ID: 983891105

View in Genome Browser
Species Human (GRCh38)
Location 4:173031081-173031103
Sequence CCCACTGTGGATGCTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983891098_983891105 5 Left 983891098 4:173031053-173031075 CCTGCAGGGCCTCATAATAGTCA 0: 1
1: 1
2: 3
3: 6
4: 76
Right 983891105 4:173031081-173031103 CCCACTGTGGATGCTGGCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 214
983891100_983891105 -4 Left 983891100 4:173031062-173031084 CCTCATAATAGTCACTGGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 110
Right 983891105 4:173031081-173031103 CCCACTGTGGATGCTGGCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983891105 Original CRISPR CCCACTGTGGATGCTGGCTT TGG Intronic
900280370 1:1863428-1863450 CCCACTGTGGCTGCTGCCACTGG + Intronic
901196612 1:7443827-7443849 CCCCCTGTAGAGGCTGTCTTGGG - Intronic
901674221 1:10873469-10873491 CCCAGTCTGGTTGCTGGCCTGGG + Intergenic
901956386 1:12788600-12788622 CCCAGTGTGGATTCTGGGATTGG + Intergenic
902002318 1:13204283-13204305 CCCAGTGTGGATTCTGGGATTGG - Intergenic
903128579 1:21263769-21263791 CCCACTGCCAATGCTGGCTGGGG + Intronic
905309176 1:37037628-37037650 CCCACTGGGGCTGCTGCCTGCGG + Intergenic
905407853 1:37748516-37748538 CACTATGGGGATGCTGGCTTTGG - Intronic
906360432 1:45152672-45152694 ACCATTCTGGATGCTGGCCTTGG + Intronic
906560167 1:46750723-46750745 CTCTCTTTGGATGCTTGCTTTGG + Intergenic
909249031 1:73327906-73327928 CCAAATGAGGCTGCTGGCTTTGG - Intergenic
909577983 1:77196890-77196912 ACCATTCTGGATGCTGGCCTTGG - Intronic
910334331 1:86110681-86110703 CCCTCTGTAGCTGCTGGCCTGGG - Intronic
912384665 1:109265320-109265342 GCCACAGTGGAGGCTTGCTTGGG - Intronic
913965788 1:143376707-143376729 TCCACTGTGGATTCAGGCTTGGG - Intergenic
914060162 1:144202315-144202337 TCCACTGTGGATTCAGGCTTGGG - Intergenic
914118988 1:144764054-144764076 TCCACTGTGGATTCAGGCTTGGG + Intergenic
914975087 1:152353863-152353885 CGAACTGTGGATCCTGACTTTGG + Exonic
917977233 1:180248044-180248066 CAGGCTGTGGATTCTGGCTTGGG - Intronic
918972121 1:191433183-191433205 CCCACTGTGGGGGATGGGTTTGG - Intergenic
919859776 1:201731882-201731904 CCCTCTGTGGAGGCTCGCTGTGG - Intronic
922735678 1:227977149-227977171 CCCACTGTGGGAGAAGGCTTGGG + Intergenic
922897508 1:229111875-229111897 CCCACACTGGAGGCTGGGTTAGG - Intergenic
1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG + Intergenic
1063267781 10:4473591-4473613 CCCATAGTGGATGCGGGCATGGG + Intergenic
1067222514 10:44354077-44354099 CCCACTGAGGTGGCTGGCTTGGG - Intergenic
1071852268 10:89585985-89586007 GCCTCTGTGGACTCTGGCTTTGG - Intronic
1073193455 10:101668875-101668897 CCCTCTGTTGCTGCTGTCTTGGG - Intronic
1075294122 10:121258120-121258142 TCCACTGTGGATGGTCACTTGGG - Intergenic
1075987547 10:126800543-126800565 CCCAAGGTGTCTGCTGGCTTTGG - Intergenic
1078146186 11:8723168-8723190 CCCAGTGTGGCTGCTGCCGTGGG + Intronic
1081602182 11:44503156-44503178 CCCAGTGTGGCTGATGGCATGGG - Intergenic
1083617865 11:64035505-64035527 TCCACGGTGGAGGTTGGCTTTGG + Intronic
1083724832 11:64622723-64622745 CCCACTCTGGCTGGTGGATTAGG - Intronic
1083793294 11:64999782-64999804 CCCACTGGGGCTGCTGGCTCTGG - Intergenic
1083833241 11:65246987-65247009 GCCACTCTGGTTGCTGGATTTGG + Intergenic
1083977836 11:66138327-66138349 CCCACTTTGGGTGGTTGCTTGGG - Intronic
1084510500 11:69600711-69600733 CCTGCTGTGGGTGCTGGCCTTGG - Intergenic
1087063235 11:94003490-94003512 CCCACTGTACATGGTGGGTTTGG + Intergenic
1090068469 11:123524164-123524186 CCCACTGAGGAGGAGGGCTTGGG - Intergenic
1094224336 12:28028431-28028453 CCGACTGTGGATACTGCCTCGGG + Intergenic
1095898871 12:47306968-47306990 CGCGTTGTGGCTGCTGGCTTGGG - Intergenic
1100911093 12:99364587-99364609 CACCCTGTGGATTCTGACTTCGG + Intronic
1101719108 12:107335686-107335708 CCCACAGTGGATGTGTGCTTTGG + Intronic
1102642454 12:114379059-114379081 CCCACAGTTGATGCTGCTTTTGG - Intronic
1104390102 12:128384735-128384757 CCCACTGTGGGAGGTGGATTTGG - Intronic
1104535234 12:129612313-129612335 CCCACTGTGGATGTTGACAAGGG - Intronic
1109111017 13:58318758-58318780 CCCTCTGCAGCTGCTGGCTTGGG + Intergenic
1111097957 13:83539080-83539102 CCCACCTTGGCTGGTGGCTTTGG - Intergenic
1113351155 13:109530571-109530593 CTCACTTTGGATGCAGGGTTTGG - Intergenic
1114055221 14:18962800-18962822 GCCACTGATGATGCTGGGTTTGG + Intergenic
1114079551 14:19191656-19191678 CCCATTATGGAAGCTGGATTTGG - Intergenic
1114107322 14:19438976-19438998 GCCACTGATGATGCTGGGTTTGG - Intergenic
1114780408 14:25532748-25532770 CCCATTGTGGATGTTGTCATGGG + Intergenic
1114852212 14:26394859-26394881 CTCACTGTGGTTTCTGCCTTCGG + Intergenic
1115503783 14:34074440-34074462 CCCATTATTGATGCTGACTTTGG - Intronic
1115630552 14:35240685-35240707 ATCACTGTGATTGCTGGCTTGGG - Intronic
1115932102 14:38508583-38508605 CCCACTGTGCAAGCTGGCAGTGG + Intergenic
1118734650 14:68692553-68692575 TCCTCTCTGGAAGCTGGCTTTGG - Intronic
1120181136 14:81343238-81343260 CCCACAGAGGATGCTGGGATTGG - Intronic
1122005298 14:98698517-98698539 CCCAGTGTGGCCGCTGGCATGGG + Intergenic
1122348312 14:101073742-101073764 CCCACAGGGGAGGGTGGCTTCGG + Intergenic
1122967145 14:105136675-105136697 CCCACTGTGGATGGTGGGATGGG - Intergenic
1124927532 15:34085920-34085942 CTCACTGTGGAGCCTGGCATTGG + Intronic
1125765255 15:42131218-42131240 CCCGCTGTTGATCCAGGCTTTGG - Intergenic
1126456301 15:48865788-48865810 ACCCCTGGGGATCCTGGCTTGGG - Intronic
1126898219 15:53283050-53283072 CCCACAGGGTATGCTGGGTTTGG + Intergenic
1128674514 15:69598772-69598794 ACCCCTGTGGATACTGGTTTGGG + Intergenic
1128678589 15:69629744-69629766 CCCATTGTGGAGGCTGTTTTGGG + Intergenic
1129194650 15:73956645-73956667 CCCCCTGAGGCTGCTGGCATTGG + Intergenic
1131217465 15:90550801-90550823 CTCACTGAGGATGCAGGCCTGGG + Intronic
1131438619 15:92442171-92442193 CTCAGTGAGGATGCTGGGTTGGG - Intronic
1135525414 16:23210191-23210213 CCCTCTCTGGATGATGGCCTTGG + Intronic
1136412843 16:30086792-30086814 GCCTCTGTGGCTGCTGGCTCTGG + Exonic
1136453794 16:30369645-30369667 GCCACTGTGGTTCCCGGCTTGGG + Exonic
1138496824 16:57413938-57413960 CCCACTGAAGATGCTGGCCCTGG + Exonic
1139707263 16:68749804-68749826 CCCACTGGAGATGCTGAGTTTGG - Intronic
1139707270 16:68749854-68749876 CCCACTGGAGATGCTGAGTTTGG - Intronic
1140054965 16:71517519-71517541 CCCAATGTTGATTCTGGTTTTGG + Intronic
1140408980 16:74730062-74730084 CCCGCTGTGGCTGCAGGCTTTGG - Intronic
1141763552 16:86044436-86044458 CCCACTGTGCTGGCTGGCCTGGG + Intergenic
1141821510 16:86449442-86449464 CCGGCTGTGGTTGCTGGCTGAGG + Intergenic
1142458568 17:73020-73042 ACCACTGTGAAGACTGGCTTGGG - Intergenic
1142873978 17:2840073-2840095 ACCACTGTTGATGTTGGCCTTGG + Intronic
1143449034 17:7024667-7024689 TCCACTGGGGAGCCTGGCTTGGG - Exonic
1144460526 17:15455135-15455157 ACAAGTGTGGATGCTGTCTTGGG + Intronic
1146811452 17:35907078-35907100 CCTGCTCTGGATGCTGGTTTGGG + Intergenic
1149999695 17:61426020-61426042 CCTGCTGTGTATGCTGACTTAGG + Intergenic
1150246776 17:63681844-63681866 CTCACTGTTGATGCTGGTGTAGG - Exonic
1150475241 17:65470076-65470098 CCCTGTGTGGAGGCTGGCATGGG + Intergenic
1151696253 17:75719490-75719512 CCCACTGTGGGTGGGGGCTGAGG - Intergenic
1151980668 17:77506625-77506647 CCCACGGTGGCTCTTGGCTTGGG - Intergenic
1152660427 17:81539526-81539548 CCCACTGAAAATGCTGGGTTTGG + Intergenic
1155327242 18:24677030-24677052 ACCATTGTGAATGCTGGCATTGG + Intergenic
1156196905 18:34784609-34784631 TGCACTGTGGATGTGGGCTTTGG + Intronic
1157141071 18:45107171-45107193 CCCATTGTGGAAGCTGCTTTAGG - Intergenic
1159732559 18:72048494-72048516 ACCATTGAGGATGTTGGCTTTGG - Intergenic
1159944350 18:74432778-74432800 CTCTCTGTGGATGCTGGTCTTGG - Intergenic
1160709363 19:544036-544058 CCCAGTGTGGGTGCTGGCCCCGG - Exonic
1160794919 19:940871-940893 GCCACTGTGGCTGCTGGCGCCGG + Intronic
1161481299 19:4512049-4512071 CCCACTGTAGATGGTGTCCTTGG + Exonic
1162178137 19:8847016-8847038 CCACCTGTGGATGCTGCCATGGG - Intergenic
1164554571 19:29241266-29241288 CCTTCTGTGTGTGCTGGCTTTGG - Intergenic
1164597253 19:29538376-29538398 CACTCAGTGGATGTTGGCTTTGG + Intronic
1165094118 19:33401360-33401382 CCCACTCTGGACACTGGCATGGG - Intronic
1166088491 19:40492628-40492650 CACACTGTGGATGCAGGAGTGGG + Intronic
1168192772 19:54751854-54751876 CCCTCTGTGGCTGCTGCCTTGGG - Intronic
1168194859 19:54766682-54766704 GCCTCTGTGGCTGCTGCCTTGGG - Intronic
1168197108 19:54783124-54783146 GCCTCTGTGGCTGCTGCCTTGGG - Intronic
1168436018 19:56317529-56317551 CCCTCTGTGGAATCTGGCTGGGG - Intronic
1202699566 1_KI270712v1_random:154200-154222 TCCACTGTGGATTCAGGCTTGGG - Intergenic
926013715 2:9429228-9429250 CCCACTGGGGCTGCCGGCCTTGG + Intronic
927433609 2:23047956-23047978 CCCACTGTGAGTGATGGCTCAGG - Intergenic
928127640 2:28627367-28627389 GACACTGTGGACGCTGGCGTAGG + Intronic
928316806 2:30252786-30252808 CCCAATGTGGCTGCTGGATGTGG + Intronic
928324514 2:30309019-30309041 CCCAGAGTTGATGCTGGCCTGGG - Intronic
929138920 2:38650442-38650464 CCCACTGTTGCTGTTGGATTTGG + Intergenic
932476967 2:72012503-72012525 CTCTCTGTGGTTGCTGTCTTGGG + Intergenic
933130631 2:78669283-78669305 ACCATTCTGGATGCTGGCTTTGG + Intergenic
937859678 2:126697923-126697945 CCCAGTGTGGATGCTGACACTGG + Intergenic
938190436 2:129274571-129274593 CCCATTGTGGAAGCTGGTTAAGG - Intergenic
938885164 2:135639033-135639055 TCCACTGAAGCTGCTGGCTTTGG - Exonic
942400536 2:175597471-175597493 ACCACTCTGGATGTTGGCCTTGG - Intergenic
948453125 2:238090986-238091008 CCCACTGTGGGTGATGTGTTGGG - Intronic
948517430 2:238512428-238512450 CCCACTGTGGCTGCTGGCTGAGG + Intergenic
1170930879 20:20768574-20768596 CCCTCTGTGGCTGCTGGCCCAGG - Intergenic
1170960349 20:21020104-21020126 CGCCCTGTGGAAGCTGGCTGTGG - Intergenic
1171303086 20:24080783-24080805 CTCACTGTGCATTCTTGCTTTGG + Intergenic
1171443606 20:25187204-25187226 CCCACTGGGCAGCCTGGCTTGGG + Intergenic
1172701263 20:36855011-36855033 CCCTCTGTGGGTGTTGGCTTGGG - Intronic
1172777408 20:37415543-37415565 CCCCCTGTGGGTGCTGGGTCAGG - Intergenic
1175587077 20:60149616-60149638 CCCACTGTGGGGGCTGCCTTTGG - Intergenic
1177006744 21:15682621-15682643 ACCAATGTGGATTCTGCCTTGGG + Intergenic
1179255598 21:39712754-39712776 TCCACGGTGAATGCTGTCTTGGG + Intergenic
1180026188 21:45163584-45163606 CCCACTGGGGACGCTGACTCTGG + Intronic
1180473703 22:15685352-15685374 GCCACTGATGATGCTGGGTTTGG + Intergenic
1180501215 22:15931042-15931064 CCCATTATGGAAGCTGGATTTGG + Intergenic
1182132172 22:27862844-27862866 CCTGTTGTGGATGCTGGCTTGGG + Intronic
1182471766 22:30553293-30553315 CCCACTGGGGATGCTGAATGAGG + Intergenic
1182499371 22:30734532-30734554 CCCACTGTGAGTCCTGGCTGAGG - Intronic
1182875885 22:33690727-33690749 GCCAAGGTGGAGGCTGGCTTGGG + Intronic
1182904978 22:33928018-33928040 CTCAGTTTGGATGCTGGTTTGGG - Intergenic
1183004521 22:34890175-34890197 CCCACTGGGGATGCTGTGTGGGG - Intergenic
1183520242 22:38292691-38292713 CCCACTCTGGGGCCTGGCTTGGG - Intronic
1184452861 22:44593205-44593227 GCCACTGTGGAGGCTGAGTTGGG - Intergenic
1184821319 22:46910948-46910970 CACAATGTGGGTGCTGGCTGGGG + Intronic
1185029485 22:48434207-48434229 CGCACTGTGGATGTTGGGTCCGG - Intergenic
949481086 3:4494094-4494116 TCCAATGAGGATGCGGGCTTCGG + Intronic
949739444 3:7213686-7213708 CCCATAGTGGATTCTGGGTTGGG + Intronic
951620548 3:24597306-24597328 TCCACTGTTAATGATGGCTTTGG + Intergenic
951732583 3:25826750-25826772 CACACTGTGGCTTCTGCCTTAGG + Intergenic
952823393 3:37504621-37504643 CCCAGTTTGGATGATGGGTTTGG + Intronic
955089650 3:55737008-55737030 CCCAATGTGGAGGCTTCCTTGGG - Intronic
955393074 3:58535298-58535320 CCCCCTGTGGACACTGGCTGTGG + Intronic
955719494 3:61866406-61866428 CCCACTGTGCAGGCTGGAGTAGG + Intronic
957156601 3:76551735-76551757 CCCACAGTGGAAGCTGCCTGTGG + Intronic
958964381 3:100542374-100542396 ACCATTCTGGATGTTGGCTTTGG + Intronic
961314103 3:126022813-126022835 CACACTGTCCATTCTGGCTTTGG - Exonic
962191503 3:133315649-133315671 GCCACTGTGGCTGTTGGGTTTGG - Intronic
963686975 3:148448129-148448151 CACACTGTGGACTCTGGGTTTGG - Intergenic
963750612 3:149175601-149175623 TGCACTGTGGCTGCAGGCTTTGG - Intronic
966881981 3:184355620-184355642 CACACTGGGGCTGTTGGCTTTGG + Intronic
967519590 3:190414576-190414598 CCCAGTGTGGAAGCTGCTTTTGG - Intergenic
969029286 4:4198180-4198202 TCCACCGTGGATTCAGGCTTGGG + Intronic
969531614 4:7733833-7733855 CCCACTGGGGATGGAGGCTGTGG - Intronic
970280367 4:14448407-14448429 CTCAGTGTGGATCCTGGCTTGGG - Intergenic
970307821 4:14751544-14751566 CCCACTGTGGATTATGTCTGAGG - Intergenic
971234485 4:24829023-24829045 CAGCCTGTGGATGCTGTCTTTGG + Intronic
977761128 4:100738565-100738587 ACTGGTGTGGATGCTGGCTTTGG + Intronic
977957144 4:103042124-103042146 CCCACAGTGAATGCTGTCTATGG + Intronic
978318139 4:107463081-107463103 CAAAGTGAGGATGCTGGCTTGGG + Intergenic
979260263 4:118637770-118637792 CCCCCTGTGGGTGAAGGCTTGGG + Intergenic
982243351 4:153322907-153322929 CCTAGTGTGTTTGCTGGCTTTGG + Intronic
983891105 4:173031081-173031103 CCCACTGTGGATGCTGGCTTTGG + Intronic
984475117 4:180225479-180225501 CGCACTGTGAATTTTGGCTTTGG - Intergenic
995635098 5:114179297-114179319 ACCTCTGTTCATGCTGGCTTTGG + Intergenic
995719424 5:115114528-115114550 ACCACTCTGGATACTGGCCTTGG + Intergenic
996658209 5:125967061-125967083 CTCATGGTGGATGCTGGCCTAGG - Intergenic
997166238 5:131662562-131662584 CCCACAGTGGTGGGTGGCTTGGG + Intronic
998417411 5:141955848-141955870 CCCAATGAGGCTGCTGGCATTGG + Exonic
999671733 5:153964585-153964607 CCAGCTGTGGATGAGGGCTTGGG - Intergenic
1000038482 5:157467042-157467064 TCCACAGTGGATGGAGGCTTCGG + Exonic
1001866088 5:175106757-175106779 CCCACTGAGGCTACTGGCATTGG + Intergenic
1002349192 5:178570984-178571006 CCCAGTGTGAATGCTGTCTGCGG - Intronic
1005412299 6:25562827-25562849 CCCAATTTGGGTGCTGGTTTTGG - Intronic
1005719787 6:28590021-28590043 CCCTCCGGGGCTGCTGGCTTTGG - Intronic
1006633574 6:35446416-35446438 CCCAGTGAGGAGGCTGGCCTGGG + Intergenic
1008593124 6:53013661-53013683 CCGACTGTGGATGCTTGTTGTGG + Exonic
1009242477 6:61198943-61198965 CCCAGTGTGGATGCTGTGTAGGG - Intergenic
1011294410 6:85810745-85810767 CCCACTGTAGATGCTGCAGTGGG - Intergenic
1012036326 6:94145587-94145609 CCCAGTGGGGATGATTGCTTTGG + Intergenic
1013608178 6:111770106-111770128 CCCAGTGTGGCTACTGGCTATGG - Intronic
1015842702 6:137490996-137491018 TCCACTGTAGATGCTAACTTAGG + Intergenic
1016858918 6:148698264-148698286 CCCCCTGCAGATGCTGGCCTGGG + Intergenic
1019368430 7:647323-647345 GCCACAGGTGATGCTGGCTTGGG - Intronic
1022510513 7:30932393-30932415 CCCATTGTAAATGCTGGCCTGGG + Intergenic
1022643106 7:32206533-32206555 CCCACTGTGGCTCCTGACATTGG - Intronic
1023253697 7:38291619-38291641 ACCACTGTGCCTGCTGGATTAGG - Intergenic
1027557549 7:79685169-79685191 GCTACTGTGTCTGCTGGCTTTGG - Intergenic
1028185325 7:87778193-87778215 CCCACTGGGGAGGCTGAGTTGGG + Intronic
1029205323 7:98866351-98866373 CACCCTGTTGGTGCTGGCTTTGG - Intronic
1029664795 7:101988300-101988322 CCCACTTTGGAGGCTGGGGTGGG + Intronic
1030117072 7:106070172-106070194 ACCACCGTGGATTCTGGCTGTGG - Intergenic
1032052494 7:128657763-128657785 CCCACTGTGGGAGAAGGCTTGGG + Intergenic
1032783506 7:135183072-135183094 CCCACTGTGCACGCTGTATTCGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035621101 8:1036330-1036352 GCTGCAGTGGATGCTGGCTTGGG + Intergenic
1039230624 8:35443240-35443262 CCTACTGTGTGTGCTGTCTTGGG + Intronic
1041548106 8:59069290-59069312 CCCTCCGTGGATGCTGGCTGGGG + Intronic
1042188853 8:66165164-66165186 CCCATTGTCCATCCTGGCTTAGG - Intronic
1042193184 8:66208707-66208729 CCCACAATGGATGCTGGATATGG + Intergenic
1042523355 8:69738038-69738060 ACCAGTGTAGATGCTGGCATTGG + Exonic
1044934497 8:97279638-97279660 CCCAATGTGGTTGGTGGCCTTGG + Intergenic
1044962287 8:97542816-97542838 CCCACAGTCCCTGCTGGCTTGGG + Intergenic
1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG + Intergenic
1049710051 8:144059370-144059392 CCCACCCTGGATGCTGGTGTGGG - Intronic
1049874352 8:145006422-145006444 CCCACTGTGGTTTCATGCTTTGG + Intergenic
1050160882 9:2717855-2717877 CCAGCCGTGGATGCTGGCCTGGG - Exonic
1051582529 9:18693410-18693432 CCCACTGTGGCTGCTCAGTTTGG + Intronic
1052780765 9:32780394-32780416 CCCACTGTTGCTGCTGACTTGGG + Intergenic
1058540144 9:106003187-106003209 GCCACTGTGGATGGTGTCTAGGG + Intergenic
1058597630 9:106631821-106631843 CCCACTGTGGACTGCGGCTTTGG - Intergenic
1059581695 9:115556149-115556171 CCCCCTGTGGATGCTTTCTTGGG + Intergenic
1060906156 9:127307895-127307917 ACCACTGTGGAGTCTGGCTGAGG + Intronic
1061209460 9:129182419-129182441 CCCACTGTGGACCCGGCCTTTGG - Intergenic
1061610176 9:131740468-131740490 CCCACAGGGGATGCTGGGTCCGG - Intergenic
1061644085 9:131985150-131985172 CCTGCTCTGGATGCTTGCTTTGG + Intronic
1062029550 9:134356043-134356065 CTCACTGTGGGATCTGGCTTGGG + Intronic
1062103407 9:134739855-134739877 GCCAGTGGGGATGCTTGCTTGGG + Intronic
1189177836 X:38975722-38975744 CACACTGTGGATGATGTCATAGG + Intergenic
1193991157 X:88309032-88309054 ACCACTGTGGACGTTGGCCTTGG - Intergenic
1195792934 X:108608804-108608826 GCCACTGTGGATGATGGGATAGG - Intronic
1198435157 X:136609874-136609896 CCCACTATGGTGGCTGTCTTGGG - Intergenic