ID: 983877822

View in Genome Browser
Species Human (GRCh38)
Location 4:172897245-172897267
Sequence AGTCCTCTGATTGCAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983877822 Original CRISPR AGTCCTCTGATTGCAACAGG AGG Intronic
900284693 1:1893488-1893510 AGTGCTCACACTGCAACAGGGGG - Intergenic
900872885 1:5317206-5317228 AGACCTGTGATTTCTACAGGTGG - Intergenic
902205403 1:14864734-14864756 CGTCCTCTGAATGCAACAGCAGG - Intronic
910354187 1:86336164-86336186 AGTCATCTGATTGCTACTGGTGG - Intergenic
915028578 1:152856287-152856309 ATTACTTTGATTGCAGCAGGGGG + Intergenic
915922033 1:159983160-159983182 CCTCCTCTGATGGGAACAGGAGG - Intergenic
916619069 1:166476066-166476088 AGTCCTCTGGTTTCAGAAGGAGG + Intergenic
917050834 1:170920667-170920689 AGTTTTCTGACTGCAGCAGGAGG - Intergenic
917176998 1:172246314-172246336 GCTCCTCTGATTGCAGCAAGTGG - Intronic
917517709 1:175721890-175721912 TGTCCTGTGATTGCAAGAGAGGG - Intronic
919154010 1:193737787-193737809 ATTGCTCTGATTTCAAAAGGGGG - Intergenic
919228764 1:194744965-194744987 CTTCCTCTGATTGGAAAAGGAGG - Intergenic
921206973 1:212857854-212857876 AGTCCTCAGACTGCAGGAGGAGG - Intergenic
923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG + Intergenic
924238476 1:242019236-242019258 AATGCTGTGATTGCAAGAGGAGG - Intergenic
1064307446 10:14180463-14180485 AGTCTGCTGATTCCAACGGGAGG + Intronic
1065782620 10:29184171-29184193 TGTCCCCTGATTGCAATAGATGG - Intergenic
1072563146 10:96595581-96595603 CGTCCTCTGGGTGGAACAGGTGG + Exonic
1081921140 11:46778562-46778584 ATTCCTCTGGTTGGAGCAGGTGG + Exonic
1081984231 11:47290002-47290024 CGTCCTCTGACTGCACCATGCGG - Exonic
1082210723 11:49498259-49498281 AGTTTTCTGATTGCAACAAGAGG - Intergenic
1085219879 11:74864904-74864926 AGTTCTCTGATTGCAGCTGGAGG - Intronic
1085219928 11:74865171-74865193 AGTAACCTGATTGCAGCAGGAGG - Intronic
1086638915 11:89126533-89126555 AGTTTTCTGATTGCAACAAGAGG + Intergenic
1088934315 11:114383700-114383722 TTTCCTCTGATGGCATCAGGAGG - Intergenic
1090101400 11:123800802-123800824 TCTCCTCTGATTGGAAAAGGAGG + Intergenic
1092669085 12:10842044-10842066 AGGCCTCTGATCTCAACATGAGG - Intronic
1099520204 12:83650667-83650689 AGTTCCCTGATTGTAGCAGGAGG - Intergenic
1101720087 12:107343417-107343439 AGTGTTCTGATTGCTAAAGGTGG + Intronic
1103472560 12:121193471-121193493 ATTCCTCTGAGTCCAACAGGAGG + Intergenic
1103900241 12:124300098-124300120 AGTCCTTTGCTTGCCACAGGGGG - Intronic
1108436295 13:50404712-50404734 TGTCCTCTGATTGCAAAGGGTGG + Intronic
1113056381 13:106272447-106272469 AGTCCCCAGATGGAAACAGGAGG - Intergenic
1115380101 14:32726916-32726938 AGTCCTCTGCCTGAAACAGTGGG + Intronic
1115821827 14:37221279-37221301 TGTCATCTCATGGCAACAGGTGG + Intronic
1125006725 15:34824961-34824983 AGTCCTTTGCTTGCAGCATGAGG - Intergenic
1125178871 15:36858636-36858658 ATTCCACTGACTGCAACAGGTGG - Intergenic
1125356879 15:38825769-38825791 AGTACTCTGATTTCCACTGGGGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1132128143 15:99248307-99248329 GGTCCTGTGTTTGGAACAGGAGG - Intronic
1132645555 16:997767-997789 AGTCATCTTCTTGCAAAAGGCGG + Intergenic
1137812304 16:51364488-51364510 AGACCTCTGATTTCATCATGTGG - Intergenic
1138788805 16:59877907-59877929 AGGGCTCTGATTGAAATAGGTGG + Intergenic
1141200266 16:81892326-81892348 GTTACTCTGATTGCAACAGAAGG + Intronic
1141547997 16:84785245-84785267 TGTCTTCTGATGGAAACAGGAGG - Intergenic
1142612194 17:1115165-1115187 AGTCATCTGATGTCAGCAGGAGG - Intronic
1147627290 17:41908346-41908368 AGGCCTCTGAGTGTACCAGGAGG + Intronic
1151582641 17:74988828-74988850 TGTCCTCAGATGGCAACTGGGGG - Intronic
1152875111 17:82781944-82781966 TGCCCTCTGCTGGCAACAGGTGG - Intronic
1153232301 18:2950463-2950485 TGGCCACTGAGTGCAACAGGTGG + Intronic
1155310514 18:24518465-24518487 ATGCCTCTGATAGCGACAGGAGG - Intergenic
1156103683 18:33630221-33630243 AGTCCTCTTATGGAAACAAGAGG - Intronic
1156687452 18:39667120-39667142 AAAACTCTGATTGAAACAGGTGG - Intergenic
1165605702 19:37101981-37102003 AGTTCTATGACTGCAACAGGAGG + Intronic
927304373 2:21553854-21553876 AGTCCTCTGATTCCAGCTAGTGG - Intergenic
927391751 2:22604018-22604040 AGTCCTCTGATTTTTGCAGGAGG - Intergenic
931197958 2:60070983-60071005 AGTCCTTTGATAGCAGCAGTTGG + Intergenic
931268038 2:60677989-60678011 AGTCCTATGATTGTAAGAGTGGG + Intergenic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
932093097 2:68824271-68824293 AGTCCTCTGAATCCATCAGTTGG + Intronic
936607242 2:113970848-113970870 AGTTCTCTGTTTGGAAGAGGTGG + Intergenic
944260194 2:197668283-197668305 AGTCCTCTGATAGCATGAGCAGG + Intronic
946203677 2:218087932-218087954 AATCCTCTGATATCAAAAGGAGG + Intronic
946456391 2:219830119-219830141 AGTCCTCAGACAGCAACAGTAGG + Intergenic
948443531 2:238013780-238013802 ATTCCTCTAATTGTAACAGTGGG + Intronic
948710970 2:239825336-239825358 ACTCCACAGATGGCAACAGGTGG + Intergenic
1168961220 20:1871345-1871367 AGTCTTCTGAGTGCAGGAGGGGG + Intergenic
1170914747 20:20611822-20611844 CTCCCTCTCATTGCAACAGGAGG + Intronic
1172611584 20:36256447-36256469 AGGCCTCGGAATGGAACAGGTGG - Exonic
1175753855 20:61516923-61516945 AGTCCTGTGTTTGTAACATGGGG + Intronic
1176654319 21:9576305-9576327 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1181256441 22:21565947-21565969 AGTACTCTGATTGGAAAATGGGG - Intronic
1184019238 22:41809438-41809460 AGTGCTCTGATGGGCACAGGAGG + Intronic
950463245 3:13138218-13138240 AGTCCTCGGCTTGCCACTGGAGG + Intergenic
952722409 3:36546872-36546894 AGTCCTCTGAGTACATCTGGTGG + Exonic
953468543 3:43146753-43146775 AGTGATCTCATTGCAACAGGTGG + Intergenic
955478703 3:59366951-59366973 TGTCCTCAGATGGCAAAAGGTGG - Intergenic
957171691 3:76745327-76745349 GGTTCTTTGATTGCAACAGCTGG + Intronic
959269919 3:104193643-104193665 AGTCCTCTGAGGGCAACAAATGG - Intergenic
963503607 3:146159205-146159227 AGTCCTCAGATTTAAACAGTGGG + Intronic
964928162 3:161982457-161982479 AGTTCATTGATTGCATCAGGAGG + Intergenic
967606363 3:191451778-191451800 AGTTCCTTGACTGCAACAGGAGG + Intergenic
967606382 3:191451916-191451938 AGTTTTCTGAATGCAACAAGAGG + Intergenic
970523035 4:16904413-16904435 AGTCATCTCATTGCAAGATGGGG + Intergenic
971436381 4:26629108-26629130 AGTTCTCCTATTGCAACAAGTGG - Intronic
975594444 4:76035371-76035393 ATGCATCTGATTGCAACAGATGG + Intronic
980878855 4:138689084-138689106 ATTCCTCTTATTGCAAAAAGCGG - Intergenic
983877822 4:172897245-172897267 AGTCCTCTGATTGCAACAGGAGG + Intronic
985122944 4:186661855-186661877 AGGCCTCGGCTTGCAACTGGTGG + Intronic
987735215 5:21831515-21831537 AGTTCCCTGATTTCCACAGGTGG - Intronic
988588874 5:32531638-32531660 AGTCCTCTTAGTGCACCAGAAGG + Intronic
988731829 5:33980213-33980235 AGTCCACTGATTGGAGTAGGAGG - Intronic
996407443 5:123119552-123119574 ATTCCTCTAATTCCAAGAGGGGG - Intronic
996470267 5:123852395-123852417 AGTTCTTTGACTGCAACAAGAGG + Intergenic
1002412794 5:179096618-179096640 AGTTCTCTGATTGCAGTGGGAGG + Intergenic
1003293831 6:4806132-4806154 AGTCCTCTGAGGTCAGCAGGAGG + Intronic
1003599634 6:7505210-7505232 AGTTCTATGATTGCAACACTGGG + Intergenic
1003958060 6:11184238-11184260 AGGCCTCTACTTGCAACTGGCGG + Exonic
1004258510 6:14086984-14087006 AGTTCTCTCATTGCAAAATGGGG - Intergenic
1004840586 6:19579627-19579649 AGTCTTCTGATTGCACAAGAAGG + Intergenic
1007062713 6:38956267-38956289 AGTTCCCTGACTGCAGCAGGAGG - Intronic
1008211028 6:48726342-48726364 AGTTTTCTGACTGCAGCAGGAGG + Intergenic
1008253150 6:49265171-49265193 CGTACTCTGTTGGCAACAGGTGG - Intergenic
1011103983 6:83758530-83758552 AGTTCTCTGACTGCAGTAGGAGG + Intergenic
1011748619 6:90433345-90433367 AGCTCTCTCATGGCAACAGGTGG - Intergenic
1015017972 6:128437375-128437397 TGTCCTCAGAATGCAAGAGGAGG - Intronic
1016814023 6:148287090-148287112 AGGTCTCTGATGGCATCAGGAGG + Intronic
1019053816 6:169205630-169205652 AGTTCTCTGATTGTAGCAGAAGG - Intergenic
1019053839 6:169205768-169205790 AGTTCTCTGATTGTATCAGAAGG - Intergenic
1019069426 6:169330833-169330855 AGTCCTCTTATGAGAACAGGTGG + Intergenic
1019107640 6:169681982-169682004 AGTTCCCCGATTTCAACAGGAGG - Intronic
1022861129 7:34368096-34368118 GGTACTATGATTGGAACAGGTGG + Intergenic
1024060975 7:45698533-45698555 AGTCCTGCCAATGCAACAGGTGG - Intronic
1027681471 7:81227503-81227525 ATTCCTCTGACTGCTACAGTTGG - Intergenic
1028068986 7:86426316-86426338 AGTTCTCTGATTGCCAGATGAGG - Intergenic
1030190597 7:106806748-106806770 AGTCCTTTGATGGCAATAGCAGG - Intergenic
1034229256 7:149508479-149508501 CATTCTCTGATTGCAGCAGGAGG - Intergenic
1035842451 8:2827143-2827165 AGTCCTCTGAGTGCAAAGGACGG - Intergenic
1037476988 8:19267733-19267755 AGTCCTCTGAGGGCTACAGTCGG - Intergenic
1044932117 8:97260528-97260550 ACTCCTTTGATTGCTAAAGGAGG + Intergenic
1050460949 9:5876926-5876948 AGTGCTGTGACTGCAACTGGCGG + Intergenic
1055075654 9:72212631-72212653 ATTCCTCTGATTACTCCAGGTGG - Intronic
1055135565 9:72824936-72824958 AGTATACTGATAGCAACAGGAGG - Intronic
1057340760 9:94199038-94199060 AGTCCTCAGAGTGTGACAGGGGG - Intergenic
1061014188 9:127972507-127972529 TGTCCTCTGAGAGCACCAGGAGG + Intronic
1203632040 Un_KI270750v1:79763-79785 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1185713546 X:2323376-2323398 AGTACTCTGAGTGTAACAGATGG - Intronic
1189143178 X:38627893-38627915 AGTCCTCTGGTGGCCACAGTAGG + Intronic
1192905708 X:75547899-75547921 AGTCCTCAGAGTGCAATAAGGGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1199380377 X:147165360-147165382 AGTTCTTTGATTAAAACAGGAGG + Intergenic