ID: 983884805

View in Genome Browser
Species Human (GRCh38)
Location 4:172968505-172968527
Sequence CTTTTTTTGTAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 701}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983884805_983884810 22 Left 983884805 4:172968505-172968527 CCCTCCTCCCTCTACAAAAAAAG 0: 1
1: 0
2: 4
3: 63
4: 701
Right 983884810 4:172968550-172968572 CAATCTAAAATATAACACTGAGG 0: 1
1: 0
2: 2
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983884805 Original CRISPR CTTTTTTTGTAGAGGGAGGA GGG (reversed) Intronic
900317095 1:2062494-2062516 TTTTTTTGGCAGAGGGGGGACGG + Intronic
901273730 1:7974139-7974161 ATTTTTTTGTAGAGGTCGGTGGG - Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
903727510 1:25461571-25461593 CTTTTTTTTGAGGGGGGGGAAGG - Intronic
904050077 1:27633727-27633749 ATTTTTTTGTAGAGACAGGACGG + Intronic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
905568241 1:38983147-38983169 TTTTTTTTGTGGGGGGAGGCGGG - Intergenic
905759339 1:40541197-40541219 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
906097964 1:43236902-43236924 CTTTTTTTTTTGGGGGGGGATGG - Intronic
906115958 1:43357530-43357552 TTTTTTCTGTAAAGGGAAGATGG + Intergenic
906528291 1:46509074-46509096 TTTTTTTTGCGGAGGGGGGATGG + Intronic
906855401 1:49298644-49298666 CTTATTTTCAAGAAGGAGGAGGG - Intronic
907127952 1:52068678-52068700 TTTTTTTTGGTGGGGGAGGAGGG - Intronic
907416616 1:54318770-54318792 ATATCTTTGTAGTGGGAGGAGGG - Intronic
907480149 1:54740166-54740188 TTTTTTGGGTAGTGGGAGGAGGG - Intronic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908459431 1:64335027-64335049 GATTTTTTCTGGAGGGAGGAGGG - Intergenic
908633821 1:66139724-66139746 TTTTTTTTTTTGAGGGGGGAGGG - Intronic
908674280 1:66584944-66584966 CTTTTTGTTTTGAGGGAGAAGGG - Intronic
909646398 1:77921905-77921927 ATTTTTTTGTAGAGACAGCAGGG - Intronic
909888661 1:80974601-80974623 TTTTTTTTCTAGAGAAAGGAGGG + Intergenic
909979570 1:82082611-82082633 CTAGTTTTGAAGATGGAGGAAGG - Intergenic
910504646 1:87936001-87936023 TTTTTTTTGAGGAGGGGGGACGG - Intergenic
910559821 1:88578397-88578419 CTTTCTTTGTGGTGGGAGGCAGG - Intergenic
911026388 1:93440005-93440027 TATTTTTTGTAGAGGCAGGAGGG + Intergenic
911114516 1:94232937-94232959 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
911655585 1:100439282-100439304 TCTTTTTTGTAGGGGAAGGATGG + Intronic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
912246652 1:107967151-107967173 TTTTTTTTGTGGGGGGTGGACGG + Intergenic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912759717 1:112356352-112356374 TTTTTCTTGTAGAGGAAGGAGGG - Intergenic
913270661 1:117090033-117090055 CCTTTTTTGTTGAGGAAGAAGGG - Exonic
913421425 1:118673943-118673965 ATATTTTTGTAGAATGAGGATGG - Intergenic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
913571373 1:120123472-120123494 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914024307 1:143898565-143898587 CTTTTTTTTTGGGGGGGGGACGG - Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914226497 1:145723580-145723602 CTTTTTTTATGGGGGCAGGAAGG + Intronic
914292184 1:146284449-146284471 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
914553228 1:148735232-148735254 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914766538 1:150642529-150642551 GTTGTTTTGTAGAGGCAGGGGGG - Intergenic
914991196 1:152501027-152501049 ATTTTTGGGAAGAGGGAGGAAGG - Intergenic
915193477 1:154171646-154171668 GTTCTATGGTAGAGGGAGGAGGG - Intronic
915426674 1:155833338-155833360 CTTTTTTTGCAGTGGGAGAATGG - Intronic
915921193 1:159976868-159976890 CTTTTTTTTTAGAGAGATGGGGG - Intergenic
916179106 1:162069383-162069405 TTGTTTTTGGAGAGGGGGGAGGG - Intergenic
916229946 1:162531690-162531712 CTTTTTTTTTAGACGGAGCCTGG - Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917065332 1:171086851-171086873 CTTTTTTTGTAGAGTAGAGATGG - Intergenic
917099997 1:171435462-171435484 TATTTTTTGTAGAGACAGGACGG - Intergenic
917905538 1:179584289-179584311 TTTTTTTTGGAGGGGGAGGTAGG - Intergenic
918003171 1:180517561-180517583 CTTTTTTTGGGGAGCGGGGATGG + Intergenic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918062003 1:181069964-181069986 CTCTTTTTGCACAGGCAGGAGGG + Intergenic
918678366 1:187319381-187319403 CTTTCTTTATGGAGTGAGGAGGG + Intergenic
919258823 1:195162642-195162664 TTTTTTTTTTAGTGGGGGGAGGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920454969 1:206093843-206093865 TTTTTTTGGTCGGGGGAGGAGGG + Intronic
920970169 1:210736537-210736559 ATTTTTTTTTGGAGGGGGGATGG - Intronic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
921084905 1:211780305-211780327 CTACTGTTGTAGAGAGAGGATGG + Intronic
921156072 1:212439853-212439875 CTTTTTTTGTGGGGGGGGGACGG - Intronic
921724145 1:218506004-218506026 CTTTTTTTGTAGAGACCTGAAGG + Intergenic
921920696 1:220666108-220666130 GTTTTTTTGGAGATGGAGGGGGG - Intergenic
922136324 1:222830682-222830704 CTTGTTTTAAAGAGGGTGGAAGG - Intergenic
922238213 1:223737183-223737205 CTTTTTCTGGAGAGGAAGCAAGG + Intronic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
923148748 1:231215778-231215800 CTTTTTTTGGAGGGAGAGGAAGG + Exonic
923414762 1:233745830-233745852 CTTTTCCTGTTGGGGGAGGATGG + Intergenic
923478583 1:234360645-234360667 CTCTTTTTGTAGAGAAAGGATGG - Intergenic
923921022 1:238564843-238564865 CTTGTTTTGGAAGGGGAGGATGG - Intergenic
923985309 1:239375336-239375358 CTTTTTTTTAAGAGAGAGGGGGG + Intergenic
924064683 1:240209253-240209275 TTTTTTTTTTGGAGGGGGGACGG + Intronic
924121597 1:240805201-240805223 TTTTTTTTGTAGAGACAGGGTGG - Intronic
924236397 1:242002922-242002944 TTTTTTTTGGAGGGGGCGGAGGG + Intergenic
924774811 1:247108706-247108728 CTATTTTTGTAATAGGAGGAAGG + Intergenic
1063559898 10:7116109-7116131 CATTTTTTGTAGAGACAGGCTGG - Intergenic
1063600535 10:7476645-7476667 TTTTTTTTGTAGAGACAGGCTGG - Intergenic
1064112097 10:12548462-12548484 TTTTTTTTGCTGGGGGAGGAGGG + Intronic
1064620468 10:17211427-17211449 ATTTTTTTTAAGGGGGAGGATGG - Intergenic
1064716643 10:18183404-18183426 CTTTATTTGCAGTGTGAGGATGG - Intronic
1065705855 10:28471040-28471062 CTTTCTTTGTAAAGGCAGGAGGG + Intergenic
1066121211 10:32289411-32289433 CTTTTTTTGCAGGGGGAGGCGGG - Intronic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1066617528 10:37310439-37310461 CTTTTTTTTTAGATGGAGTCTGG - Intronic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1069015634 10:63426201-63426223 ATTTTTTTGTAGAGAGAGGGTGG - Intronic
1070174553 10:73959020-73959042 CTTTTTTTGGAGTGGGAGACAGG + Intergenic
1070240605 10:74676480-74676502 CTTTTTTTGGAGGGGGAGATGGG + Intronic
1071065311 10:81626399-81626421 CTTTTATTTTAGAGAGAGTATGG - Intergenic
1071604552 10:86976089-86976111 TTTTTTTTGTAGAGACAGGGAGG + Intronic
1072201354 10:93161671-93161693 TTTTTTTTGTGGAGGGGGCAGGG - Intergenic
1072695180 10:97598139-97598161 CTTTTTTGGTAGAGACAGGTAGG + Intronic
1074097678 10:110328373-110328395 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1075112522 10:119598613-119598635 CTTTTCTTGAAGATGGAGGATGG - Intergenic
1075118976 10:119651035-119651057 TTTTGTTTGTACAGGAAGGACGG + Intergenic
1075172023 10:120124454-120124476 CTTTTTTTTTTGAGGTAGGGAGG + Intergenic
1075984197 10:126769122-126769144 GTTTTTTTTATGAGGGAGGAAGG - Intergenic
1076231327 10:128822236-128822258 CTCTTTTTGTAGGAGGAGCAGGG - Intergenic
1077240832 11:1509634-1509656 CTTTTTTTGGGGAGGGGTGATGG - Intergenic
1077964513 11:7114350-7114372 CCTTTTTTTTAGAGAGAGGGGGG - Intergenic
1078628403 11:12979599-12979621 TTTTTTTTTTAGTGAGAGGAAGG - Intergenic
1078635997 11:13050868-13050890 CATTTTTTGAAGAGAGAGGAAGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079684242 11:23336878-23336900 CTTTTTTTTTACACTGAGGAGGG + Intergenic
1080197543 11:29630034-29630056 TTTTTTTGGTTGGGGGAGGAGGG + Intergenic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1081103770 11:39038431-39038453 CTGTTTATGTAGAGCAAGGATGG + Intergenic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081791325 11:45788472-45788494 GTTTTCTTGTTGGGGGAGGAGGG + Intergenic
1082283018 11:50290995-50291017 CATACTTTGTAGAGGGAGGTAGG + Intergenic
1083242327 11:61398073-61398095 ACTTTTTTCTAGAGGGAGGAAGG + Intronic
1085995935 11:81914146-81914168 CTTTTTTTTTAGATGGAGTCTGG + Intergenic
1086180842 11:83949807-83949829 TTATTTTTTTAGAGGCAGGAAGG - Intronic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087647176 11:100821596-100821618 TTTTTTTTGTGGTGGGAGTAGGG - Intronic
1087694687 11:101363200-101363222 CTTATTTTGTAGAGGATTGAGGG - Intergenic
1088139225 11:106595554-106595576 CTTTTTTTGTAGAGGGGTGGGGG + Intergenic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1088277775 11:108106822-108106844 TTTTTTTTGGAGGGGGAGGCTGG - Exonic
1088720923 11:112591026-112591048 CTTTATTGGGAAAGGGAGGAGGG - Intergenic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1088941785 11:114466845-114466867 CTTTTATTGCAGGGGGAAGATGG + Intergenic
1089236842 11:117036009-117036031 CCTTTTCTGGAGAGGGATGAAGG + Intronic
1089243250 11:117098842-117098864 TTTTTTTTGTTAAGGGAGGTTGG - Intergenic
1089290065 11:117432255-117432277 GTTTTTTTTTAAAGGGAGGAGGG - Intronic
1089319673 11:117616630-117616652 CTTTTTTTGGTTGGGGAGGAGGG + Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1090142020 11:124275645-124275667 TTTTTTTTGTAGAGGTGGCAGGG + Intergenic
1090172691 11:124618638-124618660 CTTTTTTTGGAGTGGGGGGGTGG + Intronic
1091077297 11:132632256-132632278 TTTTTTTTTTGGAGGGAGCAAGG + Intronic
1091841456 12:3624193-3624215 CTTTTCAGGTTGAGGGAGGAAGG + Intronic
1093600669 12:21017835-21017857 TTTTTTTTGCGGGGGGAGGAGGG + Intronic
1093853824 12:24074036-24074058 CTTTTTTTTTTGAGGGATGTAGG - Intergenic
1094147600 12:27246344-27246366 CTTTTTGTTAAGAGGGAGAAAGG + Intronic
1094455146 12:30623838-30623860 CTGATTTTGAAGACGGAGGAAGG - Intergenic
1094573449 12:31662321-31662343 GGTTTTTTGTAGAGGTTGGAGGG - Intronic
1094640481 12:32270107-32270129 TTTTTTTTTTAGAGGGAGTCTGG - Intronic
1095334979 12:41013010-41013032 CTCTTTCTGTAGAGGGAGAGGGG + Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096116763 12:49059762-49059784 GTTTTTTTGTGGGGGGAGGGTGG - Intronic
1097312877 12:58140483-58140505 CTTTAATTATATAGGGAGGAAGG - Intergenic
1097541246 12:60946307-60946329 CATTCTTTGGAGAGGGAGAAGGG + Intergenic
1098612166 12:72472199-72472221 ATTTTATTGTAGAGGTAGGGGGG - Intronic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1098773250 12:74581777-74581799 CGTTTTTGGAAGAGGGAGGAGGG - Intergenic
1099293454 12:80801384-80801406 CTCGTTTTGAAGATGGAGGAAGG + Intronic
1099499593 12:83397038-83397060 ATTCTTTTGTTGGGGGAGGAAGG + Intergenic
1100124885 12:91411992-91412014 TTTTTTTGGAAGGGGGAGGATGG + Intergenic
1100419454 12:94417390-94417412 CTTTTCTGGTAGAGGAAAGAGGG - Intronic
1100828144 12:98493821-98493843 TATTTTTTGTAGAGGGATGGTGG - Intronic
1100844223 12:98643478-98643500 TTTTTTTTCTGGCGGGAGGAGGG - Intronic
1100985972 12:100201941-100201963 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1101908955 12:108848644-108848666 CTTTTCTTGTGTAGCGAGGAAGG + Intronic
1102427729 12:112857508-112857530 CTGGTTTTGAAAAGGGAGGAAGG + Intronic
1102444835 12:112993953-112993975 GTTTTTTTGTGGGGGGGGGAGGG + Intronic
1102841631 12:116131202-116131224 CTTATTTTGGAGAGAAAGGAAGG + Intronic
1103093920 12:118117872-118117894 TTTTTTTTTTAGACGGAGGCTGG - Intronic
1103841106 12:123865496-123865518 TTTTTTTTGTAGAGAGAGCTAGG + Intronic
1103869904 12:124084030-124084052 TCTTTTTTTTAGGGGGAGGACGG + Intronic
1104300200 12:127558004-127558026 CTTCTTTAGTAGAGGCAGGATGG - Intergenic
1105652845 13:22399449-22399471 TTTTTTTTAAAGAGGGAGAAAGG + Intergenic
1105949907 13:25220410-25220432 TTTTTTTTTTGGAGGGGGGACGG - Intergenic
1106437302 13:29734635-29734657 GTTTTTTTGGTGAGGGAGGGTGG - Intergenic
1106511505 13:30417359-30417381 TTTTTTTTGAGGTGGGAGGATGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107201616 13:37726189-37726211 CTTTTTTTTTTGGGGGGGGACGG - Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107519330 13:41163596-41163618 TGTGTTTTGTAAAGGGAGGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108089540 13:46833536-46833558 TTTTTTTTGTAGAGACAGGGAGG + Exonic
1109189263 13:59306045-59306067 ATTTTTCTGTGGACGGAGGATGG - Intergenic
1109650056 13:65313280-65313302 CTTTGATTGAAGAGGGAGGTAGG + Intergenic
1110210630 13:72968170-72968192 CTTTTTTTGGAGACGGAGTCTGG - Intronic
1110283153 13:73719139-73719161 CTTTTTGTGGAAAGGTAGGAAGG + Intronic
1110314443 13:74089216-74089238 CTTTTTTTGTAGGGGGCGGGTGG - Intronic
1110317852 13:74132115-74132137 CTTTTTTCCTTGAGGGAGGGGGG + Intronic
1110549629 13:76797927-76797949 TTTTTTTTGTGGTGGGTGGAGGG + Intergenic
1110738733 13:78969243-78969265 TATTATTTGTAGAGGCAGGATGG - Intergenic
1111343615 13:86919898-86919920 TTTTTTTTTTAGAGGGAGTCTGG - Intergenic
1112517341 13:100065940-100065962 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1112786457 13:102956946-102956968 CTTTTGTGTTAGAGGGTGGAGGG - Intergenic
1112991189 13:105515613-105515635 TTTTTTTGGTGGAGGGAGAAAGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113352735 13:109545243-109545265 TTTTTTTTGGAGGGGGTGGATGG - Intergenic
1113544066 13:111132830-111132852 TTTTTTTTTTAGAGGAAGGTGGG + Intronic
1115559009 14:34566090-34566112 CTTTTTTTTTAAAGAGAGGCTGG - Intronic
1115580197 14:34750269-34750291 GTTTTTTTCTAGAGAGAGAAGGG - Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1115754108 14:36516805-36516827 TTTTTTTTTTGAAGGGAGGACGG - Exonic
1116006650 14:39299056-39299078 TTTTTTTTTTAGAGGCAGGGAGG - Intronic
1116381863 14:44278787-44278809 CTTATTTTGTACAGGGATCAGGG + Intergenic
1116575099 14:46564179-46564201 CATTTTCTGTGGTGGGAGGAAGG - Intergenic
1117058485 14:51936718-51936740 TTTTTTTTGTAGAGACAGGTTGG + Intronic
1117705049 14:58457042-58457064 CTTCTGTTGGAAAGGGAGGAAGG + Intronic
1117814205 14:59580491-59580513 CTAGTTTTGAAGATGGAGGAAGG + Intergenic
1118218993 14:63837740-63837762 ATTTTTTTGTAGAGACAGGGGGG - Intergenic
1118311994 14:64700732-64700754 TTTTTTTTGTAGAGGTGGGGTGG + Intergenic
1118846469 14:69551179-69551201 CTTTTGTGGTAGTGGGAGCATGG - Intergenic
1119302021 14:73579069-73579091 CTTTTTTTTGAGATGGAGGCTGG - Intergenic
1119655213 14:76412591-76412613 CCTTCTTTGTTGGGGGAGGATGG - Intronic
1119908001 14:78323016-78323038 CTTTATTTGTAGAGGCATTATGG - Intronic
1121769847 14:96524101-96524123 CTTTTTTTTGAGAGGAAGGGGGG + Intronic
1121856048 14:97271040-97271062 CTTTCTTTATAAAGAGAGGATGG - Intergenic
1121927450 14:97941298-97941320 CTTTTTTTTTGCATGGAGGAAGG + Intronic
1122606802 14:102952173-102952195 TTTTTTTTGTAGAGAGTTGAGGG - Intronic
1122733538 14:103820668-103820690 TTTTTTTTGTAGAGACAGGGTGG + Intronic
1123957887 15:25358371-25358393 ATTTTTTGGTGGAGGGAGGCAGG - Intronic
1124560232 15:30766694-30766716 TTTTTTTTTTAGAGGGAGGCTGG + Intronic
1125438556 15:39675039-39675061 CTTTTTTTTTAAAGGGGGGGTGG + Intronic
1126613051 15:50549117-50549139 TTTTTTTGGTAGACGGAGGGTGG - Intergenic
1126670643 15:51112431-51112453 CTTTTTTTGCAGGGGGATGATGG + Intergenic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126743569 15:51802206-51802228 TTTTTTTTTGAGGGGGAGGAAGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127821921 15:62665867-62665889 CTTTTAATTTAGTGGGAGGATGG - Intronic
1127866059 15:63034009-63034031 CTTCCTTTGAAGAGGTAGGAGGG - Intergenic
1128129171 15:65214416-65214438 CTCTTTCTGTAGTGGGAGGCAGG + Intergenic
1128207367 15:65865230-65865252 CATTTTTTGTAGAGATAGGGGGG + Intronic
1128269028 15:66293059-66293081 CTTTTTTTGTAGAGATGGGAGGG - Intergenic
1128335575 15:66783819-66783841 CTCTTGTTGTAGGGGCAGGACGG + Intergenic
1128499478 15:68217928-68217950 CCTTGCTTGTAGTGGGAGGATGG - Intronic
1129023539 15:72546922-72546944 CTTTTTTTTTGGAGGGGGGGGGG + Intronic
1129424471 15:75454147-75454169 TTTTTTTCGCGGAGGGAGGAGGG - Intronic
1129555800 15:76507516-76507538 TTTTTTTTGAAAAGGGAGTAGGG + Intronic
1129768308 15:78184353-78184375 TTTTTTTTGTAGAGACAGGGGGG + Intronic
1129951876 15:79599302-79599324 CTTTTTTTGGGGAGGGGGGCAGG - Intergenic
1130070089 15:80639830-80639852 CTTGTAGTGAAGAGGGAGGATGG + Intergenic
1130247844 15:82269575-82269597 TTTTTTTGGTGGAGGGTGGAGGG + Intronic
1130453640 15:84081684-84081706 TTTTTTTTGTTGGGGGAGGACGG + Intergenic
1130629699 15:85554328-85554350 CTTTATTTGGAGAGCTAGGAAGG + Intronic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1131498544 15:92936838-92936860 TTTTTTTTTTTGATGGAGGAGGG + Intronic
1132087998 15:98923580-98923602 CTTTTTTTGTTGAGGGACTGGGG + Intronic
1132183955 15:99787376-99787398 CTTTTTGTGTTGAGAGAGAAGGG + Intergenic
1132258321 15:100398110-100398132 CTTTTTTTGTGGCGGGTGGTGGG + Intergenic
1132434425 15:101785765-101785787 CTTTTTGTGTTGAGAGAGAAGGG - Intergenic
1133561266 16:6952637-6952659 TCTTTTTTTTGGAGGGAGGAGGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1133816942 16:9204705-9204727 TTTTTTTTGTAGAGATAGGGAGG + Intergenic
1133834607 16:9356000-9356022 ATTTTTTTTTAGGGGGAAGAAGG + Intergenic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134076252 16:11293642-11293664 TTTTTTTGGTCGGGGGAGGAGGG - Intronic
1134289509 16:12892460-12892482 TGTTTCTTGAAGAGGGAGGAGGG - Intergenic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135649147 16:24190358-24190380 GTTTTCTTGTTGTGGGAGGAGGG + Intronic
1135751311 16:25060685-25060707 TTGTTTTGGTAGAGGGAGAAAGG + Intergenic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136175562 16:28514180-28514202 CTTTTTTTGCAGGGGGAGCGGGG - Intergenic
1136331428 16:29580111-29580133 TTTTTTTTTTAATGGGAGGAGGG - Intergenic
1136446060 16:30319861-30319883 TTTTTTTTTTAATGGGAGGAGGG - Intergenic
1136577890 16:31135125-31135147 CTTTCCTCGGAGAGGGAGGAGGG - Intronic
1137246248 16:46707996-46708018 CTTTTTTTGGGGAGGGGGTAGGG + Intronic
1137806450 16:51310784-51310806 TTTTTTTTGCAGTGGGGGGAGGG - Intergenic
1137949923 16:52774032-52774054 CTGATTTGGTAGAGAGAGGAGGG - Intergenic
1138244797 16:55459625-55459647 ATTTTTTTGTAGGGGGAGGGAGG - Intronic
1138450380 16:57090537-57090559 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1138657819 16:58500976-58500998 CTTATTTTGTAGGTGGGGGAAGG + Intronic
1138675523 16:58648523-58648545 CTTTTTCTGTAGTGGGAGGGTGG + Intergenic
1139869345 16:70092503-70092525 CTTTTTTGGGAGATGGAGGGAGG + Intergenic
1139918206 16:70441010-70441032 CTTTTAATGTGGAGGGAGGAGGG - Intergenic
1140066171 16:71613224-71613246 TTTTTTTTGTAGAGAGAGATAGG - Intergenic
1140214498 16:72996546-72996568 CTCTTTTTGTAGAGAGTTGATGG - Intronic
1140240563 16:73196156-73196178 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1140386038 16:74539710-74539732 CTTTTTTGGGAGATGGAGGGAGG - Intronic
1141243204 16:82282246-82282268 TTTTTTTTCTGGAGGAAGGAAGG + Intergenic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1143044258 17:4064047-4064069 AATTTTTTGTAGATGGAGGGGGG + Intronic
1143602343 17:7956239-7956261 CTTTTTTTGGTGGGGGAGGTGGG - Intergenic
1143928930 17:10400196-10400218 TTTTTTTTGGAGCGGGGGGATGG - Intronic
1144062341 17:11594561-11594583 CTTTCTCTGTAGAGAGAGGGGGG - Intergenic
1145124942 17:20292334-20292356 CTTTTTTTTTGGGGGGGGGACGG + Intronic
1145612355 17:25594617-25594639 CTCTTTTTGTAGAGGCTGCAAGG + Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1145855848 17:28156558-28156580 CTTTTTTTGTGGGAGGGGGAGGG + Intronic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146102897 17:30003087-30003109 TTTTTTTTGTAGCGGGGGGGGGG + Intronic
1146351906 17:32102181-32102203 TTTTTTTGGTAGGGGGAGGTGGG + Intergenic
1146736795 17:35244869-35244891 CTTTTTTTATGGTGGGGGGAGGG - Intronic
1147002342 17:37372883-37372905 TTTTTTTTGGTGGGGGAGGATGG + Intronic
1147226147 17:38979366-38979388 TTTTTTTTTGAGACGGAGGATGG + Intergenic
1147352124 17:39857682-39857704 CTTTTATAGTAAAGGGGGGAAGG - Intronic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148500131 17:48083818-48083840 TTTTTTTTTTGGAGGGGGGATGG - Intronic
1148737674 17:49874018-49874040 CTTTTTATGGAGATGGAGGTGGG - Intergenic
1149246281 17:54712180-54712202 CTTATTCTTTAGAGGGAGAATGG - Intergenic
1149595627 17:57862966-57862988 TTTTTTTTTTAAAGGGAGGTTGG + Exonic
1149597123 17:57870853-57870875 CTTTTTTGGTAGAGATAGGGGGG + Intronic
1149626900 17:58085808-58085830 CTGTTTTTTTAGGGGAAGGAAGG + Intronic
1149709366 17:58725984-58726006 TTTTTTTTGCAGGGGGTGGATGG - Intronic
1149732281 17:58958214-58958236 TTTTTTTTTTAGAGAGAGAAAGG + Intronic
1150539940 17:66087602-66087624 ATTTTTCTGTGGAGGGACGAGGG - Intronic
1150571551 17:66391341-66391363 CTTTTCTTGGAGGAGGAGGAAGG - Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150834783 17:68554612-68554634 CTTTTCTTGTTGTGGGTGGATGG + Intronic
1151853123 17:76703005-76703027 CTTCTCTTGAAGTGGGAGGATGG + Intronic
1152024052 17:77797236-77797258 TTTTTTTTCAAGAGTGAGGAGGG - Intergenic
1152253961 17:79226685-79226707 CCTTTTTGGTAGAGTGGGGATGG + Intronic
1152798979 17:82322365-82322387 CTTCTTCTGCAGGGGGAGGAAGG + Exonic
1152866866 17:82729372-82729394 GTTTTTGTGTGGAGTGAGGAAGG + Intronic
1153186545 18:2492612-2492634 CTTTTTTTTAATAGGAAGGAAGG - Intergenic
1153284921 18:3448728-3448750 TTTTTTTTTTTGAGGGAGGGTGG + Intronic
1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG + Intergenic
1153538308 18:6127582-6127604 CTATTTTAGTAGAGAGAGAAAGG - Intronic
1153552883 18:6280818-6280840 CTAGTTTTGAAGATGGAGGAAGG + Intronic
1153669499 18:7397252-7397274 TTTTTTTTGTTGGGGGGGGACGG + Intergenic
1154942126 18:21124563-21124585 ATTTTTTTGTAGAGAGGGTAAGG + Intergenic
1155456275 18:26017969-26017991 ATTTTTTTGTAAGGGGAAGAGGG - Exonic
1155719086 18:28988099-28988121 TTTTTTTTTTTGGGGGAGGATGG + Intergenic
1157013138 18:43677330-43677352 CTTTTTTTGTATAGGGTGAGAGG - Intergenic
1157155330 18:45259966-45259988 TTTTTTTGGTAGAGGGGGAATGG + Intronic
1157971031 18:52269418-52269440 CCTTTTGTGTAGAGTGAGAAAGG + Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1158300259 18:56044045-56044067 CTTTGGTTGTAGCAGGAGGATGG - Intergenic
1158394316 18:57067858-57067880 CTTTTCTTGAAGATTGAGGATGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1158740043 18:60130902-60130924 CTTTTTTATTAAAGGTAGGAGGG - Intergenic
1160226259 18:77013842-77013864 CTTTTTATGTGGAGGAAGTAAGG - Exonic
1161045845 19:2134240-2134262 TATTTTTTGTAGAGGCAGGGAGG - Intronic
1161338334 19:3726680-3726702 CTATTTTTATAGAGACAGGAGGG - Intronic
1162094643 19:8303126-8303148 TTTTTTTTGGAGAGGGAGTCTGG + Intronic
1162111581 19:8402666-8402688 TTTTTTTTGTCGGGGCAGGATGG + Intronic
1162241821 19:9361380-9361402 TTTTTTCTGGAGAGGGAGGTTGG - Intronic
1162639531 19:11997227-11997249 CTTTCTTTGGGGAGGAAGGAGGG - Intergenic
1163239768 19:16053600-16053622 CTTTTTTTGTGGGGGGAGGGGGG + Intergenic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164131742 19:22369320-22369342 CTTTTTTTGAGGCGGGAGGAGGG - Intergenic
1165178011 19:33944232-33944254 TTTTTTTTGTAGATGGAGTCCGG + Intergenic
1165320638 19:35083208-35083230 ATTTTTTTTTTGAGGGGGGATGG + Intergenic
1165366343 19:35369087-35369109 CTGTTTTTGTAGAATGAGTAGGG - Intergenic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166770225 19:45277445-45277467 TTTTTTTTGTAGAGACAGGCTGG + Intronic
1168723472 19:58568238-58568260 CTTTTTTTTTGGTGGGGGGAGGG - Intronic
925130023 2:1488245-1488267 CGCTTCTAGTAGAGGGAGGAGGG + Intronic
925940526 2:8813327-8813349 CATTTTTTGTTTAGGGAGGATGG - Exonic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928116728 2:28550534-28550556 TTTTTTTTTTGGTGGGAGGAGGG + Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929159256 2:38815234-38815256 ATTTTTTTGTAGAGAGATGAGGG + Intronic
929291809 2:40201101-40201123 CTTTTTTTTTTGAGGGAGTGGGG - Intronic
929470436 2:42187037-42187059 CTTTTTTTGGAGCGGGGGGGTGG + Intronic
929978306 2:46655845-46655867 ATTTTTTTGTAGAGGCAGGCTGG - Intergenic
930457748 2:51628219-51628241 CTTTTTTTGTTGGGGGAGGTGGG + Intergenic
930685538 2:54303353-54303375 CTTTTTTTTTGGAGGGGGGAGGG - Intronic
930955422 2:57197436-57197458 CTTTTCTTGAAGACGGAGGACGG - Intergenic
931436307 2:62250302-62250324 AATTTTTTGTAGAGACAGGAAGG - Intergenic
931674401 2:64679646-64679668 CTCTTTTTGAAGGGGGAGGGTGG - Intronic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932680669 2:73822059-73822081 TTTTTTTTGTGGGGGTAGGAGGG - Intergenic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
933364361 2:81330609-81330631 AGTGTTTTGTAGAGGGTGGAAGG - Intergenic
934072432 2:88396858-88396880 TTTTATTTTTGGAGGGAGGATGG - Intergenic
935059115 2:99592929-99592951 CTTTTTTTGGGGGGGGGGGAGGG - Intronic
935841099 2:107111323-107111345 TTTTTTTTTTAAAGGCAGGACGG + Intergenic
935902080 2:107803767-107803789 CTTTTTTTTTAGACGGAGTCTGG + Intergenic
935973546 2:108555194-108555216 CTTTATTTTTTGAGGGGGGAGGG + Intronic
936376702 2:111947272-111947294 CTTTTTTTGTGGGGGGCGGGTGG - Intronic
936624946 2:114138732-114138754 CTTTTTTTTTAGGGGAAGGTGGG + Intergenic
937047636 2:118860191-118860213 TTTTTTTTTTGGAGGGGGGAAGG + Intergenic
937240774 2:120460994-120461016 CTTTCCTGATAGAGGGAGGATGG + Intergenic
937670616 2:124533734-124533756 CTTTGTTTGTAGTGGGAAGCAGG - Intronic
937930254 2:127199280-127199302 ACTTTTTTGGAGCGGGAGGATGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938760696 2:134423245-134423267 CCTCTTTTGTAGAGGAAGCAGGG - Intronic
938907565 2:135853273-135853295 GTTTTTTTGTAGAGACAGGGAGG - Intronic
938922488 2:136008105-136008127 CATTTTTTTTAGAGGCAGGCTGG + Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939386599 2:141508079-141508101 CTTTTTTTTTGGGGGGGGGATGG - Intronic
939496525 2:142933512-142933534 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
940210133 2:151248287-151248309 TCTTTTTTGTATAGGGAGGAAGG + Exonic
940265504 2:151831489-151831511 CTTTTTTTTTGGTGGGGGGATGG + Intergenic
940569960 2:155418306-155418328 CTATTTTTACTGAGGGAGGAGGG - Intergenic
940974276 2:159925956-159925978 CCTTTTTGGTGGGGGGAGGAAGG + Intergenic
941630511 2:167879156-167879178 ATTTTTTTTTAGAGAGAGAAGGG + Intergenic
941655368 2:168138013-168138035 CTTTGTTTGTAGATGGGGAAAGG - Intronic
941706151 2:168660281-168660303 CTTTATTTGGAGAGGTGGGAAGG - Intronic
941855776 2:170228946-170228968 TTTTTTTTGTAAAGGGAATATGG - Intronic
942235925 2:173904842-173904864 TTTTTTTTGTGGGGGAAGGATGG + Intergenic
942513734 2:176729614-176729636 ATTTTTTGGTAGTGGGAGCAAGG + Intergenic
943265415 2:185725678-185725700 CTTTTTTTGTGGGGGAAGGAGGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
944540289 2:200747764-200747786 CTCATTATGTGGAGGGAGGAGGG + Intergenic
944575206 2:201084630-201084652 CTTTTTTTGGCGGGGGCGGATGG - Intronic
944714188 2:202362398-202362420 CTTTTTTTCCAGAGGGAGTCTGG + Intergenic
944776577 2:202972946-202972968 CTTTTTTTGTAAAAGAAGCAGGG + Intronic
944798600 2:203212811-203212833 CTTCTTTTGGAGATGGAGGTAGG + Intronic
945092046 2:206184656-206184678 TTTTTTTTGGTGGGGGAGGAGGG + Intronic
945693899 2:213079053-213079075 TCTTTTTTGTTGAGGGAGAAGGG + Intronic
946137848 2:217662812-217662834 CTTATTTTGTAGAGGAGGAAGGG - Intronic
946300257 2:218819397-218819419 CTTTCTTTATAGAGGAAGGTTGG - Intergenic
946532512 2:220587430-220587452 GTGTTTTTGTAGAGGTTGGAGGG - Intergenic
946973552 2:225122371-225122393 CTTTTTTAATTGAGGGAGAATGG - Intergenic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
947755751 2:232563394-232563416 CTTTTTTTTTAAGGGGAGGGGGG + Intronic
1169437469 20:5605733-5605755 TTTTTTTTGGAGGGGGAGGCAGG - Intronic
1169582505 20:7040044-7040066 CATTTTTTGTTGGGGGAGGTGGG + Intergenic
1170285846 20:14707471-14707493 ATTTTGTTCTAGAGGGAGGCAGG - Intronic
1170349256 20:15421074-15421096 TGTTTTTTTTAGAGGAAGGACGG - Intronic
1170640099 20:18144484-18144506 CTCTTTGTGTATAGGGAGAATGG - Intronic
1171437683 20:25135828-25135850 CTTTTTTTGTAGCTGGAAAAGGG - Intergenic
1172071187 20:32258443-32258465 TTTTTTTTGTAGAGACAGGCTGG + Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1173493783 20:43504529-43504551 ATTTTTTTGTAGAGACTGGAGGG + Intergenic
1174236439 20:49097087-49097109 CTTTTTTTTTATATGGGGGAAGG + Intergenic
1174309054 20:49636233-49636255 ATTTTTTTTTGGAGGGGGGAGGG - Exonic
1174468988 20:50741558-50741580 TTTTTTTTGTGGAGTGGGGACGG + Intronic
1175228063 20:57456541-57456563 GTTTTTTTGTAGAGATGGGAGGG + Intergenic
1175366404 20:58459361-58459383 TTTTTTTTTAAGAGGAAGGATGG + Exonic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176294200 21:5062073-5062095 CTTTTTATTTGGAGGGGGGATGG - Intergenic
1177022099 21:15874810-15874832 CTTTTTTTGGTGGGAGAGGAAGG + Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178852922 21:36228153-36228175 TTTATTTTGTAGAGAGATGAAGG - Intronic
1179139201 21:38709412-38709434 CTTTTTTTTGAGAGGCATGAAGG - Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179863059 21:44201575-44201597 CTTTTTATTTGGAGGGGGGATGG + Intergenic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
1181025932 22:20127686-20127708 CTTTTTTTCTATGGTGAGGAGGG + Intergenic
1182085381 22:27557597-27557619 CTTTTCTTCTTTAGGGAGGAAGG - Intergenic
1182309579 22:29395072-29395094 CATTCATTGTGGAGGGAGGATGG - Intronic
1182496886 22:30715374-30715396 TTTTTTTTGGCCAGGGAGGAGGG + Intronic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183884415 22:40865682-40865704 CTTTTTTTGTGGGGGGCGGGGGG + Intronic
1185093920 22:48795523-48795545 GCTTTTTGGTAGAAGGAGGAAGG - Intronic
1185391454 22:50563530-50563552 CTTTTTTTTCAGAGGGACGTGGG + Intergenic
949375248 3:3381999-3382021 TTATTTTTGTAGGGGGAGGGGGG - Intergenic
949705426 3:6811126-6811148 CTTTTCCTGTAGAGAGATGAGGG - Intronic
949921876 3:9009426-9009448 CTTTTTTTTTGAATGGAGGAAGG - Intronic
950384342 3:12645732-12645754 TTTTTTTTGTAGAGGTGGGGTGG + Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
951000786 3:17557022-17557044 TATTTTGTGTTGAGGGAGGAAGG - Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951074190 3:18369308-18369330 TTTTTTTTGTGGAGGGGGGTGGG - Intronic
951545668 3:23822481-23822503 CTTTTTTTGGTGAGGAAAGAGGG - Intronic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
952861517 3:37816654-37816676 CTTTTCTTGCAGAGGGGAGAAGG + Intronic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
953199528 3:40766490-40766512 GGTTTTTTGTTGAGGGAGGCAGG + Intergenic
953257952 3:41307515-41307537 CTTTATTTGTAGGGGGATGTGGG - Intronic
953331029 3:42053311-42053333 CTTTTTTTCTGGAGGCAGGGAGG - Intronic
954221080 3:49154334-49154356 CTTTCTATGACGAGGGAGGAGGG + Intergenic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955061919 3:55499968-55499990 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
955142521 3:56283561-56283583 ATTTATTTGTAAAGGGTGGAGGG - Intronic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
955373903 3:58378041-58378063 GTTTTTTGCTAGAGGGAGGAGGG - Intronic
956019762 3:64921680-64921702 CTTTTTGTGGATGGGGAGGACGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956760402 3:72438347-72438369 CTTTTTTTTTAGAGGGGGTGTGG + Intronic
956804488 3:72795610-72795632 CTCTCTTTTTAGAGGAAGGAGGG + Intronic
956875770 3:73461564-73461586 CTGTTGTTGTAGGGTGAGGATGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
958163894 3:89854102-89854124 CCTTTTTTGGAGAAGGAGTAGGG + Intergenic
959118449 3:102205817-102205839 CTCTGTTTGTAGAAAGAGGAAGG - Intronic
959714552 3:109417996-109418018 CTTTTTTTCTGGAGGGCGGGGGG + Intergenic
960432089 3:117581633-117581655 CTTTTGTTGTAGCAGGAGGAAGG - Intergenic
960896237 3:122508700-122508722 TTTTTTTTGTGGTGGGTGGAGGG - Intronic
961090811 3:124111146-124111168 CTTTTCTTGTAGTGGCAGGCTGG - Intronic
961722351 3:128905325-128905347 TTTGTTTTGTTGAGGGTGGAGGG + Intronic
961766871 3:129218298-129218320 CTTTTTCTGCAGAAGGATGAGGG + Intergenic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
962116801 3:132518527-132518549 ATTTTTTTGTAGAGGTGGAAAGG + Intronic
962290297 3:134130516-134130538 CTTTTTTTCTTGTGTGAGGATGG - Intronic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
963053683 3:141164853-141164875 CTTTTTTTTTTTAAGGAGGAGGG + Intergenic
963233959 3:142937407-142937429 CTTTTCTTGTAGTGGCAGGATGG - Intergenic
963781502 3:149491281-149491303 TTTTTTTTGTAGAGGGGCGCTGG - Intronic
964095101 3:152922205-152922227 CTTGCTTTGTAGATGAAGGAAGG - Intergenic
964483657 3:157165269-157165291 TTTTTTTTTTAAAGGGGGGATGG - Intergenic
964625314 3:158753146-158753168 TCTTTTTTGTAGAGATAGGATGG - Intronic
964895364 3:161589707-161589729 CTTTATTAGTAGAGTGAGAATGG - Intergenic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
965397080 3:168173010-168173032 CTTTTATTGTAGAGATAGAATGG + Intergenic
965398942 3:168194983-168195005 TTTTTTTTGTAGTGGGGGCAGGG - Intergenic
965486012 3:169279363-169279385 TTTTTTGTGTAGTGGGGGGAAGG - Intronic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965695373 3:171402646-171402668 GTTTTTTTGAAGCTGGAGGAAGG - Intronic
965732913 3:171791780-171791802 GTTTTGTTTTAGAGGGAGGGAGG + Intronic
966168582 3:177050814-177050836 CTTTTTTTTTAGAGGGGTGGGGG + Intronic
966297252 3:178438787-178438809 CTTTTTTTTTTGCGGGCGGAGGG - Intronic
966310107 3:178584432-178584454 TTTCTTTTGGAGAGGGAGGGAGG - Intronic
966503911 3:180678124-180678146 CTTTTTTTGTAAAGCGGAGATGG - Intronic
966737284 3:183196962-183196984 CTTTTTTTGCAGGGCCAGGAAGG + Intronic
968320627 3:197764853-197764875 TTTTTTTTGGGGGGGGAGGATGG + Intronic
969708514 4:8829477-8829499 ATTTTTCTGTACAGGGAGGTAGG - Intergenic
969905908 4:10395953-10395975 AGTTTTTTGTACAGGTAGGAAGG + Intergenic
969925737 4:10584101-10584123 CTTTTTCTGTAGAGGGATTAAGG + Intronic
970382482 4:15522024-15522046 TATTTTTTGTAGAGGTAGGGGGG - Intronic
970950010 4:21743636-21743658 TTTTTTTTGTAGGGGGAGGGGGG + Intronic
971129463 4:23790195-23790217 ATTTTCTTGTAGGGGAAGGATGG - Intronic
971142596 4:23940858-23940880 TTTTTTTTGTAGAGTCTGGAAGG - Intergenic
972037777 4:34548204-34548226 TTTTTTTTTTTGAGGGAGGGGGG - Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
973884446 4:55306419-55306441 CTTTTCTTGTAGAGAGAAAAGGG + Intergenic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974042923 4:56873269-56873291 CTTTTTTTGTAGAGATGAGAAGG + Intergenic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974476634 4:62389778-62389800 TTGTTTTTGTATAGTGAGGAAGG + Intergenic
975327847 4:73080106-73080128 CTTTTTTGGGAGGGGGAGGGGGG - Intronic
975358347 4:73435009-73435031 CATTTTTTTTAGAGGGTGGGAGG + Intronic
975574610 4:75850238-75850260 TTTTTTTTTGAGACGGAGGACGG - Intergenic
976224257 4:82782647-82782669 CTTGTTTTCTTGGGGGAGGATGG - Intronic
977217993 4:94305986-94306008 CTTATCTTGAAGTGGGAGGAGGG + Intronic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977639384 4:99339261-99339283 CTTTTTTTGGAGGGGGATGGGGG + Intronic
978143238 4:105341603-105341625 CTAGCTTTGAAGAGGGAGGAAGG - Intergenic
978727749 4:111989943-111989965 CTTTTATTGTAGTTGGGGGATGG - Intergenic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
979801645 4:124916718-124916740 ATTTTTTTGTAGAGTGGGTATGG + Intergenic
980048824 4:128018455-128018477 TTTTTTTTGTAGAGACAGGGTGG - Intronic
980116462 4:128684286-128684308 TTTTTTTTGGAGAGACAGGAAGG + Intergenic
980227456 4:130004802-130004824 ATTTTTTTGTGGGGGGAGGGTGG - Intergenic
980363942 4:131774581-131774603 CTTTTGTTCTAGAGGGATCATGG + Intergenic
980439100 4:132817718-132817740 CCTTTCTTGTCGGGGGAGGAAGG - Intergenic
981872038 4:149498179-149498201 CTTTTCTTGTTGAGTAAGGAGGG - Intergenic
982042502 4:151409506-151409528 CTTTTATTTTAGAGGGTTGAAGG + Intronic
982475891 4:155850110-155850132 TTTTTTTTTTAAAGGGAGCAGGG + Intronic
982832302 4:160077983-160078005 TTTTTTTTTTAGAGGGAGTTTGG - Intergenic
983066714 4:163218736-163218758 CTTTTTTTGGGGCGGGGGGAGGG + Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984773843 4:183463207-183463229 CTTTTTTTTTGGTGGGGGGATGG + Intergenic
984872258 4:184336253-184336275 TTTTTTTTTTTCAGGGAGGAGGG - Intergenic
985481318 5:112806-112828 CTGGGTTTGTACAGGGAGGAGGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
988100031 5:26663338-26663360 CTTTCTTTTTGGGGGGAGGAAGG + Intergenic
988239191 5:28587315-28587337 GTTTTTTTGTAGTGGGAGGTGGG + Intergenic
988797183 5:34662183-34662205 ATTTTTTTGGAGGGGGAGGAGGG + Intronic
988830654 5:34984024-34984046 CTTCATTTCTAGAGAGAGGAGGG - Intergenic
989002643 5:36776949-36776971 ATTTTTTTGTTGGGGGGGGACGG - Intergenic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
989814862 5:45723510-45723532 ATTTTCTAGTAGAGGGAGTATGG + Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991611201 5:68451139-68451161 CTCTTTTTTTGGAGGGGGGAGGG - Intergenic
992113362 5:73516665-73516687 CTTTTTTTGGAGGAGGGGGACGG + Intergenic
992312917 5:75520853-75520875 CCTTTTTTGTAGTTGAAGGATGG + Intronic
992443968 5:76818595-76818617 TTTTTATTGTAGAGGCAGGTGGG - Intergenic
992523157 5:77577309-77577331 CTTTTTTTTTGGTGGGGGGAAGG - Intronic
993315737 5:86403705-86403727 CTTATTTGGTAGGGGGTGGAGGG + Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993767748 5:91882204-91882226 GTTTTTGTGTAGTGGTAGGAGGG - Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
995133453 5:108655514-108655536 TTTTTTTTGTAGAGACAGGTTGG + Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996577697 5:124994249-124994271 CTTTTTTTGTGGGAGGATGAAGG + Intergenic
997084035 5:130775198-130775220 CTTTTTTTCCAGAGGGTTGAGGG + Intergenic
997478590 5:134165028-134165050 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
997478598 5:134165058-134165080 ATTTTTTTTTTGAGGGGGGAGGG + Intronic
997529918 5:134575710-134575732 TTTTTTTTGTAGAGACAGGCTGG - Intronic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
999038689 5:148383564-148383586 TTTTTTTTTGAGAGGAAGGACGG - Intergenic
999749122 5:154613503-154613525 ATTTTTTTGTAGAGATGGGACGG - Intergenic
1000364665 5:160479659-160479681 CTTTTTTAATCGAGTGAGGATGG + Intergenic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000578064 5:163000818-163000840 TCTTTTTTTTGGAGGGAGGAAGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1000895266 5:166847596-166847618 CTATTTTTGAAGATAGAGGAGGG + Intergenic
1001438412 5:171719113-171719135 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1002542114 5:179913231-179913253 CTTTTGTGGTACAGAGAGGAGGG + Intronic
1003266332 6:4567898-4567920 CTTTTTTGGGAGATGGATGAGGG + Intergenic
1004180116 6:13373867-13373889 CTTTTAATGTATATGGAGGAAGG - Intronic
1004408853 6:15361619-15361641 CTTTTTTTTTGGCGGGAGGGTGG + Intronic
1004794404 6:19064969-19064991 CTTTTGTTGTAAAAGGAAGAAGG + Intergenic
1004924590 6:20404072-20404094 TTTTTTTTCTAGGGGGCGGATGG + Intronic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1006698963 6:35956269-35956291 CTTTTTTTGGGGAGGGGGCAGGG - Intronic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1007211349 6:40195530-40195552 CATTTGATGTAGTGGGAGGATGG - Intergenic
1008648486 6:53540871-53540893 TTTTTTTTGTGGGGTGAGGATGG - Intronic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009924855 6:70107905-70107927 CTTTTATTGGAGTGTGAGGAAGG - Intronic
1010261520 6:73822523-73822545 CTTTTTTTCTAGTGGAGGGATGG + Intronic
1010507565 6:76679030-76679052 ATTTTTCTGTAGGGGGAGGGGGG + Intergenic
1011620677 6:89239573-89239595 TTTTTTTTTTAGTGGCAGGAAGG + Intergenic
1013993130 6:116277895-116277917 TTTTTTTTTGAGACGGAGGACGG - Exonic
1014009684 6:116461780-116461802 TTTTTTTTTTAAAGGGAAGAGGG - Intronic
1014067026 6:117139023-117139045 CATTTATGGTAGAGGCAGGAGGG - Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1015059019 6:128940005-128940027 CTTTTTTTGTAAAGGAACCATGG - Intronic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1015561399 6:134520168-134520190 TTTTTTTTTTTCAGGGAGGAAGG + Intergenic
1015785720 6:136921058-136921080 CTAATTTTGGAGAGGGAGTAAGG - Intergenic
1016478469 6:144454951-144454973 GTTGTTTTCTGGAGGGAGGAAGG - Intronic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1016811660 6:148266917-148266939 CTTTTCTTTTAAAGGGAGGCTGG + Intergenic
1016832429 6:148447082-148447104 ATTTATCTGTAGAGGCAGGAAGG + Intronic
1016833866 6:148457686-148457708 CTTTGTTAGTAGCGTGAGGATGG - Intronic
1016935770 6:149448548-149448570 GTTTTTTTGGTGGGGGAGGAGGG - Intronic
1017056712 6:150443277-150443299 ATTTTTTTTTTGAGGGTGGATGG - Intergenic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018609937 6:165638175-165638197 CTTTTTTGGTGGGGGGAGGGTGG - Intronic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018660794 6:166085708-166085730 CTTTTTTTGTGGAAGAAAGAAGG + Intergenic
1018770202 6:166963669-166963691 GTTTTTTTGTATAGAGATGAAGG + Intergenic
1019036001 6:169059181-169059203 GTTTTTTTGCGGAGGGATGAAGG + Intergenic
1019158926 6:170056815-170056837 CTTTTTCTTAAGAGGCAGGAAGG + Intergenic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021141059 7:17026071-17026093 CTTTTCTTGTAGAAGAAGCAGGG + Intergenic
1021213474 7:17886220-17886242 ATCTTCCTGTAGAGGGAGGAGGG - Intronic
1021213562 7:17886957-17886979 TTTTTTTTGTAGAGCAAGGGAGG - Intronic
1021421404 7:20449222-20449244 TTTTTTTTGGAGGGGGAGGGTGG - Intergenic
1022325010 7:29323156-29323178 CTTTTTTTGTTGGGGGGGAACGG - Intronic
1022612744 7:31893513-31893535 CTTTCTTTGTAGATGAAGAATGG + Intronic
1023139117 7:37083466-37083488 TTTTTTTTATAGAGTGAGTAAGG - Intronic
1023341710 7:39228314-39228336 CTGTTTTTGTAGGCAGAGGATGG + Intronic
1023934269 7:44728097-44728119 GTTTTTTTTTGGAGGGGGGAGGG - Intergenic
1023943909 7:44788171-44788193 TTTTTTTTGTAGAGATGGGAGGG + Intergenic
1024130120 7:46342679-46342701 CTTTTTTTGTCAAAGGAGTATGG + Intergenic
1024932033 7:54674123-54674145 CTTTTTTTGTAAAGAGAAGCTGG + Intergenic
1025795436 7:64735502-64735524 CATTTATTGTAGTTGGAGGATGG - Intergenic
1026375107 7:69742120-69742142 TTTTTTTTTTTGAGGGGGGAGGG + Intronic
1026900883 7:74036815-74036837 TTTTTTTTGGTGGGGGAGGACGG + Intronic
1027119337 7:75505470-75505492 TTTTTTTTGTGGGGGGGGGATGG + Intergenic
1027141452 7:75660746-75660768 CTTTTTTTGTAATGGCAAGAGGG - Intronic
1027228183 7:76257979-76258001 CTTTTTTTCTAGAGGTAGCTGGG - Intronic
1027231533 7:76275486-76275508 TTTTTTTTTTTGAGGGAGCAGGG - Intronic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1028223059 7:88219569-88219591 TTTGTTTTTTAAAGGGAGGAAGG + Intronic
1028398330 7:90396994-90397016 CTTTTTTGGGAGGGGGAGTATGG + Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029818499 7:103122110-103122132 TTTTTTTTGTAGAGACAGGGTGG + Intronic
1029989282 7:104948248-104948270 CTTTTTTTGTAGATCTAGGTAGG + Intergenic
1030278633 7:107745834-107745856 CTTTTTTTGTAGAGGTGAGACGG + Intronic
1030730767 7:112985675-112985697 CTTTTTTTGTAGATTGAAGGTGG + Intergenic
1032104883 7:129019674-129019696 ATTTTTTTGTAGAGGCACGGGGG - Intronic
1032430121 7:131854115-131854137 TTTTTGTGGTAGGGGGAGGAAGG + Intergenic
1032572972 7:133020933-133020955 CTTTTTTGGTGGGGGGAGAACGG + Intronic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033348615 7:140544195-140544217 CTTTATTTGTGGGGGCAGGAGGG + Intronic
1033980133 7:147154095-147154117 TTTTTTTTGTGGGGGGAGGGCGG - Intronic
1034495822 7:151421570-151421592 CTTTTTTTGTAGACTCAGGAAGG - Intergenic
1034639373 7:152590365-152590387 TTTTTTTTGGAGGGGGGGGATGG - Intergenic
1035219636 7:157398361-157398383 CTTTTTTTGGGGAGAGAGGGGGG - Intronic
1035403305 7:158582544-158582566 TTTTTTTTTTTGAGAGAGGACGG - Intronic
1035520153 8:269359-269381 CTTTTTTTCTTGGGGGAGGGTGG - Intergenic
1036131762 8:6121441-6121463 CCTTTTCTGTCTAGGGAGGAGGG - Intergenic
1036391885 8:8330807-8330829 CTCTTCTGTTAGAGGGAGGAGGG - Intronic
1036482829 8:9153279-9153301 TTTTTTTGGTTGGGGGAGGAGGG - Intronic
1036538517 8:9677600-9677622 CTTTTGTTGGAGAGGAAGGTGGG - Intronic
1037109180 8:15145363-15145385 CCATTTTGGTAGAGTGAGGAAGG + Intronic
1037262994 8:17027923-17027945 CTTTTTTTGTAAGAGGGGGAGGG - Intronic
1037520992 8:19680567-19680589 CTTTTTTTGTGGGGGGGGGGGGG - Intronic
1038109540 8:24480044-24480066 CCTTTTTGTAAGAGGGAGGAAGG + Intronic
1038129897 8:24718136-24718158 CTATATTTTTAAAGGGAGGAGGG + Intergenic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038447294 8:27612876-27612898 CTTTTCTGGTAGAAGGAGCAAGG - Intronic
1038608222 8:29032264-29032286 CTTTTTTGGGGGTGGGAGGAGGG + Intronic
1038619179 8:29123813-29123835 CTTTCTTTGTAGGGGGTGGGAGG + Intronic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1038989653 8:32854108-32854130 TTTTCTTTTTAGAGGGAGGTGGG - Intergenic
1039086869 8:33788811-33788833 ATTTTATTGAAGAGGGAGGCTGG - Intergenic
1039953483 8:42190085-42190107 ATTTTTTTGTAGAGGCGGGGTGG + Intronic
1040032804 8:42841575-42841597 CTGTTTTTGTCGAGGCACGATGG - Intronic
1040806560 8:51403074-51403096 TTTTTTTTGGAGAGGGAGTTTGG - Intronic
1041149610 8:54917511-54917533 CTTTTCTTTAAGAGGGAGAAGGG - Intergenic
1041261965 8:56028771-56028793 ATTTTTTTGTAGAGGTGGGGGGG - Intergenic
1041310573 8:56512290-56512312 TTTTTTTTGGTGGGGGAGGATGG + Intergenic
1041812532 8:61927561-61927583 CTTTTATTTTAGAGAGATGAAGG + Intergenic
1042255045 8:66794466-66794488 TTTTTTTTTCAGGGGGAGGAGGG - Intronic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043547745 8:81334369-81334391 TTTTTTTAGTAGAGGCAGGCAGG + Intergenic
1043547757 8:81334468-81334490 TTTTTTTAGTAGAGGCAGGCAGG + Intergenic
1043829369 8:84969730-84969752 GTTTTTTTGTGGGGGGAGGTAGG - Intergenic
1043846505 8:85169873-85169895 CTTTTTTTGTTGAGGTATTAGGG + Intergenic
1043868459 8:85402362-85402384 CTTTTTTTTTTGGGGGGGGATGG + Intronic
1044766828 8:95585181-95585203 CTTTTTTTTTGGGGGGGGGATGG + Intergenic
1044949442 8:97421054-97421076 CTTTTTTTGTCGTGGGAGACAGG + Intergenic
1044986816 8:97763167-97763189 CTTTTTTTGTGGGGGGGGGTTGG + Intergenic
1045185591 8:99834459-99834481 TTTTTTTTCTAGAGGTAGGCAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045630203 8:104110008-104110030 CTTATTTTCTAGAGGGGAGATGG + Intronic
1046362216 8:113175811-113175833 ATTATTTTTTAGAGGGTGGAAGG - Intronic
1046404208 8:113751190-113751212 CATTTTCTCTGGAGGGAGGAGGG + Intergenic
1046508772 8:115171938-115171960 CTTTATTAGTAGTGTGAGGATGG - Intergenic
1048042614 8:130745878-130745900 CTACTGTTGTAGAGGGAGGCAGG + Intergenic
1048131187 8:131699483-131699505 CTTTTTGTGTAGACGTAAGAAGG - Intergenic
1048658947 8:136574455-136574477 CTTTTCTTGGAGATTGAGGAAGG - Intergenic
1050266058 9:3891055-3891077 TTTTTTTTTTTGAGGAAGGAAGG - Intronic
1050305956 9:4306245-4306267 TTATTTTTGTAGAGGCAGGGGGG + Intronic
1051331723 9:16030862-16030884 ATTTTTTTCAAGAGGGTGGAGGG + Intronic
1052097197 9:24397409-24397431 CTTTTTTTGTGGGGGGAGGTGGG + Intergenic
1052400816 9:27997947-27997969 CTTTTTTTGGGGTGGGAGGGGGG + Intronic
1052566624 9:30161304-30161326 CATTTTTTGTCGGGGGAGAAAGG + Intergenic
1053239076 9:36481798-36481820 TTTTTCTTGGAGAGAGAGGAGGG - Intronic
1053789020 9:41673120-41673142 CTTTGTTATTAGAGGCAGGAGGG - Intergenic
1054156121 9:61641641-61641663 CTTTGTTATTAGAGGCAGGAGGG + Intergenic
1054177302 9:61884473-61884495 CTTTGTTATTAGAGGCAGGAGGG - Intergenic
1054660231 9:67696335-67696357 CTTTGTTATTAGAGGCAGGAGGG + Intergenic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1054879246 9:70127677-70127699 TTTTTTTTGTGGGGGGAGGTAGG - Intronic
1055026614 9:71728994-71729016 CTTTTTTTTTGGAGGGTGTAGGG + Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055189797 9:73504133-73504155 CTTTTTTTTTAGAGGCCTGAAGG - Intergenic
1055355770 9:75435696-75435718 CTTATATTTTAGTGGGAGGATGG - Intergenic
1055797488 9:79990766-79990788 CTTTATTTGTTGAGGGTGGGTGG + Intergenic
1056358066 9:85822752-85822774 CTTTTTTTTTGGCGGGGGGATGG - Intergenic
1056809361 9:89752362-89752384 CTTTTTGGGTAGAGGGGTGAGGG + Intergenic
1058235968 9:102490496-102490518 CTTTTTTTGTGAAGGGACGTTGG - Intergenic
1058689654 9:107508702-107508724 CTTTATTTGTAGCAAGAGGAGGG + Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059017975 9:110542815-110542837 CTTCTTTTGGGGAGGGGGGAGGG + Intronic
1060122461 9:121006669-121006691 CTTTTTTTGTAAATGAAGAAGGG - Intronic
1061346896 9:130033662-130033684 TTTTTTTTGTAGAGGTGGGGGGG - Intronic
1061445757 9:130636299-130636321 CTTTTTCTCCAGAGCGAGGAGGG - Intronic
1185850233 X:3478703-3478725 ATTTTACTGTTGAGGGAGGAAGG - Intergenic
1186018542 X:5226990-5227012 TTTTTTTTTGAGAGGGAGCACGG - Intergenic
1186325402 X:8471367-8471389 ATTTTTTTGTGGAGGGGGGAGGG + Intergenic
1186466703 X:9789153-9789175 CATTTTTTGTAGCTGGAGAAAGG + Intronic
1186675591 X:11814041-11814063 CTTCTCATGTAGAGGGAGAATGG - Intergenic
1187797554 X:23020958-23020980 ATTTTTTTCTGGGGGGAGGATGG + Intergenic
1188464541 X:30464868-30464890 CTTTTTTTTTTGAAGGAGGTAGG - Intergenic
1188537244 X:31211081-31211103 CTTTCTTTAAAGTGGGAGGAAGG + Intronic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189297129 X:39926713-39926735 CTTTTTTTTTGGAGAGAGGCAGG - Intergenic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1189490901 X:41471113-41471135 CTTTTTTTGGAGGGGGGGGATGG + Intronic
1189517841 X:41733261-41733283 CTTTTTTTGTAGGAGTAGGCTGG + Intronic
1189846737 X:45145468-45145490 ATTTTTTTGTAGAGGCAACAGGG - Intergenic
1190021723 X:46884564-46884586 CTTTTTTTGTAGATGGGGTGGGG + Intergenic
1190230176 X:48575803-48575825 CTTTTGTTCTAGGGGGTGGAGGG + Intronic
1190243656 X:48676726-48676748 CGTTTTGTGTTGTGGGAGGAAGG - Intronic
1190522616 X:51295670-51295692 CTTTTTTTTCAGAGGTAGGAAGG - Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1192282349 X:69699965-69699987 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
1193021014 X:76793390-76793412 TTTTTTTTTTAAAGGGAGGATGG - Intergenic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194308216 X:92274300-92274322 CTTTTCTTGTAGACGGAGGACGG + Intronic
1194743775 X:97606587-97606609 ATCTTTTTGAAGAGGGAGGGAGG + Intergenic
1195522261 X:105844821-105844843 CCTGTTTTGTAGAGTGAGGAAGG - Intronic
1195658098 X:107352544-107352566 GTTTTTTTGGAGGAGGAGGAAGG - Intergenic
1195935590 X:110123083-110123105 CTTTATGTGTAGTGTGAGGAAGG + Intronic
1196610960 X:117714370-117714392 CTTTTTTTTTTGAGGGAGGTGGG - Intergenic
1196657138 X:118230067-118230089 CTTTTTTTTGAGGGGGAGGAGGG - Intergenic
1197691043 X:129501603-129501625 CTTTTTTTGGGGGGGGAGGTGGG + Intronic
1198039298 X:132834071-132834093 CTTTTTAGGGAGTGGGAGGATGG - Intronic
1198204253 X:134451509-134451531 CTATTTTTCTACAGTGAGGATGG + Intergenic
1199232142 X:145448576-145448598 CTTTTTTTTAAAAGGGCGGAGGG + Intergenic
1199389945 X:147267736-147267758 CTTTTGTTTTAGAGTGAGGCAGG - Intergenic
1199448116 X:147949847-147949869 CTTATTTTGGAGAGATAGGAAGG + Exonic
1199645156 X:149902166-149902188 TTTTTTTTGTGGGGGGAAGAGGG - Intergenic
1200051822 X:153436848-153436870 ATCTTTTTTTAGGGGGAGGAGGG - Intergenic
1200689795 Y:6295534-6295556 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1201045477 Y:9879186-9879208 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1201423910 Y:13828718-13828740 CTTTTTTGGGGGAGGGGGGAGGG + Intergenic