGCAACAAGGAGAACT TGG Intronic
902463216 1:16595537-16595559 GACTTACAACAAGGGGAACTTGG - Intronic
903158299 1:21465186-21465208 GACTTACAACAAGGGGAACTTGG + Intronic
906057771 1:42929882-42929904 CAACCGCAACGAGGAGAACCGGG - Exonic
909872497 1:80760227-80760249 CAAATTCAACAAGGAAAAGTGGG - Intergenic
910041011 1:82851740-82851762 CCATTCCAAAAAGGAGAAATAGG + Intergenic
910058204 1:83057200-83057222 CACTTAGAAGAAGGAGAACTGGG - Intergenic
910414249 1:86981529-86981551 CCATTGCAACTTGGAGAAATTGG + Intronic
911076123 1:93877323-93877345 GAATTGCAACTAGAAGAACCAGG - Exonic
911902638 1:103525411-103525433 GAATAGCAAGGAGGAGAACTTGG - Intergenic
913040015 1:115012809-115012831 CCATTCCAAAAAGGAGAAATTGG - Intergenic
913179430 1:116307089-116307111 CATTTGCAAAAATGAGAACATGG - Intergenic
913321196 1:117589759-117589781 CAATTGCAAGCTGGAGAACCAGG - Intergenic
914687885 1:149998062-149998084 TAATAGCAATAAGGAGAGCTGGG - Intronic
914999457 1:152575132-152575154 CAATTGCAAAAATGACAAATGGG + Intronic
919306912 1:195853215-195853237 CAATAGCAGCAAGGATAACAGGG - Intergenic
919999301 1:202784587-202784609 CAAATGCAAAAGGTAGAACTAGG + Intronic
920269670 1:204753364-204753386 CAGTTGCAACAAGGATATATGGG + Intergenic
921507383 1:215989127-215989149 CAATTTCTATAATGAGAACTAGG - Intronic
922661587 1:227435079-227435101 CAATTGTAACAGGGAGAGCCTGG - Intergenic
923336775 1:232977651-232977673 CATTTGAAACATGGAGAAGTGGG - Intronic
923854955 1:237836529-237836551 TAATTGCCAGAAGGAGAAATTGG + Intergenic
923983655 1:239354966-239354988 CAAGTGCAACCATGAGGACTTGG - Intergenic
1063261497 10:4394253-4394275 CAAAGGCAACAAGGATGACTAGG - Intergenic
1065486716 10:26242858-26242880 AAACTGCAAAAAGGCGAACTGGG - Intronic
1068201696 10:53791669-53791691 CAAGTGTTACAAGGAGAAATTGG - Intergenic
1068400228 10:56518687-56518709 CCATTCCAACTGGGAGAACTTGG + Intergenic
1069057664 10:63861728-63861750 TACTTCCAACAAAGAGAACTAGG - Intergenic
1070064065 10:73016322-73016344 CAAATACAACAAGGAAAAGTGGG - Intronic
1071213602 10:83372913-83372935 CATCTGCAACAAAGAGAACTAGG - Intergenic
1071859406 10:89656816-89656838 CCATTCCAAAAAGGAGAAATTGG - Intergenic
1072196638 10:93121788-93121810 CCATTGGAACAGGGAGACCTGGG + Intergenic
1072435395 10:95409854-95409876 GAATTCCAAAAAGGAAAACTTGG + Intronic
1074271940 10:111962623-111962645 CAATTGCAACAGGGAGGACATGG - Intergenic
1074737715 10:116453226-116453248 CAATTCCAAAAAAGAGAAATTGG - Intronic
1079226582 11:18611390-18611412 CAATTGCACCATTGGGAACTGGG - Intronic
1080391250 11:31848853-31848875 CATTTGGAAGAAGGAGAAGTGGG + Intronic
1080437739 11:32261908-32261930 CCATTCCAAAAAGGAGAAATAGG + Intergenic
1086942726 11:92815179-92815201 GAATTGGAACAAGGAAAACCAGG + Intronic
1088153468 11:106776347-106776369 AAATTACAAAAAGTAGAACTTGG + Intronic
1089026357 11:115274604-115274626 CAACAGCAACAACGAAAACTGGG + Intronic
1090941227 11:131389950-131389972 CAGATGCAACAGAGAGAACTGGG + Intronic
1091520921 12:1241695-1241717 TAAGTGCTACCAGGAGAACTGGG - Intronic
1091557616 12:1586843-1586865 CAATTACAAAGAAGAGAACTGGG - Intronic
1092341399 12:7679436-7679458 CAAATACAACAAGGAAAAATGGG + Intergenic
1093525510 12:20100465-20100487 CTTTGGCACCAAGGAGAACTTGG + Intergenic
1094624200 12:32107118-32107140 GAAATGCAACATGGAGAACAGGG - Intronic
1096344625 12:50834653-50834675 CCATTGCAAATAGGAGAAATCGG - Intergenic
1096347372 12:50861761-50861783 GATTTGCAACAGGCAGAACTGGG - Intronic
1097458977 12:59836264-59836286 CCATTCCAGCAATGAGAACTTGG + Intergenic
1097779163 12:63684106-63684128 TATTTGCAATAAAGAGAACTGGG + Intergenic
1097879699 12:64675711-64675733 CTATTGCTACAAGGAGGATTAGG + Intronic
1098319913 12:69232615-69232637 CAATTCCAAGAAGGAGAGATTGG - Intergenic
1098775013 12:74601282-74601304 CCATTCCAAAAAGGAGAAATTGG - Intergenic
1098908060 12:76181525-76181547 TAATTCCAACAAGGACAAGTGGG + Intergenic
1099890773 12:88586210-88586232 CCATTCCAACAGGGAGAAATTGG + Intergenic
1100084567 12:90893515-90893537 CATTTGCAACATGGAGAATGGGG - Intergenic
1101207676 12:102505073-102505095 CAATTTCAACATGGACAACATGG + Intergenic
1101442137 12:104711838-104711860 TCATTCCAACAAGGAGAAATAGG + Intronic
1101771059 12:107751433-107751455 CAATTCAAACAAGGAGAACATGG - Exonic
1102190779 12:110986517-110986539 CAATTGTAAGAAGGTAAACTTGG + Intergenic
1104392979 12:128406889-128406911 CACTTACAACCAGGAGATCTTGG + Intronic
1106227511 13:27796231-27796253 CATCTGCAAGCAGGAGAACTAGG + Intergenic
1106878219 13:34099746-34099768 TAATTTCAACAATGAGCACTTGG + Intergenic
1107092933 13:36502303-36502325 CAATTGCATCAAGGAATATTAGG - Intergenic
1110469219 13:75840130-75840152 CATTTGGAATAAGGTGAACTTGG + Intronic
1112057980 13:95708148-95708170 AAAATGCACCAAGCAGAACTAGG + Intronic
1112191262 13:97180120-97180142 CAATTGAAACAGAGAGAATTAGG + Intergenic
1112927851 13:104698690-104698712 CAATGACAACAAGGAGAATTCGG + Intergenic
1113121080 13:106924559-106924581 CCATTCCAAAAGGGAGAACTAGG + Intergenic
1115864063 14:37723239-37723261 CCATTTCAACAAGGAGCCCTGGG + Intronic
1117434693 14:55704614-55704636 CAATTCCAGCAAGGAGAATTTGG + Intergenic
1121855801 14:97269047-97269069 CACTTGGAACAAGGAGGACTGGG - Intergenic
1122613148 14:102999362-102999384 CAACTGCAACAATGAGAGCTGGG + Intronic
1126140790 15:45436711-45436733 CAAATGCAACAAGTAAACCTTGG - Intronic
1126936501 15:53714923-53714945 AAAATGTAACAAGCAGAACTTGG + Intronic
1127366277 15:58293682-58293704 TAATAGCAAGAAGGAGAACCTGG + Intronic
1128226117 15:66002422-66002444 AAAGTGGACCAAGGAGAACTTGG + Intronic
1128441852 15:67717476-67717498 CAATGGAAACATGTAGAACTGGG + Intronic
1128769628 15:70272209-70272231 CATGTGCAACCAGGAGACCTGGG + Intergenic
1131162452 15:90116381-90116403 CAACTCCAACAAGGACAAGTGGG + Intergenic
1131414354 15:92240214-92240236 CAAATGCAACAAGAATAAATGGG + Intergenic
1133360431 16:5169609-5169631 CAATACCAACAAGGAGGGCTTGG - Intergenic
1133822372 16:9248134-9248156 CAATTGCCTCAATGAAAACTAGG - Intergenic
1133936029 16:10270090-10270112 CAAATACAACAAGGAAAAATGGG - Intergenic
1137474457 16:48795148-48795170 CCTTAGCAACAAGGACAACTTGG - Intergenic
1137761424 16:50943850-50943872 CAATAGCAACAATGAGTGCTGGG + Intergenic
1137950640 16:52780409-52780431 AATTTGCAAAAAGGAGAATTGGG - Intergenic
1138305743 16:55972866-55972888 CCATTGCAAAAGGGAGAAATTGG + Intergenic
1139645209 16:68324408-68324430 CAGTTGGAAAAAGGAGAACATGG + Intronic
1140303188 16:73777825-73777847 CAACTGCAAGAATCAGAACTGGG + Intergenic
1141391892 16:83671779-83671801 CTATGGCAACAAGTAGAACAAGG + Intronic
1141738324 16:85871065-85871087 CAATGGCAACAAAAACAACTAGG + Intergenic
1142294387 16:89210900-89210922 AAACAGCAGCAAGGAGAACTGGG - Intergenic
1144994248 17:19256236-19256258 CAATTACAACAGGAAGGACTGGG - Intronic
1149101392 17:52910568-52910590 CAAGTACAACTAGGAGAGCTGGG - Intergenic
1149142046 17:53442958-53442980 CAATTGCAACAAAAACAAGTGGG + Intergenic
1149796561 17:59526379-59526401 CAATTGCAACAAGTAGACATTGG + Intergenic
1150773763 17:68062845-68062867 CATTTTCAAAAAGGAGAACCAGG - Intergenic
1151913315 17:77099043-77099065 CCATTGCAATAAAAAGAACTTGG - Intronic
1152364673 17:79848715-79848737 CAATTGGACCAAGGGCAACTTGG + Intergenic
1153541013 18:6155092-6155114 AAATAGCAACAAGGAGAATGTGG + Intronic
1153671669 18:7418118-7418140 CAATTGCAAGAAGATAAACTTGG - Intergenic
1155665851 18:28307461-28307483 CAATTCCAAATAGGAGAAATTGG - Intergenic
1156083730 18:33374067-33374089 CAACTGCAATAAAGAGATCTGGG + Intronic
1156829410 18:41472617-41472639 TATTTGCAACAAGGAGTAATCGG + Intergenic
1158115088 18:53986681-53986703 CAATTGCAAGAGGGAGGACCTGG - Intergenic
1158283524 18:55853109-55853131 AAAGTGCAACATTGAGAACTGGG + Intergenic
1158748583 18:60230811-60230833 CATTTGCAACAAGATGAAGTTGG + Intergenic
1162831855 19:13289797-13289819 CCATTGCAAAAGGGAGAAATTGG - Intronic
1168655291 19:58123132-58123154 CTATTCCAAAAGGGAGAACTTGG + Intergenic
1202678877 1_KI270711v1_random:32972-32994 GACTTACAACAAGGGGAACTTGG - Intergenic
925454317 2:4001702-4001724 CAATTGCAGCAAGGAATACAGGG - Intergenic
926828900 2:16938127-16938149 CAATAGGAACATGGAGAACATGG - Intergenic
930438550 2:51377638-51377660 CCATTGCAAATAGGAGAAATTGG - Intergenic
930444502 2:51452680-51452702 AAAATGCAACAAGGAAAAGTGGG - Intergenic
933467893 2:82679057-82679079 CAATAGCAACAATAAGCACTGGG + Intergenic
934700362 2:96434770-96434792 CAAAGGCAACAAGGAAAAGTGGG - Intergenic
934793189 2:97080827-97080849 CAATTGCTACAAGAAGAATAAGG - Intergenic
934813001 2:97299716-97299738 CAATTGCTACAAGAAGAATAAGG + Intergenic
934824694 2:97408764-97408786 CAATTGCTACAAGAAGAATAAGG - Intergenic
935324681 2:101925392-101925414 CCATTCCAAAAAGGAGAAATTGG - Intergenic
936984539 2:118296631-118296653 CCATTGCAAATGGGAGAACTTGG + Intergenic
939577903 2:143918185-143918207 CCATTGCAAGATGGAGAACCAGG + Intergenic
939986893 2:148838109-148838131 CCATAGGAACAAAGAGAACTGGG - Intergenic
940103507 2:150070298-150070320 CATTACCAACAAGGAAAACTGGG + Intergenic
940228831 2:151428817-151428839 CTCTTGCAACTAGAAGAACTTGG + Exonic
940969624 2:159881593-159881615 CAAGTGAAACAAGGAGCACCAGG + Intronic
941286025 2:163613170-163613192 CAATGGGAAAAAGGAGAACAGGG - Intronic
945076062 2:206040551-206040573 CAATTCCAACCACGAGAGCTTGG - Intronic
948161071 2:235825096-235825118 CAATTTCAACAAGGAGAAACAGG - Intronic
1169951159 20:11044955-11044977 CAATTGCAAAAAGGTGAGTTAGG + Intergenic
1173021558 20:39271858-39271880 CAATAACAACAAGGATAACAAGG + Intergenic
1176121254 20:63455569-63455591 CAAGTGCAAAGAGGAGAAGTTGG + Intronic
1177188563 21:17824432-17824454 CCATTGCAAAAGGGAGAAATTGG + Intergenic
1178994377 21:37385055-37385077 CAATTGTGACAAGCAGAAGTTGG + Intronic
1179050633 21:37885979-37886001 GAATTGCACCAAGGAGTCCTGGG + Intronic
1179198895 21:39195450-39195472 CAATGGAAACCAGGAGATCTTGG + Intronic
1181614514 22:24043919-24043941 CCATTCCAACAGGGAGAAATAGG + Intronic
1182945392 22:34316791-34316813 CCATTCCAAAAGGGAGAACTTGG - Intergenic
950665177 3:14490908-14490930 CAAGTGCAACAAAGAAAACAAGG - Exonic
950794774 3:15501872-15501894 CCATTACAACAAGGACAAGTGGG - Intronic
951385847 3:22041373-22041395 GAATTGCAAGTTGGAGAACTGGG + Intronic
951448336 3:22808042-22808064 AACTTGCAACTAGGAGAATTAGG + Intergenic
951477016 3:23117899-23117921 CAAATACAACAAGGACAAGTGGG + Intergenic
951640446 3:24829658-24829680 CAATAGCAATAAAGGGAACTTGG - Intergenic
952304892 3:32136931-32136953 CACATCCAACAATGAGAACTTGG + Intronic
953520483 3:43637512-43637534 CAATAGCATCACGGAGAATTAGG + Intronic
954259252 3:49426815-49426837 CAATTTCAACAAGTATCACTAGG + Intronic
955422007 3:58748316-58748338 CAATTCCAGCAAGGAAAGCTGGG + Intronic
955833160 3:63026189-63026211 CCATTGCAAAAGGGAGAAATTGG + Intergenic
959536204 3:107488150-107488172 AAATTGCTACAAGGTGTACTGGG - Intergenic
960478236 3:118157846-118157868 CAATTCCAAATGGGAGAACTTGG + Intergenic
961406812 3:126685404-126685426 CAATTCCAAAACGGAGAAATTGG - Intergenic
961604968 3:128086816-128086838 CAATTCCTACAGGGACAACTGGG + Intronic
962162512 3:133013897-133013919 CCATTCCAAAAAGGAGAAATTGG - Intergenic
964505168 3:157391203-157391225 CAATGGTCACAAGGAAAACTTGG + Intronic
966626199 3:182019719-182019741 GAATAGGAACAAGTAGAACTTGG - Intergenic
970645137 4:18111304-18111326 CAACTGCAACAACTAGAATTAGG + Intergenic
971559200 4:28053787-28053809 CACTGGCAAAAGGGAGAACTGGG + Intergenic
972553999 4:40162815-40162837 CATCTGCAAGCAGGAGAACTAGG + Intergenic
973107001 4:46352284-46352306 CAATTCCAAACAGGAGAGCTTGG - Intronic
974025274 4:56728211-56728233 CAATTTCAAAGATGAGAACTCGG + Intergenic
974628409 4:64453196-64453218 CCATTGCAAATAGGAGAAATTGG + Intergenic
977447964 4:97155498-97155520 CAAATACAACAAGGAAAAGTGGG - Intergenic
978615061 4:110586059-110586081 AAATTGCAAAAAGGAAAATTTGG + Intergenic
979517590 4:121628438-121628460 CTATTGCCATAAGGACAACTAGG + Intergenic
981140839 4:141267121-141267143 CTAATACAACAAGGAGAAGTGGG + Intergenic
981608121 4:146562443-146562465 CAAATGCAATAGGAAGAACTAGG - Intergenic
982088366 4:151859418-151859440 AAATTTCAGCAAGGAAAACTGGG - Intergenic
983378276 4:166957777-166957799 CCATTCCAAAAAGGAGAAATTGG - Intronic
983455149 4:167953686-167953708 CCATTCCAACTGGGAGAACTCGG - Intergenic
983736799 4:171071815-171071837 TAATTACATCATGGAGAACTAGG - Intergenic
983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG + Intronic
984987519 4:185345830-185345852 CAATGGGAACAAAGAAAACTTGG - Intronic
985809645 5:2073576-2073598 CCATTCCAAGAAGGAGAAATTGG - Intergenic
986177514 5:5364729-5364751 CAATGGCAGCAACGAGAACCGGG + Intergenic
986250527 5:6053682-6053704 CCATTGCAAAAGGGAGAAATAGG - Intergenic
986601634 5:9478646-9478668 CCATTCCAAAAGGGAGAACTTGG - Intronic
987763644 5:22196734-22196756 CACAGGCAACAAGGAGAAGTAGG - Intronic
989217553 5:38920839-38920861 CAATTGGAAAAAGGATAACATGG - Intronic
989540547 5:42613288-42613310 CAACAGCAGCAAGGATAACTTGG - Intronic
991898365 5:71429820-71429842 CACAGGCAACAAGGAGAAGTGGG - Intergenic
992108237 5:73468315-73468337 CAATTGCAAGTTGGAGACCTGGG + Intergenic
992548358 5:77837566-77837588 GACTAGCAGCAAGGAGAACTTGG + Intronic
992905294 5:81339475-81339497 TAATTTCCACCAGGAGAACTTGG + Intronic
993820188 5:92604613-92604635 AAACTGCAACAGGGAGAATTTGG - Intergenic
994155779 5:96502969-96502991 TAATTGCAAAGAGGAGGACTTGG + Intergenic
994580214 5:101632249-101632271 CCATTGCAAAAAGGATAAATTGG + Intergenic
998352565 5:141511131-141511153 CAATGGCAACAAGAAGAAGTCGG + Exonic
999303896 5:150507748-150507770 CACTGGCAATAAGGATAACTGGG - Intronic
1000255524 5:159534751-159534773 CATTTGTAACAAGGAGAAGAGGG - Intergenic
1000564202 5:162827872-162827894 GAATTGCCACAAGAAGAAATAGG - Intergenic
1001241456 5:170074703-170074725 CAATTAGAACAAGGAGCTCTGGG - Intronic
1002212913 5:177609084-177609106 CATTTGGGCCAAGGAGAACTTGG - Intronic
1003950036 6:11108483-11108505 CAATTGGAGCATGGAGAGCTGGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1006236909 6:32641638-32641660 CAATTGCCATAAGAAGATCTGGG - Intronic
1008096465 6:47344394-47344416 CAAATACAACAAGGAAAAGTGGG + Intergenic
1009058988 6:58374905-58374927 CAATTTCAAAAGGGAGAAATGGG + Intergenic
1009231853 6:61072218-61072240 CAATTTCAAAAGGGAGAAATGGG - Intergenic
1009826161 6:68867851-68867873 CCATTGCAAAAGGGAGAAATTGG - Intronic
1011546114 6:88483253-88483275 CACTTACAACAAGAAAAACTAGG + Intergenic
1014075534 6:117230578-117230600 CTATTGCAAAAGGGAGAAATTGG + Intergenic
1014949244 6:127536196-127536218 CACTCACAACAAGGAGAACTTGG + Intronic
1016009726 6:139126871-139126893 CAAATACAACAAGGAAAAGTGGG + Intergenic
1017943560 6:159075370-159075392 CAATTTCAACAAGGAGTATGGGG - Intergenic
1017986315 6:159445919-159445941 TATATGCAACAAGGAGCACTTGG - Intergenic
1017994239 6:159518303-159518325 ACATTGCAACTAAGAGAACTAGG - Intergenic
1018371063 6:163169170-163169192 CAATTAGAAAAAGGACAACTGGG - Intronic
1018602918 6:165564353-165564375 CAAATGCAAGAGGGAGAACAAGG + Intronic
1020614196 7:10438182-10438204 CAATTCAAAGAAGGAGAATTGGG + Intergenic
1021577270 7:22115987-22116009 AAAGTCCAACCAGGAGAACTTGG + Intergenic
1022697372 7:32721613-32721635 CATATGGAACAAAGAGAACTTGG - Intergenic
1022934629 7:35160101-35160123 CATATGGAACAAGGAGAAATTGG - Intergenic
1022938086 7:35201751-35201773 TATTTGCAATAAAGAGAACTAGG + Intergenic
1023555359 7:41416709-41416731 CAGTTGCAAAAAGGATAAGTGGG - Intergenic
1024018312 7:45339676-45339698 CAATTACAACAAGAAAAAGTTGG + Intergenic
1024754901 7:52518338-52518360 CCATTCCAAAAAGGAGAAATTGG + Intergenic
1024926249 7:54618679-54618701 CAATTCCAACAGGGATAAGTTGG + Intergenic
1026793877 7:73353313-73353335 GAATTGGAACAAGGATATCTTGG + Intronic
1027940752 7:84676018-84676040 AAACTGCACCACGGAGAACTTGG - Intergenic
1029830569 7:103252881-103252903 CATATGGAACAAGGAGAAATTGG - Intergenic
1031822554 7:126522596-126522618 AGATAGCCACAAGGAGAACTGGG - Intronic
1035545002 8:473533-473555 CAAGTACAAAAAGGACAACTAGG - Intergenic
1039811643 8:41054359-41054381 CCATTCCAACAAGGACAATTGGG - Intergenic
1040945854 8:52883418-52883440 CAATTCCAAAAGGGAGAAATTGG + Intergenic
1041360728 8:57051016-57051038 CAACTCCAACAAGGATAAGTGGG - Intergenic
1041361246 8:57056366-57056388 CAACTCCAACAAGGATAAGTGGG - Intergenic
1042195309 8:66227116-66227138 CCATTGCAAGAGGGAGAACTAGG + Intergenic
1042295680 8:67215055-67215077 TCATTGCAAAAAGGAGAAATTGG - Intronic
1042711537 8:71722747-71722769 CAATTGCCTGAAGGAGAAATGGG - Intergenic
1043665350 8:82803937-82803959 CTATTGCACCAAAGAGAATTAGG + Intergenic
1044326987 8:90869634-90869656 CTATTCCAAAAAGGAGAAATCGG - Intronic
1046863123 8:119117162-119117184 CCATTCCAAAAAGGAGAAATTGG + Intergenic
1048571518 8:135660908-135660930 CCATTGCAAAAGGGAGAAATAGG + Intergenic
1049502737 8:142976153-142976175 CTATTCCAAAAAGGAGAAATAGG - Intergenic
1051251005 9:15158650-15158672 CAATTGTAACTAAGAGAACAGGG - Intergenic
1052665979 9:31496262-31496284 CAATTCCAAAATGGAGAAATTGG + Intergenic
1057431454 9:94998258-94998280 CATTTCCAACCAGGAGACCTAGG + Intronic
1059506394 9:114803465-114803487 CCAGGGCACCAAGGAGAACTTGG - Intronic
1186170028 X:6867117-6867139 CAATTGGAAAATGGAAAACTTGG - Intergenic
1186478323 X:9876711-9876733 CAATTGCAACAAGTCAAACAAGG - Intronic
1186513653 X:10149928-10149950 CAACTGCAACAAGTAAAATTTGG - Intergenic
1188104344 X:26131419-26131441 AAATTGGAACCAGGACAACTGGG - Intergenic
1188703578 X:33297673-33297695 GATTTGCAACAAGGTGAACTTGG + Intronic
1189213447 X:39303667-39303689 CCATTCCAACAGGGAGAAATTGG - Intergenic
1190980255 X:55451329-55451351 CAATTGGAATAAGAAGCACTGGG - Intergenic
1191608071 X:63083078-63083100 CAACTGCAACCAGGAGAAGTAGG + Intergenic
1194376345 X:93137920-93137942 CAATTCCAAAAAAGAGAAATAGG - Intergenic
1194499253 X:94659312-94659334 CAATTCCAAATAGGAGAAATTGG - Intergenic
1194528996 X:95020635-95020657 CAAATGCAAAACAGAGAACTGGG + Intergenic
1195585945 X:106565694-106565716 CAATGGGAACAAACAGAACTGGG + Intergenic
1196048277 X:111278846-111278868 TAATTGTAAGAAGGAGGACTGGG - Intergenic
1196778280 X:119360626-119360648 CAATGGCAAGAAGGAGGAATAGG + Intergenic
1196905053 X:120423318-120423340 CAATTGCAAGAAGCACATCTTGG - Intergenic
1197015510 X:121621120-121621142 CCATTGCAAATAGGAGAAATTGG + Intergenic
1197750186 X:129958449-129958471 CGACTACATCAAGGAGAACTTGG - Intergenic
1197755485 X:129991198-129991220 CACTTGAAACAAGGAGAAGGAGG - Intronic
1197881135 X:131167915-131167937 TTATTGCAACAATGAGAACTGGG - Intergenic
1197995525 X:132368391-132368413 TAAATACAACAAGGAAAACTGGG - Intergenic
1201302817 Y:12524890-12524912 CAATTGCAACAAGTCAAACAAGG - Intergenic
1201560371 Y:15309903-15309925 CAATTGGAAAATGGAAAACTTGG - Intergenic