ID: 983886130

View in Genome Browser
Species Human (GRCh38)
Location 4:172982546-172982568
Sequence TGAAGTCTACAATTAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983886127_983886130 5 Left 983886127 4:172982518-172982540 CCTCATGACTGAAAGTCAGAAGA 0: 1
1: 0
2: 1
3: 32
4: 234
Right 983886130 4:172982546-172982568 TGAAGTCTACAATTAGTGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 148
983886125_983886130 29 Left 983886125 4:172982494-172982516 CCAGTCTATACATAAGACAATGG 0: 1
1: 0
2: 0
3: 7
4: 160
Right 983886130 4:172982546-172982568 TGAAGTCTACAATTAGTGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983886130 Original CRISPR TGAAGTCTACAATTAGTGTG GGG Intronic
901354062 1:8627316-8627338 TAATGTCTGCCATTAGTGTGGGG + Intronic
902317747 1:15635843-15635865 TGAAGTATACAATTAATTTTAGG + Intronic
906585979 1:46978513-46978535 TAAAGTCTCCCATTATTGTGTGG - Intergenic
906589321 1:47008956-47008978 TAAAGTCTCCCATTATTGTGTGG - Intergenic
906993828 1:50768332-50768354 TGAAGTCTACTATTATTGTGTGG - Intronic
917207668 1:172594880-172594902 TAAAGTCTCCCATTATTGTGTGG + Intronic
917278129 1:173352550-173352572 GGAAGTGTACAAATAGGGTGTGG + Intergenic
921769201 1:219015314-219015336 TAAAGTCTATAAATAGTGTAAGG - Intergenic
923668733 1:236021744-236021766 TTAAGTCTGCAATTAGTGAGAGG - Intronic
924652517 1:245942515-245942537 TAAAGTCTCCCATTATTGTGTGG - Intronic
924869648 1:248027442-248027464 GGAAGTGTACAAATAGGGTGTGG - Intronic
1068552380 10:58421342-58421364 TAAAGTCTCCCATTATTGTGTGG + Intergenic
1070127548 10:73634402-73634424 TGATGTCTACGCTGAGTGTGGGG - Intronic
1070616523 10:77973616-77973638 TGAGTTCTACAATCAGTGTCAGG - Intronic
1071183938 10:83019255-83019277 GGAAGTGTACAAATAGGGTGTGG - Intergenic
1071932832 10:90492718-90492740 TGAAGTCTCCTATTATTTTGTGG - Intergenic
1072774832 10:98180666-98180688 TAAAGTCTCCCATTATTGTGTGG + Intronic
1077713904 11:4561911-4561933 TGAAGTCTCCCATTATTGTGTGG - Intergenic
1077789568 11:5423790-5423812 AGAAGTCTAAAATTAGTGTAAGG + Intronic
1081431349 11:42979761-42979783 TGAAGTCTCAAATTTCTGTGTGG - Intergenic
1081777175 11:45683593-45683615 TGCAGTCTACAATTACTGCTTGG + Intergenic
1081789679 11:45774156-45774178 TGAATTCTTGAATTAGTGGGAGG - Intergenic
1087898518 11:103613872-103613894 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1087939237 11:104075391-104075413 TTAAATCTACACTAAGTGTGAGG + Intronic
1093241144 12:16676532-16676554 TGAATTCTACAATTCATATGTGG - Intergenic
1095429154 12:42113667-42113689 TAAAGTCTCCCATTATTGTGTGG - Intronic
1096937082 12:55292588-55292610 TAAAGTCAACAATAAGTTTGAGG - Intergenic
1097733374 12:63153720-63153742 TGAAGTCTACAAAGAGTAAGAGG - Intergenic
1098086835 12:66854555-66854577 TGAAGTCTAAGATTATTGTGAGG - Intergenic
1107229283 13:38088018-38088040 TTAACTATAAAATTAGTGTGTGG + Intergenic
1109129346 13:58561643-58561665 TTAAGTATAAAATTAGTCTGGGG - Intergenic
1109644628 13:65237278-65237300 AGGAGTGTACAAATAGTGTGTGG - Intergenic
1109721966 13:66286721-66286743 GGGAGTGTACAAATAGTGTGTGG + Intergenic
1111947120 13:94677697-94677719 TGGAGTCTACAAAAACTGTGGGG + Intergenic
1112964333 13:105168765-105168787 TGAAGTTTATATTTAGTGGGGGG + Intergenic
1113296719 13:108967486-108967508 TCCAGTCTACAAGTAATGTGTGG + Intronic
1114070720 14:19103786-19103808 CATAGTCTACAATTAGTGTTTGG - Intergenic
1114091541 14:19296220-19296242 CATAGTCTACAATTAGTGTTTGG + Intergenic
1114655937 14:24315678-24315700 TGAACTCTACACCTAGTGAGGGG - Exonic
1115004224 14:28461759-28461781 TGAAGTCTAAAATTAAGGTGTGG - Intergenic
1118490360 14:66253234-66253256 TGAAGTCTACACATTGTGTATGG + Intergenic
1119006870 14:70939735-70939757 TAAAGTCTCCCATTATTGTGTGG + Intronic
1125224686 15:37381987-37382009 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1127791889 15:62405587-62405609 TGAAAGCTGCATTTAGTGTGAGG + Intronic
1131788416 15:95937813-95937835 TGAAGTCTAAAATGAGTTTTTGG - Intergenic
1135512310 16:23096380-23096402 TAAAGTCTCCCATTATTGTGTGG - Intronic
1135864844 16:26091887-26091909 TGAGGTCTGCTATTAGTGTGGGG + Intronic
1135897560 16:26421775-26421797 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1137371694 16:47912385-47912407 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1139894458 16:70277234-70277256 TGAACTGCACAGTTAGTGTGTGG - Intronic
1147035241 17:37675098-37675120 TGGAGTTTACAAATAGGGTGGGG + Intergenic
1152435276 17:80272688-80272710 TGAAGGCTAGAGTGAGTGTGGGG + Intronic
1153461807 18:5342884-5342906 TGAACTCACCAATTATTGTGAGG - Intergenic
1153857878 18:9169318-9169340 TAAAGTCTCCCATTATTGTGTGG + Intronic
1154225276 18:12497705-12497727 TGAAATCCACAAGTAGTGGGTGG - Intronic
1157058008 18:44253843-44253865 TAAAGTCTCCCATTATTGTGTGG + Intergenic
1157840508 18:50953958-50953980 TGAAGTCAATAATTAGTGCTTGG - Exonic
1167024304 19:46903982-46904004 AGAAGTATACATTTAGTGAGGGG + Intergenic
930391331 2:50765239-50765261 TGAAGTGAACAATTAGGGTTTGG - Intronic
930638541 2:53831681-53831703 TGAATTATACAATCAGTGGGTGG + Intergenic
931894483 2:66713886-66713908 TGATGGCTACACTTAATGTGGGG - Intergenic
932224650 2:70030037-70030059 TCAAGTCAGCAATTACTGTGTGG - Intergenic
933518381 2:83335414-83335436 TGAAGGCCAAAATTAGTGTTAGG + Intergenic
937051116 2:118891388-118891410 TGAAGTCTACAATGCTGGTGAGG + Intergenic
937432754 2:121853227-121853249 TAAAGTCAACAATTAGTGGCTGG - Intergenic
938559200 2:132456082-132456104 TAAAGTCTCCAATTATTGTATGG + Intronic
939431608 2:142116811-142116833 TGAAGTCTGAAGTCAGTGTGTGG + Intronic
940452816 2:153861358-153861380 TAAAGTCTACAGTTAGTTTGTGG + Intergenic
940713149 2:157186887-157186909 TAAAGTCTACAATTTCTGTCAGG + Intergenic
942434872 2:175960097-175960119 TAAAGTCTCCCATTATTGTGTGG - Intronic
942814713 2:180038525-180038547 TGTAGACTACCAGTAGTGTGTGG + Intergenic
943630804 2:190249896-190249918 TGAAGGCTACATTTGCTGTGTGG - Intronic
945564903 2:211385365-211385387 TGCAGGATACAATTAGTGTTGGG + Intronic
946494534 2:220182544-220182566 TGAAATCTAAAATTAATGTATGG - Intergenic
1170691633 20:18621481-18621503 TGGAGGCTAAAATTAGTGAGTGG - Intronic
1175531646 20:59677260-59677282 TGAAGCCTTCATTTAGTGTCAGG + Intronic
1177928308 21:27247648-27247670 TTAAGTCTTCAAATATTGTGAGG + Intergenic
1178734422 21:35136154-35136176 TGCAGACAAAAATTAGTGTGAGG - Intronic
1180489185 22:15826251-15826273 CATAGTCTACAATTAGTGTTTGG - Intergenic
1183126968 22:35791878-35791900 TGAAGTCAACATTTAGTGTAAGG + Intronic
1184393169 22:44217407-44217429 TCAAGGACACAATTAGTGTGGGG + Intronic
951847930 3:27104383-27104405 TCAAATCTATCATTAGTGTGGGG - Intergenic
952073947 3:29672818-29672840 TAAAGTCTCCCATTATTGTGTGG - Intronic
952104421 3:30052648-30052670 TAAAGTCTCCCATTATTGTGTGG - Intergenic
953433658 3:42860389-42860411 TAAAGTCTCCCATTATTGTGTGG - Intronic
955049079 3:55391241-55391263 TAAAGTCTCCCATTATTGTGTGG - Intergenic
957714364 3:83905984-83906006 TGAAGACCACATTTAGTCTGTGG + Intergenic
959177720 3:102937210-102937232 TGTACTCTACAATTAATGTGGGG - Intergenic
962221490 3:133567986-133568008 TTAATGTTACAATTAGTGTGAGG - Intergenic
966152587 3:176880334-176880356 TGAAGTCTCCCACTATTGTGTGG - Intergenic
967293337 3:187942964-187942986 TGAAGGCTAAAAGTAATGTGAGG - Intergenic
968398516 4:266937-266959 TGAAGTGTATAATTAGATTGTGG + Intergenic
969587148 4:8100854-8100876 TGACGACTACATTTACTGTGGGG + Intronic
971437485 4:26642965-26642987 TAAAGTCTCCCATTATTGTGTGG - Intronic
971624880 4:28906616-28906638 TGAAGTACAGACTTAGTGTGGGG + Intergenic
973753163 4:54044189-54044211 TAAAGTCTCCCATTATTGTGTGG - Intronic
974899485 4:67979955-67979977 TAAACTCTACTATTATTGTGTGG + Intergenic
977008465 4:91603789-91603811 GGAAGTCTAAGATTAGGGTGGGG + Intergenic
977562708 4:98548677-98548699 TGAAGACTAAAAATAGTGGGAGG - Intronic
977735206 4:100406832-100406854 TGAAATCTACTATTATTGTGTGG + Intronic
977812144 4:101368599-101368621 TGATGTCTAACATTAGTTTGGGG - Intergenic
980766416 4:137311537-137311559 TGAAGTCAACAATCAGTTTGGGG - Intergenic
981343332 4:143647686-143647708 TGAAGTCAAGAATTGGTGTTTGG + Intronic
981353531 4:143760610-143760632 TGAAGTCTACAAAAAGTATAAGG - Intergenic
983886130 4:172982546-172982568 TGAAGTCTACAATTAGTGTGGGG + Intronic
988717767 5:33844730-33844752 GGGAGTCTACAAATAGGGTGTGG - Intronic
989623231 5:43405044-43405066 TAAAGTCTCCCATTATTGTGTGG - Intronic
990288364 5:54323906-54323928 AAAAGGCTACAATTACTGTGTGG + Intergenic
991939517 5:71837226-71837248 ACAAGTCTACAAATACTGTGAGG - Intergenic
992073008 5:73165862-73165884 TGAAGGGTACAATGAGAGTGGGG + Intergenic
993341402 5:86729442-86729464 TAAAGTCTCCCATTATTGTGTGG + Intergenic
995660693 5:114479447-114479469 TAAAGTCTCCTATTATTGTGTGG - Intronic
995983145 5:118132872-118132894 TAAAGTCTCCCATTATTGTGTGG + Intergenic
996160755 5:120160656-120160678 TAAAGTTAACAATTAGTGTTAGG - Intergenic
996245653 5:121261242-121261264 TGAAGTCTCCAACTATTGTGTGG + Intergenic
998933647 5:147209682-147209704 TGCAGTGTTCAATTAGGGTGGGG - Intergenic
999017774 5:148127313-148127335 TGAAATTTACAATGTGTGTGTGG + Intronic
1003768923 6:9274969-9274991 TGGTGTCTACAATTAAAGTGAGG - Intergenic
1005648958 6:27868728-27868750 TGAAGTTTACAATTTATGGGAGG + Intergenic
1008358596 6:50586976-50586998 TGAAGTTGTCAATTAATGTGAGG + Intergenic
1011137154 6:84113195-84113217 TAAAGTCTCCCATTATTGTGTGG + Intergenic
1012683216 6:102209600-102209622 AGAAGTCAAGAATTAGTGTTTGG + Intergenic
1012878680 6:104759087-104759109 TAAAGTCTCCCATTATTGTGTGG - Intronic
1013724594 6:113078007-113078029 TGAAGTCAACAAGGAGTGGGAGG + Intergenic
1013860638 6:114631605-114631627 TAAAGTCTCCCATTATTGTGTGG + Intergenic
1014522260 6:122459164-122459186 TGAAAACTACAACTAGAGTGAGG + Intronic
1014600503 6:123405796-123405818 TGAGGATTACAATTAGTATGGGG - Intronic
1015381574 6:132576003-132576025 TGAAGTCCACTATGAGTCTGAGG + Intergenic
1015455105 6:133417800-133417822 TAAAGTCATAAATTAGTGTGAGG + Intronic
1017062350 6:150495807-150495829 TGAATTCTACAATTGGTGGCGGG + Intergenic
1020623979 7:10555849-10555871 TGAAGTCTCCTATTAGTATTGGG - Intergenic
1022929469 7:35095354-35095376 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1028030532 7:85906484-85906506 TCATGTATATAATTAGTGTGAGG + Intergenic
1030422200 7:109321580-109321602 TGATATCTATAATTAGGGTGAGG + Intergenic
1030807373 7:113934326-113934348 TGAAGTCTCCCACTACTGTGTGG + Intronic
1044786445 8:95798826-95798848 TAAAGTCTCCCATTATTGTGTGG + Intergenic
1045035213 8:98171247-98171269 TGCATTCTCCAAGTAGTGTGGGG - Intergenic
1050223230 9:3420603-3420625 TAAAATCTACAGTTAGTTTGGGG - Intronic
1050391019 9:5144583-5144605 TAAAGTCTCCTATTATTGTGTGG + Intronic
1050920417 9:11194837-11194859 TGAAGTCTATAATTTGCATGAGG - Intergenic
1050998261 9:12246896-12246918 TGGTGTCTATAATTTGTGTGTGG + Intergenic
1051470947 9:17440978-17441000 AGTACTCTACAATTAGTGTGTGG + Intronic
1051597750 9:18842641-18842663 TAAAGTCTCCCATTATTGTGTGG + Intronic
1052724666 9:32215434-32215456 TAAAGTCTCCGATTATTGTGTGG + Intergenic
1055175086 9:73308630-73308652 TGAAATCTATAATTAATATGAGG + Intergenic
1055321958 9:75091008-75091030 TAAAGTCAACAGTTAGAGTGGGG + Intronic
1055422727 9:76161138-76161160 TGACGTCTTCCATTAGTGTATGG + Intronic
1058224200 9:102339737-102339759 TAAAGTCTCCCATTATTGTGTGG - Intergenic
1058393539 9:104524246-104524268 TGACGTCTGCCATTATTGTGAGG - Intergenic
1061731463 9:132617754-132617776 TGAAGTCTACATCTAATGTATGG + Intronic
1188968093 X:36579786-36579808 TCAAGTCAACAACTAGTTTGGGG - Intergenic
1189749321 X:44203402-44203424 TGATGGCTACCATTAGAGTGGGG - Intronic
1190556291 X:51639018-51639040 TGAATACTAAAATTAGTGTATGG + Intergenic
1193104971 X:77660881-77660903 AAAAGTCTACAATGAGTGTCAGG - Intronic
1193355296 X:80513087-80513109 TTAAGTCTACCATTACTGTTGGG + Intergenic
1194072745 X:89348110-89348132 TCAAGTCTCCCATTATTGTGTGG + Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1198994748 X:142561429-142561451 GGAAGTGTACAAATAGGGTGTGG - Intergenic
1199904123 X:152207028-152207050 AGAGATCTAGAATTAGTGTGGGG - Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1200726983 Y:6683850-6683872 TCAAGTCTCCCATTATTGTGTGG + Intergenic
1200728135 Y:6699625-6699647 TCAAGTCTCCCATTATTGTGTGG + Intergenic
1201245635 Y:12001066-12001088 TAAAGTCTCCTATTATTGTGTGG + Intergenic